Skip to main content

Full text of "Nota lepidopterologica"

See other formats





NOTA 



LEPIDOPTEROLOGICA 



A Journal devoted to the study of Lepidoptera 

Published by Societas Europaea Lepidopterologica (SEL) 




Vol. 25 No. 1 2002 



SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e. V. 



http://www.zmuc.dk/entoweb/sel/sel.htm 



Council 



President 

Vice-President: 

General Secretary: 

Treasurer: 

Membership Secretary: 

Ordinary Council Members: 



Editor in chief: 
Assistant Editor: 



Prof. Dr. Niels P. Kristensen (DK) 

Prof. Dr. Jacques Lhonoré (F) 

Dr. Christoph L. Häuser (D) 

Manfred Sommerer (D) 

Willy O. de Prins(B) 

Dr. David Agassiz (UK), 

Prof. Dr. Jaroslaw Buszko (PL), 

Michael Fibiger (DK), Dr. Elisenda Olivella (E), 

Dr. Alberto Zilli (I) 

Prof. Dr. Konrad Fiedler (D) 

Dr. Matthias Nuß (D) 



Honorary Members 

Pamela Gilbert (GB), Barry Goater (GB), Prof. Dr. Lâszlô Gozmâny (H), Prof. Dr. 
Vladimir Kuznetzov (RU), Prof. Dr. Clas M. Naumann (D), Dr. P. Sigbert Wagener (D) 



Copyright © Societas Europaea Lepidopterologica (SEL) 

ISSN 0342-7536 

Printed by druck- zuck GmbH, Halle/Saale, Germany 

All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or 

mechanical including photocopying, recording or any other information storage and retrieval system, without written 

permission from the publisher. Authors are responsible for the contents of their papers. 




Nota lepidopterologica 

Ajournai devoted to the study of Lepidoptera 
Published by the Societas Europaea Lepidopterologica e 

Editor in chief: Prof. Dr. Konrad Fiedler, Lehrstuhl für Tierökologie I, Universität Bayreuth, 

D-95440 Bayreuth, Germany; e-mail: konrad.fiedler@uni-bayreuth.de 
Assistant Editor. Dr. Matthias Nuß, Staatliches Museum für Tierkunde, Königsbrücker Landstr. 159, 

D-01109 Dresden, Germany; e-mail: nuss@snsd.de 
Editorial Board: Dr. Enrique Garcia-Barros (Madrid, E), Dr. Roger L. H. Dennis (Wilmslow, UK), 

Dr. Peter Huemer (Innsbruck, A), Ole Karsholt (Kobenhavn, DK), Dr. Yuri P. Nekrutenko (Kiev, UA), 

Dr. Erik J. van Nieukerken (Leiden, NL), Dr. Wolfgang Speidel (Bonn) 



Contents • Inhalt • Sommaire 
Volume 25 No. 1 Halle / Saale, Ol. 08. 2002 ISSN 0342-7536 

Erratum 2 

The discovery, description and taxonomy of Paysandisia archon 

(Burmeister, 1880), a castniid species recently found in southwestern 

Europe (Castniidae) 

by Victor Sarto i Monteys 3 

Synonyms of European Tortricidae and Noctuidae, with special reference 
to the publications of Hübner, Geyer and Frölich 
by Wolfgang Speidel & Leif Aarvik 17 

Comparison of factors influencing the habitat characteristics 

of Gortyna borelii (Noctuidae) and its larval foodplant Peucedanum officinale 

in England and Germany 

by Zoë Ringwood, Tim Gardiner, Axel Steiner & Julian Hill 23 

Experimental evidence for specific distinctness of the two wood 
white butterfly taxa, Leptidea sinapis and L. reali (Pieridae) 
by Anja Freese & Konrad Fiedler 39 

Notes on systematics of the Erebia dabanensis species complex, with 

special consideration of the dabanensis-youngi and anyuica-occulta pairs 

of sibling species (Nymphalidae: Satyrinae) 

by Allxei G. Belik & Dmitry G. Zamolodchikov 61 

Chazara persephone (Hübner, [1805]) or Chazara anthe (Hoffmansegg, 1806) - 
what is the valid name? (Nymphalidae, Satyrinae) 
by Sigbert Wagenlr 81 

Book Reviews 16, 22, 60, 79 



Erratum 

The editors apologize for a missing indication of authorship for the book review of 
Lastuvka, Z. & A. Lastuvka, 2001, The Sesiidae of Europe published in Nota 
lepidopterologica 24 (4): 85-86. This review has been written by Axel Kallies. 



Notalepid. 25(1): 3-15 



The discovery, description and taxonomy of Paysandisia archon 
(Burmeister, 1880), a castniid species recently found in south- 
western Europe (Castniidae) 

Victor Sarto i Monteys 

Departament d'Agricultura, Ramaderia i Pesca-Fundaciö CReSA/Entomologia, Universität Autônoma de 
Barcelona. Campus de Bellaterra, edifici V, 08193 Bellaterra, Barcelona, Spain. E-mail: victor.sarto@uab.es 



Summary. Paysandisia archon (Burmeister, 1880) is an attractive castniid moth whose presence in 
Europe has been recently reported. Its larvae are endophagous (the first instar can be partly exophagous) 
and feed inside the trunks and branches of several species of Arecaceae (palm trees), such as Trachy carpus, 
Trithrinax, Phoenix, Chamaerops, Butia, Washingtonia, Brahea, Livistona and Syagrus. The present 
paper deals with the historical aspects of its discovery in the Argentine province of Catamarca, becoming 
the first castniid species ever found in Argentina. Details concerning its description by Hermann 
Burmeister, based on probably only two specimens that he did not collect himself, and the subsequent 
taxonomy of this moth, which was originally included in the genus Castnia Fabricius, 1807, are reported. 
Widespread errors concerning the original date of publication of archon (which is 1880) as well as that 
of its synonym josepha Oberthür (which is 1914) are discussed and corrected. The only known 
paralectotype of Castnia archon Burmeister, 1880, a male, is figured (Museo Argentino de Ciencias 
Naturales "Bernardino Rivadavia", Buenos Aires). 

Zusammenfassung. Seit kurzem ist die ursprünglich südamerikanische Art Paysandisia archon (Bur- 
meister, 1880) (Castniidae) auch aus Spanien und S-Frankreich bekannt. Die Larven leben endophag 
(die des ersten Stadiums z.T. exophag) im Stamm von Palmen (Arecaceae) wie Trachy carpus, Trithrinax, 
Phoenix, Chamaerops, Butia, Washingtonia, Brahea, Livistona und Syagrus. Hier wird die Entdeckungs- 
geschichte in der argentinischen Provinz Catamarca dargestellt. P. archon war die erste aus diesem 
Land bekannt gewordene Castniiden-Art. Einzelheiten zur Erstbeschreibung durch Hermann Burmeister 
und die taxonomische Beurteilung von P archon (die zunächst der Gattung Castnia Fabricius, 1807 
zugeordnet wurde) durch spätere Autoren werden berichtet. Irrtümer zum Jahr der Originalbeschreibung 
von archon (1880) und dem subjektiven Synonym josepha Oberthür (1914) werden diskutiert und 
berichtigt. Der einzig bekannte männliche Paralectotypus von Castnia archon Burmeister, 1880 wird 
abgebildet (aufbewahrt im Museo Argentino de Ciencias Naturales "Bernardino Rivadavia", Buenos 
Aires). 

Résumé. Paysandisia archon (Burmeister, 1 880) est un attirant castnidien dont la présence vient d'être 
récemment signalée en Europe. Ses larves sont endophages (le 1er. stade peut être partiellement 
exophage) et elles se nourrissent à l'intérieur des troncs et des branches de plusieurs espèces d'Arecaceae 
(palmiers), telles que Trachycarpus, Trithrinax, Phoenix, Chamaerops, Butia, Washingtonia. Brahea, 
Livistona et Syagrus. Ce travail traite exclusivement de certains aspects historiques concernant sa 
découverte dans la province Argentine de Catamarca, devenant ainsi la 1ère espèce de castnidien 
trouvée en Argentine. Y sont ajoutés des détails de la description faite par Hermann Burmeister, basée 
très probablement sur uniquement deux exemplaires qui n'avaient même pas été capturés par lui. et de 
la taxonomie subséquente de cet insecte qui à l'origine avait été inclu dans le genre Castnia Fabricius. 
1807. On y discute et corrige des erreurs largement répandues sur la date originale de publication 
à" archon (qui est 1880) ainsi que celui de son synonyme josepha Oberthür (qui est 1914). On y figure 
le seul paralectotype connu, un mâle, pour Castnia archon Burmcister, 1880 (Muséo Argentino Je 
Ciencias Naturales "Bernardino Rivadavia", Buenos Aires). 

Resumen. Paysandisia archon (Burmeister, 1880) es un atractivo câstnido cuva presencia en Europa 
se ha dado a conocer rccicntcmente. Sus larvas son endôfagas (cl primer estadio puede sei parcialmente 
exôfago), y se alimentan en el interior de troncos y ramas de varias especies de Arecaceae (palmeras), 
taies como Trachycarpus. Trithrinax. Phoenix. Chamaerops. Butia. Washingtonia, Brahea, livistona 
y Syagrus. El présente trabajo trata tan solo de aspectos histôricos relativos a su descubrimiento en la 
provincia Argentina de Catamarca, convirtiéndosc en la primera especie de câstnido ballada en 
Argentina. Se aportan detalles de su descripciôn por Hermann Burmeister, basada probablemente en 
tan solo dos ejemplares que no habian sido capturados por el mismo, y de la subsiguiente taxonomia 
de esta polilla, la cual habia sido originalmente incluida en el género Castnia Fabricius, 1807. Se 
discuten y corrigen errorcs ampliamente extendidos sobre la fecha original de pubheaeion de archon 
(que es 1880) asi como el de su sinônimo josepha Oberthür (que es 1914). Se figura el ûnico 

© Nota lepidopterologica. 01.08.2002. ISSN 0342-7536 



Sarto: Paysandisia archon 



paralectotipo conocido, un macho, de Castnia archon Burmeister, 1880 (Museo Argentino de Ciencias 
Naturales "Bernardino Rivadavia", Buenos Aires). 

Key words. Paysandisia, archon, Castniidae, Europe, Arecaceae, pest status, history, taxonomy 



Introduction 

Paysandisia archon is an attractive castniid moth whose presence in Europe was recently 
indicated by Aguilar et al (2001) as having a well established population in the north- 
eastern Spanish province of Girona, within Catalonia. In the following towns, arranged 
from north to south, larvae were found within palm trunks: Cornelia de Terri, Sant 
Feliu de Pallerols, Les Planes d'Hostoles, Bordils, La Cellera de Ter, Angles. Towns in 
that province where typical damage on the palms has been detected (although trunks 
were not cut open to look for the larvae) are, at the time of writing, as follows: Vila- 
Sacra, Sant Père Pescador, Pontôs, Bàscara, L'Escala, Torroella de Montgri, Cornelia 
del Terri, Sant Feliu de Pallerols, Les Planes d'Hostoles, Bordils, Jafre, Celrà, La Pera, 
Sant Gregori, Cervià, La Cellera de Ter, Angles, Bescanô, Palafrugell, Vall-Llobrega, 
Vilobi d'Onyar, Santa Coloma de Farners, Caldes de Malavella, Llagostera, Santa 
Cristina d'Aro, Castell-Platja d'Aro, Arbücies, Sant Feliu de Buixalleu, Breda. In 
September 2001, several adults were seen flying around palm trees at the locality of 
Cardedeu, the first record in the province of Barcelona. Later, its presence was also 
reported from south-eastern France (Sarto i Monteys & Aguilar 2001; Drescher & 
Dufay 2001), in the areas of Hyères and Toulon (Departement de Var). 

The larvae of this moth are endophagous (the first instar can be partly exophagous) 
and feed mainly inside the trunk of several species of Arecaceae (palm trees), such as 
Trachycarpus, Trithrinax, Phoenix, Chamaerops, Butia, Washingtonia, Brahea, 
Livistona and Syagrus. Infected trunks may be severely damaged because of the galleries 
produced by the larvae as they bore into them, as well as by secondary infections by 
fungi and other micro-organisms that may result. Although this species is not considered 
to be a palm pest in its native habitat (north-western Argentina, Paraguayan Chaco, 
western Uruguay and the southernmost state of Brazil, Rio Grande do Sul, all located 
between 25-35° southern latitude), it certainly is so in Spain and France. Full details 
of its pest status will be given in a separate paper (Sarto i Monteys & Aguilar, in prep.). 

The present paper deals with the discovery, description and taxonomy of this castniid 
moth. While conducting a thorough bibliographic search into the historical background 
of this species several inaccuracies were discovered that require correction. 

First period: from Burmeister to Strand (1878-1913) 

Paysandisia archon was described in 1880, as Castnia archon, by Dr. Hermann Carl 
Conrad Burmeister, then Director of the Museo Publico de Buenos Aires (now the 
Museo Argentino de Ciencias Naturales "Bernardino Rivadavia"), where the types 
(actually two syntypes) are currently housed. However, if one checks the entry for 
archon in the checklist of Neotropical Castniidae (Miller 1995), the year of publication 
is given as 1879. The same year appears in Lamas' 1995 checklist in which he makes 
a very thorough and critical review of the previous checklist by Miller. This same 



Notalepid. 25(1): 3-15 



mistake is reproduced in all publications consulted where the year of description for 
archon is quoted (from Breyer 193 1 to Drescher & Dufay 2001). The only exception to 
this is that of Miller (1986) in which the correct year, 1880, is given. It seems 
inexplicable, therefore, that Miller reverted to 1879 in her 1995 checklist. 
Checking the original publication by Burmeister one can understand how the mistake 
may have originated. In 1878 Burmeister published his "Description physique de la 
République Argentine..". This book contained no plates; these were published later in 
a separate, but complementary work, the "Atlas de la description physique de la 
République Argentine..", published in two installments, or "livraisons" in French, each 
clearly stating the year of publication on its title page. The first livraison was published 
in 1879 and the second one in 1 880; the two together contained 64 text pages (the first 
(1879) pages 1^40 and the second (1880) pages 41-64) as well as 24 colour plates, 
plus one supplementary monochrome plate. 

On page 54 of the second livraison (1880), Burmeister includes a section entitled 
"Additions et corrections du tome V" and it is on page 56 where he provides the 
description of archon'. "1. Castnia archon, C.fusco-testacea; alis anticis satis angustis, 
acutis, immaculatis ; posticis aurantiacis, macula magna disci sinuosa nigra, cum 
maculis sex albidis, infasciam transversam congestis. Exp. Alar. 4-4 V2 [10-11 cm.]". 

It is worth noting that, although it is not the main subject of this paper, the date of 
publication of Castnia uruguayana (now Geyeria uruguayana) must also be 1880 and 
not 1879 as appears in some checklists, e.g. in that of Lamas (1995). Burmeister 
describes it on pages 56-57 of this second livraison. 

It is historically interesting to note that in his 1878 book (mainly dealing with 
Argentine Lepidoptera) Burmeister deals with the family Castniidae (his "Dixième 
Famille") on pages 298-301 and later {Atlas pi. IX, Fig. 13, 14) even figured the wing 
design and venation of two species. In his text, he seems very familiar with Neotropical 
castniids, giving quite accurate morphological and ethological observations, as well as 
narrating one particular encounter he had in Brazil with Castnia decussata (now Geyeria 
decussata (Godart [1824]). 

However, in 1878, no castniids had yet been found in Argentina. Burmeister ex- 
plains: "Nous avons reçu dernièrement, dans l'ouvrage de Boisduval: Spec, génér. des 
Lépid. Hétéroc. tome 1, une synopsis des espèces connues, dont l 'auteur en décrit 68 
de l Amérique tropicale et 10 de Nouvelle Hollande. Jusqu 'à présent aucune n 'a été 
trouvée dans notre territoire, mais comme des différentes Orchidées et Broméliacées 
sont indigènes dans les forêts vierges des Missions et du Grand Chaco du Nord, nous 
avons encore l 'espérance de rencontrer une ou autre espèce de ce groupe partie ulier ". 

The wait was not long as just two years later, Burmeister mentions the first castniid 
species for Argentina, a new species from the northwestern Province of Catamarca, 
which he described as Castnia archon. 

The type specimens of archon were given to Burmeister by a collector called Georg 
Ruscheweyh, who in turn had received them from an unknown collector as originating 
from the "Province of Catamarca" (as it is specified in the original description). 



Sarto: Paysandisia archon 



According to Dr. Bachmann (pers. comm.), curator of entomology at the Museo 
Argentino de Ciencias Naturales "Bernardino Rivadavia", there are only two speci- 
mens, one male and one female, of archon housed in this museum bearing a label 
handwritten by Burmeister; the labels read "Archon Burm." and are accompanied by 
another typewritten pink label reading "Typus". Because Burmeister did not designate 
a holotype in the original description, these two specimens must be considered syntypes; 
most likely they were the only ones received from Ruscheweyh. Unfortunately, no 
further labels can be found either pinned with these two specimens or within the drawer 
that contains them, so precise data on their origin is lacking. 

Concerning the type locality for archon, "Province of Catamarca", serious doubts 
arise about its validity. In fact, after Burmeister 's description in 1 880, it has never been 
found there nor in the neighbouring Province of La Rioja, both in northwestern 
Argentina. Jörgensen (1930) explains that although he lived for three years in the 
Province of Catamarca and intensively looked for castniids there, he never saw it. 
Furthermore, according to Jörgensen, the moth was also never found by Dr. Giacomelli 
in La Rioja where the latter lived nearly all his life. Moreover, not a single modern 
record exists. According to Dr. Bachmann (pers. comm.) there are virtually no palm 
stands in these two provinces and this would account for the lack of archon populations, 
since its larvae are specialized palm feeders. 

The specimens on which Burmeister based his description of Castnia uruguayana, 
just after Castnia archon in the same 1880 publication, were also received via Georg 
Ruscheweyh from an unknown collector. However, in uruguayana the exact type locality 
is given in the original description as Paysandü (Uruguay). My reckoning is that the 
two archon syntypes given by Ruscheweyh to Burmeister also came from the Uruguayan 
town of Paysandü, where archon was and is very abundant, and that they were 
mislabelled, possibly intentionally as there was an eagerness to find the first castniid 
species for Argentina. The truth will probably never be known. 

Burmeister did not provide a figure of his Castnia archon, which possibly accounted 
for some confusion as to its identity among subsequent authors, as well as the 
redescription of the species in 1914 by Oberthür as Castnia josepha (see below). 
Jörgensen (1930) figured for the first time the female syntype housed at the present 
Museo Argentino de Ciencias Naturales "Bernardino Rivadavia", from a black-and- 
white photograph made by Dr Carlos Bruch (see below), although stating incorrectly 
that it was Burmeister 's type of archon and neglecting the male syntype. This female 
syntype must be considered the archon lectotype, as according to Article 74.5 of the 
Code (ICZN 1999), Jörgensen's action constitutes a valid lectotype designation. 
Subsequently (see articles 73.2.2. and 74.1.3. of the Code), the male syntype becomes 
automatically a paralectotype; the latter is figured here (Fig.l) for the first time. 

When Embrik Strand dealt with the Neotropical Castniidae, together with Adalbert 
Seitz, who wrote a fine introduction to this group and had considerable personal 
experience himself with Neotropical castniids (Seitz & Strand 1913), they included 
"Castnia archon Burm." on page 13, but added nothing new to Burmeister 's notes, 
simply reproducing Burmeister 's original description of archon . They stated for example 
that archon is similar to the Brazilian Castnia therapon, though twice as big, more or 



Notalepid. 25(1): 3-15 




Fig. 1. Paralcctotype of Castnia archon (Burmeistcr, 1880), male, upperside and underside. Museo 
Argcntino de Ciencias Naturales "Bernardino Rivadavia", Buenos Aires. Photo: G. Lamas. 



less the same what Burmeister wrote in 1880. Obviously, they never saw an archon 
specimen and had to rely upon Burmeister's description. In fact, C. therapon, now 
known as Athis therapon (Kollar, 1839), is not as similar to archon as Burmeister first 
stated. Not surprisingly, Castnia archon is not figured in the plates of Seitz & Strand 
(1913) while Castnia therapon appears on plate 7 ofthat work. By 1913, nothing was 



8 



Sarto: Paysandisia archon 



known about the biology and distribution of Castnia archon, apart from its supposed 
type locality in the Argentine Province of Catamarca. 

Second period: from Oberthür to Houlbert (1914-1918) 

In 1914, the famous French lepidopterist Charles Oberthür reported what he believed 
was a new Castnia species (Oberthür 1914). He named it Castnia josepha after his 
fellow countryman Monsieur Joseph Petit, who presented to him four specimens, 
obtained from cocoons he had found on palms, and three cocoons. These had been 
obtained in Paysandü, a town located in western Uruguay, near the border with the 
Argentine province of Entre Rios and about 1000 km from the Argentine Province of 
Catamarca. As usual, Oberthür figured in colour (plate CCLVII) (Fig. 2) one male and 
one female of his new species josepha (superbly and accurately rendered by Jules 
Culot), although he did not use for the illustrations those first four specimens but others 
that M. Petit presented to him later (see below). He accurately described the moths 
and, concerning the cocoons (which were not figured) only stated: "Ces cocons sont 
grands et formés d'un tissu végétal très serré de fibres fines et dures, ayant une apparence 
de chiendent". Oberthür provided no information about the hostplant or biology of this 
species. The type series of josepha is currently housed in the collection of The Natural 
History Museum, London (Fig. 3). 




The correct year of description 
for josepha is 1914, not 1913 
as it appears many times in the 
literature (e.g. Houlbert 1918, 
Miller 1995). Oberthür 's Fasci- 
cle IX of his Etudes de 
Lépidoptérologie comparée 
was published in two parts, the 
first in 1913 and the second, in 
which josepha is described, in 
1914; those years are clearly 
stated on the title pages of each 
part. Many subsequent authors 
(including Aguilar et al 2001) 
cite 1913 when referring to 
josepha. Lamas (1995) correctly 
cites 1914 in his checklist. 



Fig. 2. Castnia josepha Oberthür, 
1914, male and female, reproduced 
from Oberthür 's original description. 
As indicated in the text, josepha 
Oberthür, 1914 is a synonym of archon 
Burmeister, 1880. Photo: V. Sarto i 
Monteys. 



Notalepid. 25(1): 3-15 




Fig. 3. Paysandisia archon (Burmeister, 1880) specimens (two right columns) along with other castniids 
(two left columns) belonging to the Oberthür collection deposited in drawer "Castnia 16" at The NHM 
London. Included are the "Castnia josepha" Oberthür lectotype (a male, fourth on the right column) and 
the paralectotype (a female, fifth on the same column) selected by J. Y.Miller in 1977, the lectotype only 
bears a label that reads "Uruguay, Jos. Petit, 1902". [Wing spans of Spanish bred specimens average 
7.82 cm (males; n=10) and 9.22 cm (females; n=12)] Photo: V. Sarto i Monteys. 



A milestone in the study of Neotropical Castniidae was undoubtedly the massive work 
by Constant Houlbert, a professor at the University of Rennes, which was published in 
1918 in Oberthür 's Études de Lépidoptérologie comparée. To undertake this immense 
work Prof. Houlbert had access to the extensive Neotropical Castniid collection of 
Oberthür (approximately 425 specimens, "qui renferme 105 espèces ou variétés réparties 
en 33 genres", to use his own words). In addition, he also incorporated data on all 
castniids deposited at that time in the Muséum National d'Histoire naturelle, Paris, 
assisted by the lepidopterist Ferdinand Louis Le Cerf. 

In that work Houlbert described several new genera of Neotropical Castniinae, in- 
cluding Paysandisia (see below). Miller (1995) accepted the genera established by 
Houlbert, and further refined by Rothschild (1919), Oiticica (1955) and Miller (1976, 
1980), "with some reservation". Lamas (1995) also follows Miller's arrangement 
although stating clearly that "Even though the generic arrangement adopted in Miller's 
list is completely unsatisfactory to me, for the sake of simplicity I have followed it, 
recognizing the same genera as her". 

Houlbert had never seen the type of archon, so placed it in his revision with therapon 
in the genus Orthia* Herrich-Schäffer [1853], no doubt because, according to 
Burmeister, and then repeated by Seitz & Strand (1913), who also had not seen the 
type, archon was said to be "similar" to therapon. 



t " Sarto: Paysandisia archon 

Houlbert was unaware that Burmeister 's archon was the same species as Oberthür's 
josepha. He created a new monotypic genus to include josepha, which he named 
Paysandisia after the Uruguayan town of Paysandü, where Joseph Petit had obtained 
all the specimens. Houlbert's original description of Paysandisia is as follows: 
"Ailes antérieures d'un gris rosé uniforme dans toute leur étendue, avec quelques 
points noirs (mâles) ou deux taches claires discontinues (femelles) partant de la cel- 
lule discoïdale et se dirigeant transversalement vers l'angle interne (Fig. 96). Ailes 
inférieures d'un rouge orangé, portant dans leur milieu une grande tache noire de 
forme irrégulière marquée centralement de macules blanchâtres. Le corps, en dessous, 
est d'un gris un peu jaunâtre; les antennes sont d'un gris brun. La lamelle libre des 
plantules (Fig. 97) est ovale et nous a paru fortement bombée en avant. " 

Figure 96 is a drawing that shows the wing design and maculation patterns of the 
right upperside of a female j osepha. Figure 97 is a drawing of morphological features 
of the post-tarsus, including the arolium. 

Certainly, such a generic description, based almost exclusively on wing colour and 
maculation patterns, would not be valid by today's standards. Paysandisia is maintained 
today as a valid monotypic genus by J.Y.Miller (1 986; 1 995) and Lamas (1 995), although 
my opinion is that a modern revision of the Castniini (i.e. the Neotropical Castniinae) 
is badly needed and might change the present placement. 

When Houlbert dealt with josepha, there already named as "Paysandisia josepha 
Obthr.", he reproduced the text of Oberthür's 1914 original work, adding that, apart 
from the four specimens already quoted in Oberthür's work, he was able to study eight 
more, also from Paysandü and collected again by Joseph Petit. Houlbert explains that 
one male and one female of these last eight specimens were used by Culot for making 
the beautiful colour figures reproduced in Oberthür's original work. Also important is 
the fact that for the first time some data on the hostplant and other biological details 
were published by Houlbert, thanks to the information given to him by M. Petit. These 
were as follows: "Le P. josepha vole très rapidement, à la façon des Sphinx, mais en 
plein midi, autour des Palmiers à feuilles épineuses à l'intérieur desquels vit la che- 
nille qui est blanchâtre et à tête brune. L 'éducation de la chenille est difficile à réaliser, 
mais la recherche des cocons, presque toujours fixés à l'aisselle des pétioles, fournit 
aux chasseurs le moyen d'obtenir rapidement un grand nombre de Papillons vivants. 
Les oeufs sont pondus sous les feuilles; à l 'éclosion, les petites chenilles gagnent 
l'intérieur des troncs où elles creusent, dans la moelle, de larges galeries, qui 
s 'entrecroisent dans tous le sens et qui ne sont pas sans causer quelque préjudice aux 
Palmiers. " 



* Today, therapon is placed in the genus Athis Hübner, [1819], so one would expect Orthia Herrich- 
Schäffer [1853] to be a synonym of Athis; however Fletcher and Nye (1982: 114) clearly stated the 
generic name Orthia belongs in the Agaristidae (currently a subfamily of the Noctuidae). Lamas (1995) 
followed Fletcher & Nye and accordingly eliminated in his checklist Orthia as a synonym of Athis. The 
placement of Orthia in the Castniidae, as a synonym of Athis, by Miller (1995) is most likely due to a 
misinterpretation. 



Notalepid. 25(1): 3-15 11 

It is in this short paragraph where we learn for the first time that palm trees (with 
"spiny leaves") are the hostplants of archon and the first indication that the larvae 
might cause damage to palm trees. The palm tree referred to by Petit must have been 
Phoenix canariensis (see below). 

Houlbert also complemented the description already given by Oberthür (1914) of the 
three cocoons of archon by figuring them life size in an excellent photograph (Fig. 97- 
bis of his revision). He also comments on the absence of pupal exuviae inside the three 
empty cocoons: "Les parois chitineuses des chrysalides ont probablement été extraites 
après l'éclosion; en tout cas nous n'en avons trouvé aucune trace à l'intérieur des 
cocons." This observation by Houlbert has a significant biological meaning, though he 
was at the time unaware of this (Sarto i Monteys & Aguilar, in prep.). 

Third period: Bourquin and Jörgensen (1930-1944) 

In September 1930, the Argentine Fernando Bourquin visited Paysandü (Uruguay) 
and by chance (Bourquin 1933, 1944) reached the properly of Joseph de Boismenu, a 
nephew of Joseph Petit, de Boismenu had collaborated with his uncle by sending 
specimens of josepha and information to Charles Oberthür in France. 

Whilst in Paysandü, undoubtedly following the information given to him by de Boismenu, 
Bourquin carried out a thorough search of palm trees over a period of several days. He only 
managed to find two live cocoons on the frond leaf axils of two palm species, Phoenix 
canariensis (the spiny-leaved palm that Petit had indicated to Houlbert) and Trithrinax 
campestris (the Spanish "Palmera Caranday" or English "Campestre palm"). 

He also obtained some eggs which were figured (a photograph with three eggs) and 
described quite accurately (Bourquin 1930). These were probably given to him by de 
Boismenu as he makes no mention of having found them himself on the palms. This is 
reinforced by the fact that what he states about where the female lays the eggs on the 
palms ("within a small hole") was obviously communicated to him by someone else 
(probably again by de Boismenu) and it is not correct (Sarto i Monteys & Aguilar, in 
prep.). In addition, he briefly mentions some morphological details of the pupa such as 
its brown colour and the rows of teeth present on the abdominal segments that help it 
move outside the cocoon prior to emergence. 

So far, all biological information about this castniid came from the population at 
Paysandü (i.e. josepha). Nothing was known about the population found in the Argentine 
Province of Catamarca (i.e. archon). 

In his 1930 paper, Bourquin did not mention that he had found two live cocoons on 
the palms at Paysandü as explained above (he only mentioned this in his 1933 and 
1944 publications). Also he told nothing about Joseph de Boismenu and the help he 
received from him (again he only did so in those two latter publications) and, most 
surprisingly, he referred directly to Castnia archon Burm. as the species he was dealing 
with! Not a single reference to Oberthür 's josepha appeared in his 1930 paper, which 
furthermore had a rather ambiguous title "Algunas observaciones sobre Castniidae", 
i.e. "Some observations on Castniidae" when the paper was dealing solely with archon. 
No doubt, Bourquin had become aware by September 1930 that josepha and archon 
were the same species. 



1 9 

1Z - Sarto: Paysandisia archon 

The explanation to these puzzling facts came to me later when I encountered a paper 
by Alberto Breyer (193 1), published in the same journal as that of the Bourquin paper. 
There, Breyer added two more Argentine localities for archon (Concordia, Province of 
Entre Rios; Cordoba, Province of Cordoba) and, most importantly, established the syn- 
onymy between archon Burmeister and josepha Oberthür as follows: 

"<...> Considerando que la description de Oberthür para la Castnia josepha nos pinta la Castnia archon 
de Burmeister en todos sus detalles, que los ejemplares de Oberthür son de Paysandü como algunos de los 
revisados por nosotros y como los observados por el sehor Bourquin, y que las observaciones biolôgicas 
son idénticas, como también la planta alimenticia (palmeras), no titubeamos en declarar la sinonimia 
entre ambas denominaciones. Habiendo publicado Burmeister en el ano 1879, y Oberthür en 1913, la 
prioridad queda a favor de la denomination de Burmeister como Castnia archon Burm. " 

No doubt Breyer had discovered, some time before September 1930, that archon 
and josepha were synonyms and had communicated this to Bourquin. However this 
was not published by Breyer until 1931. This is why Bourquin was so sparing in his 
1930 paper: (1) because he was going to have his paper on the castniid published a bit 
earlier than that of Breyer establishing the synonymy, (2) because he did not want to 
take the priority about the synonymy out of Breyer 's hands and, (3) because at the 
same time he disliked the fact of using the name josepha for what he knew would soon 
become a synonymic name. So he just referred to Castnia archon in his 1930 paper 
and eliminated any reference to Joseph de Boismenu, Joseph Petit and everything that 
might link this castniid to Oberthiir's josepha. Later, in his 1933 and 1944 publications, 
he gave proper credits to all people at Paysandü that had helped him. 

In an interesting paper by Pedro Jörgensen (1930) dealing with all known Castniidae 
of Argentina and Paraguay, he gives valuable information about the distribution and 
biology of these moths, mainly from his own experience. For Castnia archon Burm., 
he only quotes what was already known from Burmeister 's work with the comment 
(translated from Spanish) "It must be extremely rare or very local, as I have never seen 
it during my three year stay in that province. And I believe Mr. Giacomelli has neither 
seen it in the neighbouring province (Rioja)". 

The most important thing about this paper is that on plate X he figures, for the first 
time, a black-and-white photograph of a female he says is Burmeister 's type of archon 
(actually it was one of the two syntypes and must be considered the valid lectotype, as 
explained above). So, 50 years after it was described by Burmeister, "Castnia archon" 
was first shown in an illustration to the scientific community. 

Later, Bourquin (1933, 1944) described quite accurately the archon larva and pupa, 
figured the final larva and all other life stages (Fig. 4) and gave very useful biological 
data, mentioning that it had the potential to become a serious pest of palms. 

Fourth period: from Miller to present (1986-2001) 

Another milestone in the study of Neotropical Castniidae is J. Y. Miller's 1986 work 
on this group. Miller retained archon Burmeister, 1880 in the monotypic genus 
Paysandisia Houlbert, 1918, and provided an accurate diagnosis of the genus. It is 
distinguished by the following apomorphic characters: "origins of R b R 2 , and R 3 equi- 



Notalepid. 25(1): 3-15 



13 




Fig. 4. Plate XXXII reproduced from Bourquin (1933), depicting the life history of Paysandisia arc/ion 
(Burmeister, 1880). Photo: M. R. Honey. 



distant, with R 3 , R 4 , and R 5 connate; distinctive setal-scale patch along cubital veins 
on basal two-thirds of forewing, subcostal retinaculum absent; female genitalia, duc- 
tus bursae membranous, undulate, corpus bursae membranous without signae." 
She also gave details of many adult morphological characters (both male and female), 
figuring for the first time the labial palpus, the complete wing venation and the male 
and female genitalia. However, concerning the early stages, larval foodplants, flight 
period and distribution, reference is only made to Bourquin's 1933 paper, including 
some inaccuracies and omitting some published data (e.g. Breyer 1 93 1 , Biezanko 1 96 1 : 
cf. Sarto i Monteys & Aguilar, in prep.). 

Later (Miller 1995) treats the Uruguayan population of archon (i.e. thai used by 
Oberthiir to describe josepha) as a good subspecies of archon, i.e. as Paysandisia 



-^ Sarto: Paysandisia archon 

archonjosepha (Oberthiir). The Argentine population would thereby become the nomi- 
nal subspecies, i.e. Paysandisia archon archon (Burmeister). This appears to have 
been done without any justification of the characters used to separate both supposed 
subspecies and is based only on their extremely partially known distribution. Lamas 
(1995) relegated archonjosepha (Oberthiir, 1914) as synonym of archon (Burmeister, 
1880). Very recently, then, the species was also discovered in Spain and France (see 
Introduction) where it has been accidentally introduced. 

Acknowledgments 

The research that culminated in this paper would have been impossible without the help of several 
colleagues who contributed in different ways, mostly assisting with literature and useful comments. 
These are as follows (arranged alphabetically): Dr Axel O. Bachmann, David Carter, Carlos A. Debona, 
Martin R. Honey, Dr Ian J. Kitching, Dr Jacqueline Y. Miller, Carlos S. Morey, Dr Richard S. Peigler, 
Antonia Rodriguez (MZB) and Andres E. Varga. Special thanks go to Gerardo Lamas who recently 
photographed the paralectotype specimen and gave permission to publish this photograph here. M. R. 
Honey (The Natural History Museum, London) and R. S. Peigler (University of the Incarnate Word, San 
Antonio, Texas), deserve special mention for their support and patience during my initial, constant 
enquiries; they also provided linguistic assistance. Two anonymous referees and Dr. Ole Karsholt improved 
the final manuscript with their valuable comments. Also I express my gratitude to the Catalonian 
Department of Agriculture, Barcelona, for their financial support of my research trip to The Natural 
History Museum, London. 



Literature 

Aguilar, LI., J. Y. Miller & V. Sarto i Monteys 2001 . A new lepidopteran family for the European fauna. 

- SHILAP Revta. lepid. 29 (113): 86-87. 

Biezanko, CM. 1961. XIV. Castniidae, Zygaenidae, Dalceridae, Eucleidae, Megalopygidae, Cossidae 
et Hepialidae da Zona Missioneira do Rio Grande do Sul. - Arq. Ent. Escola de Agronomia "Eliseu 
Maciel" (Pelotas) (sér. B) 14: 1-12, 1 Fig. 

Bourquin, F. 1930. Algunas observaciones sobre Castniidae. - Revta. Soc. ent. Argentina 3: 173-174, 1 Fig. 

Bourquin, F. 1933. Notas biolôgicas de la Castnia archon Burm. -Revta. Soc. ent. Argentina 5: 295- 
298, pis. 31-32, 1 Fig. 

Bourquin, F. 1944. XXXV. Observaciones sobre Castnia archon Burmeister 1879. Lep. Fam. Castniidae. 
Pp. 133-136. - In: F. Bourquin (ed.), Mariposas Argentinas. Vida, desarrollo, costumbres y hechos 
curiosos de algunos lepidôpteros argentinos. - F. Bourquin Publisher, Buenos Aires. 

Breyer, A. 1931. Los Castniidae argentinos. - Revta. Soc. ent. Argentina 3: 233-238, pis. 7-8. 

Burmeister, H. 1878. Description physique de la République Argentine d'après des observations 
personnelles et étrangères. Tome cinquième. Lépidoptères. Première partie, contenant les Diurnes, 
Crépusculaires et Bombycoïdes- Imprimerie de P. E. Coni; Paris, F. Savy; Halle, E.Anton, Buenos 
Aires. 524 pp. 

Burmeister, H. 1879-1880. Atlas de la description physique de la République Argentine contenant des 
vues pittoresques et des figures d'histoire naturelle. Cinquième section, seconde partie. Lépidoptères. 

- Imprimerie de P.E. Coni; Paris, F.Savy; Halle, E.Anton, Buenos Aires. [I e Livraison, 1879]: 1^40 
pp; [2 e Livraison, 1880]: 41-64 pp., 24 colour pis. + 1 monochrome pi. 

Drescher, J. & A. Dufay 2001. Un nouveau ravageur des palmiers dans le sud de la France. - PHM 

Revue Horticole, 429: 48-50. 
Fletcher, D. S. & I. W. B. Nye 1982. Bombycoidea, Castnioidea, Cossoidea, Mimallonoidea, Sesioidea, 

Sphingoidea, Zygaenoidea. Pp. xiv + 192. - In: I. W. B. Nye (ed.), The Generic names of moths of 

the world. Volume 4. - Trustees of the British Museum (Natural History). London. 
Houlbert, C. 1918. IL Révision monographique de la Sous-Famille des Castniinae. Pp. 5-713, 437^62 

pis. - In: Ch. Oberthiir (ed.), Études de Lépidoptérologie comparée, Fascicle XV - Imprimerie 

Oberthür. Rennes. 



Notalepid. 25(1): 3-15 15 

ICZN, 1999. International Code of Zoological Nomenclature, fourth edition. - International Trust for 

Zoological Nomenclature, London, xxix + 306 pp. 
Jörgensen, P. 1930. Las especies de Castniidae de la Argentina y Paraguay (Lepidoptera). - Revta. Soc. 

ent. Argentina 3: 175-180, pis. 9-10. 
Lamas, G. 1995. A critical review of J. Y. Miller's Checklist of the Neotropical Castniidae (Lepidoptera). 

- Revta. Per. Ent. 37: 73-87. 
Miller, J. Y. 1976. Studies in the Castniidae. II. Descriptions of three new species of Castnia, s.l..- Bull. 

AllynMus. 34: 1-13, 18 figs. 
Miller, J. Y 1980. Studies in the Castniidae. III. Mirocastnia. - Bull. Allyn Mus. 60: 1-15, 20 figs. 
Miller, J. Y 1986. The taxonomy, phylogeny, and zoogeography of the Neotropical moth subfamily 

Castniinae (Lepidoptera: Castnioidea: Castniidae). Ph. D. thesis, University of Florida. - U.M.I. 

Dissertation Services, Ann Arbor, Michigan. 569 pp. 
Miller, J. Y 1995. Castniidae. Pp. 133-137, 176-177. - In: J.B. Heppner (ed.), Atlas of Neotropical 

Lepidoptera. Checklist: Part 2. - Association for Tropical Lepidoptera / Scientific Publishers, 

Gainesville, Florida. 
Oberthür, Ch. 1914. VI. Nouvelle espèce de Castnia de l'Uruguay. Pp 63-64, pi. CCLVII, Fig. 2164- 

2165- In: Ch. Oberthür (ed.), Études de Lépidoptérologie comparée, Fascicle IX (2 partie). - 

Imprimerie Oberthür, Rennes. 
Oiticica, J. 1955. Revisäo dos nomes genéricos sul-americanos da subfamilia Castniinae (Lepidoptera, 

Castniidae). - Revta. Brasil. Ent. 3: 137-167. 
Rothschild, L. W. 1919. Supplementary notes to the review of Houlbert and Oberthür 's monograph of 

Castniinae by Talbot and Prout. - Novit. Zool. 26(1): 1-27. 
Sarto i Monteys, V & LI. Aguilar 2001. Paysandisia archon (Burmeister, 1880), Castniidae, also in 

France. - SHILAP Revta. lepid. 29(115): 280 
Seitz, A. &E. Strand 1913. Family Castniidae. Pp. 5-19, pis. \-S.-In: A.Seitz(ed.), The Macrolepidoptera 

of the world, vol. 6: The American Bombyces & Sphinges- Alfred Kernen, Stuttgart. 
Varga, A. E. 2000. Mariposas Argentinas. Guia practica e ilustrada para la identificaciön de las principales 

mariposas diurnas y nocturnas de la Provincia de Buenos Aires. Métodos y técnicas para la cria, 

colecciôn y preservation de mariposas. - Asociacion Amigos del Museo Mariposas del Mundo, San 

Miguel, Buenos Aires. 148 pp. 



Book Review 

Hacker, H. H. (editor): Esperiana, Volume 8. 944 pp., 36 colour plates, Schwanfeld, July 
31, 2001. ISBN 3-9802644-7-5. Price: € 165.00. 

A new volume of Esperiana, a book-series edited by Hermann H. Hacker, has been issued two 
years after the publication of Volume 7. It is again mainly devoted to the fauna of the Middle 
East (Israel, Jordan, Lebanon, Sinai, and Syria). Thirty-one scientific papers on insects are 
contained which mainly treat Lepidoptera, especially Noctuidae, but also Coleoptera (Elateridae) 
and Hymenoptera (Formicidae). 

Almost all species treated, including many type specimens and habitats, are figured on 36 
excellent colour plates, which have been considerably improved over past volumes. Figuring a 
series of specimens shows the full variability of some species. 

The main part of the book is formed by the fauna of the Noctuidae (and Nolidae) of the Middle 
East (the Levant) (which is also available separately for € 92.00) where 585 species are dealt 
with. Many corrections to previous misidentifications are made, several new synonymies are 
recorded, and taxonomic changes are made, considerably improving the knowledge of the 
Noctuidae of this region. Not only new records to the fauna of the Middle East (79 species) are 
published, but also two genera, eight species, and 10 subspecies are described as new to science. 
The historical continuity in systematics is fully respected in the present volume which is in a 
clear positive contrast to some recent publications by H. Beck. The genus Clytie is revised in 
an appendix, where many lectotypes are selected which is necessary because of the mixed 
type-series for some species. This thorough revision of the difficult genus was vital for its 
inclusion in a review of the fauna of this region. A final analysis of the noctuid fauna of the 
Middle East shows that species with a general Palaearctic arboreal distribution are more 
numerous than eremic taxa. The careful documentation of the relationships between animal 
and habitat will hopefully help to highlight the importance of protection of the remaining 
natural landscapes in this region. 

The second part of the volume is somewhat heterogeneous, containing papers on insects of 
some Levantine countries, and also from other parts of the world (e. g. Ghana, Greece, China, 
Madeira, Romania, Mongolia, Nepal, Central Asia, Iran, and Kazakhstan). These papers, though 
not directly addressing the fauna of the Middle East, are of no less importance. Interestingly, 
Weidlich describes a new noctuid species from Madeira. This is an absolutely unexpected 
discovery of a clearly recognizable moth in the western Palaearctic region, though its genitalia 
are figured without aedeagus and the female is still unknown. 

This volume is highly recommended not only for every student of the insect fauna of the 
Middle East, but also to all entomologists interested in taxonomy. The price of € 165- for the 
present volume is moderate, taking into account that it is hard-covered and contains excellent 
colour plates. It can be reduced by 20 % when subscribing to the whole series. 

Wolfgang Speidel 



Notalepid. 25(1): 17-21 17 

Synonyms of European Tortricidae and Noctuidae, with special 
reference to the publications of Hübner, Geyer and Frölich 

Wolfgang Speidel* & Leif Aarvik** 

*Zoologisches Forschungsinstitut und Museum Alexander Koenig, Adenauerallee 160, D-53113 

Bonn, Germany. E-mail: W.Speidel.ZFMK(^uni-bonn.de 
**Zoological Museum, University of Oslo, P. O. Box 1172 Blindem, NO-0318 Oslo, Norway 



Summary. Pyralis approximana Fabricius, 1798 is synonymized with Acleris ferrugana (Denis & 
Schiffermüller, 1775). Epagoge peramplana Hübner, 1825, in combination with Aphelia Hübner, 1825 
is introduced as the valid name for the species known as Aphelia amplana (Hübner, 1813). Frölich is 
established as the correct author of the species currently known as Lozotaeniodes formosana (Geyer, 
1830). Tortrix venustana Frölich, 1828 is a new synonym of Celypha aurofasciana (Haworth, 1811). 
Olethreutes valesiana Rebel, 1 907 (not 1 906) is placed in the genus Phiaris Hübner, 1 825. Tortrix perlana 
Frölich, 1830 is a new synonym of Eublemma pulchralis (Villers, 1789). 

Zusammenfassung. Pyralis approximana Fabricius, 1798 wird mit Acleris ferrugana (Denis & Schiffer- 
müller, 1775) synonymisiert; Ëpagoge peramplana Hübner, [1825], neu kombiniert mit Aphelia Hüb- 
ner, 1825 wird als gültiger Name für die als Aphelia amplana (Hübner, 1813) bekannte Art eingeführt; 
Frölich wird als der richtige Autor der gegenwärtig als Lozotaeniodes formosana (Geyer, 1830) geführ- 
ten Art festgestellt; Tortrix venustana Frölich, 1828 ist ein neues Synonym von Celypha aurofasciana 
(Haworth, 1811); Olethreutes valesiana Rebel, 1907 (nicht 1906) wird in die Gattung Phiaris Hübner, 
1825 gestellt. Tortrix perlana Frölich, 1830 ist ein neues Synonym von Eublemma pulchralis (Villers, 
1789). 

Résumé. Pyralis approximana Fabricius, 1798 est synonymisé sous Acleris ferrugana (Denis & 
Schiffermüller, 1775). Epagoge peramplana Hübner, 1825, en combinaison avec Aphelia Hübner, 1825, 
est introduit comme nom valide pour l'espèce connue sous le nom de Aphelia amplana (Hübner, 1813). 
Frölich est établi comme étant l'auteur correct de l'espèce connue jusqu'à présent sous le nom de 
Lozotaeniodes formosana (Geyer, 1830/ Tortrix venustana Frölich, 1828 est un nouveau synonyme de 
Celypha aurofasciana (Haworth, 1811). Olethreutes valesiana Rebel, 1907 (non 1906) est placé au sein 
du genre Phiaris Hübner, 1825. Tortrix perlana Frölich, 1830 est un nouveau synonyme de Eublemma 
pulchralis (Villers, 1789). 

Key words. Lepidoptera, Tortricidae, Noctuidae, nomenclature, synonymy, Europe. 



Introduction 

Jakob Hübner contributed considerably to the knowledge of European Tortricidae in 
the Tortrices part of the 'Sammlung europäischer Schmetterlinge". This part is not 
dated, but the 53 plates were published, according to Hemming (1937), from 1799 
until 1833. Only the first 47 plates were edited by Hübner himself, the remaining by 
Geyer. There is no text to the plates published by Hübner. All plates have the headline 
'Tortrices', i.e. the generic name with plural ending. Therefore, we regard all the species 
published without text to be originally combined with Tortrix. Plates 1 to 29 were 
published in 1799, plate 30 in 1800, plates 31 to 37 in 1813, 38 to 41 in 1817, 42 to 43 
in 1819, 44 in 1822, 45, 46 in 1823, 47 in 1829, 48 to 52 in 1830 and 53 in 1833 
(Hemming, 1 937: 284-29 1 ). Geyer edited plates 48 to 53, but he is only the author of 
the names published in plate 53. The new descriptions for species figured in plates 48 
to 52 were authored in an accompanying text, which is dated 1 830, by Franciscus A. G. 
von Frölich from Ellwangen (Germany). 

© Nota lepidopterologica. 01.08.2002, ISSN 0342-7536 



1 * Speidel & Aarvik: Synonyms of European Tortricidae and Nocruidae 

Frölich was one of the first authors who specialized in Tortricidae. He has left us two 
publications on Tortricidae. The first one is a faunistic paper on the Tortricidae of 
Württemberg (South- West Germany) containing many new descriptions (Frölich 1 828). 
However, most of FroTich's names were later forgotten, because they were not 
recognizable (Guenée 1845: 111). The second publication of Frölich is the 
aforementioned text relating to the specimens figured in plates 48 to 52 in Geyer 's 
continuation of Hübner's ' Sammlung europäischer Schmetterlinge' (Frölich 1830, in 
Hübner 1796 ff.). A part of these names are erroneously attributed to Geyer in the 
modern literature, but Geyer only edited the later part of the volume on Tortricidae 
after Hübner's death, as stated above. 

Some errors relating to these early authors still persisting in recent literature are 
corrected in the present paper. A few other corrections concerning the authorship of 
European Tortricidae are also included. 

The nomenclature of the two common species of Acleris, A. notana (Donovan) (the 
Betula- feeder) and A. ferrugana ([Denis & Schiffermüller]) (the Quercus '-feeder), has 
caused a lot of confusion in the past. We deal with one old synonym that threatens the 
stability and correct a mistake that appeared in Microlepidoptera Palaearctica volume 
6 (Razowski 1 984) on the group. Our corrections do not diminish the value and usefulness 
of the important publications of Razowski (especially 1984, 2001), though they are 
sometimes in conflict with statements ofthat author (in these mentioned publications). 

Systematic Part 

Tortricidae 

Acleris ferrugana ([Denis & Schiffermüller], 1775) 

Tortrix ferrugana [Denis & Schiffermüller], 1775: 128 

Tortrix rufana sensu Hübner, 1799: Tortr., pi. 20, fig. 127, nee Denis & Schiffermüller, 1775 

Pyralis approximana Fabricius, 1798: 478. syn. n. Type locality: Halae Saxonum [Halle, Saxony] 

Tortrix tripunctulana Haworth, 1811: 417 

Tortrix bifidana Haworth, 1811:418 

[Teras] lythargyrana Treitschke, 1830: 264. Invalid name. 

Tortrix brachiana Freyer, 1833: 33 

Tortrix rubidana Herrich- S chaffer, 1851: 146 

Teras lithargyrana Herrich-Schäffer, 1851: 147 

Teras selasana Herrich-Schäffer, 1851: 147 

Peronea fissurana Pierce & Metcalfe, 1915: 325 

Notes. Pyralis approximana Fabricius, 1798 was listed as a doubtful synonym of Acleris 
tripunctana Hübner (= notana Donovan) by Obraztsov (1956: 132) and Razowski 
(1966: 442, 1984: 269). We propose to place it in synonymy with Acleris ferrugana 
([Denis & Schiffermüller], 1775). This change will maintain current nomenclatural 
usage of both species involved. The original description of approximana (Fabricius, 
1798: 478), translated from latin, "...forewings shining yellow. Three dots, nearly 

black, on the edge of the wing resembling boscana", could represent both notana 

mdferrugana, but most likely the latter which is slightly more yellowish than notana 
in most specimens. Acleris notana normally has a more brownish hue. 



Notalepid. 25(1): 17-21 19 

Fabricius described Pyralis centrana Fabricius, 1794, which was later placed in syn- 
onymy with Acleris rhombana (Denis & Schiffermüller, 1775) by Leraut (1997: 141). 
This name was listed as a doubtful synonym of Acleris notana (Donovan, 1806) by 
Obraztsov (1956: 132) and Razowski (1966: 442, 1984: 269). The specific names 
centrana and approximana (types are either lost {centrana) or could not be traced 
{approximana) according to Zimsen, 1964) have not been used as valid names after 
1899 (ICZN, 4 th ed., Art. 23.9.1) and would not threaten Acleris notana (Donovan, 
1806) anyway, but a reversal of precedence could be avoided, if the future selection of 
type specimens follows the present suggestions: A specimen of Acleris rhombana should 
be selected as neotype of centrana, and a specimen of Acleris ferrugana as neotype or 
eventually lectotype of approximana. 

Razowski (1984) interchanged the figures of male and female genitalia of the two 
species Acleris notana and A. ferrugana. His figure numbered 109 represents notana 
(not ferrugana), and figure numbered 113 represents ferrugana (not notana). The 
mistake was repeated by Razowski (2001), where genitalia figure 28 is notana (not 
ferrugana) and 29 is ferrugana (not notana). 



Aphelia peramplana (Hübner, 1825) comb. n. 

Tortrix amplana Hübner, 1813 ("1796"): Tortr., pi. 31, fig. 201 

Epagoge peramplana Hübner, 1825 ("1816-1826"): 389 (replacement name for amplana) 

Note. Tortrix amplana Hübner, 1813 ("1796") is a junior primary homonym of Tortrix 
amplana Hübner, 1799 ("1796"): pi. 5, fig. 24, now placed in the genus Cydia. The 
name peramplana is erroneously treated as a synonym of Cydia amplana (Hübner, 
1799) (Leraut, 1997: 148). 



Lozotaeniodes formosana (Frölich, 1830) auct. rev. 

Tortrix formosana Frölich, 1830 in Hübner, Tortr.: 9, pi. 51, fig. 319, 320 
Type locality: Süd-Frankreich (South France) 

This name has erroneously been attributed to Geyer, 1830 in Hübner, 1796 ÏÏ. (Razowski in Karsholi t v_ 
Razowski, 1996: 141; Leraut, 1997: 135) 



Celypha aurofasciana (Haworth, 1811) 

Tortrix venustana Frölich, 1828: 54. syn. n. 

Type locality: Elvaci [Germany, Baden-Württemberg, Ellwangen]. 

The name venustana was wrongly attributed to Geyer, in Hühner 1S30 ("1796") (Leraut, 1997: 151), 

however it had already been used by Frölich. 1828 and Frölich, 1830 {in Hühner. 1796 ff.): 12. pi. 

51, fig. 326. 



Phiaris valesiana (Rebel, 1907) comb. n. 

Olethreutes valesiana Rebel. 1907. Dt. ent. Z. Ins 19: 232. 
Type locality: Switzerland, Wallis. Grüben, ca. W00 m. 



20 



Speidel & Aarvik: Synonyms of European Tortricidae and Noctuidae 



Note. This species has been erroneously credited to Guenée, 1 844 (Razowski in Karsholt 
& Razowski, 1996: 144; Leraut, 1997: 15.1) and placed in Celypha. However, no 
description could be found under that reference. The species was listed with correct 
authorship as a synonym of Phiaris turfosana (Herrich- Schäffer, 1851) (Razowski, 
1995: 316). In Rebel's original description, the present species is said to be most closely 
related to Phiaris turfosana (Herrich- S chaffer, 1851) and comparative genitalia figures 
of both species are given. Therefore, Olethreutes valesiana is here transferred from 
Celypha to Phiaris. The correct date for the description of Phiaris valesiana and 
Eucosma monstratana Rebel, which are described in the same publication, is 1907 
(Rebel, 1907: 235). It has erroneously been dated 1906 (Razowski in Karsholt & 
Razowski, 1996: 149; Razowski, 1995: 316; Razowski, 2001: 22). Razowski (2001) 
treated valesiana as a synonym of turfosana. In our opinion, the genital characters 
given in the original description indicate that valesiana is a distinct species, and evidence 
to the contrary must be presented before accepting the synonymy. 



Noctuidae 

Eublemma pulchralis (Villers, 1789) 

Tortrix perlana Frölich, 1830 in Hübner, Samml. europ. Schmett., Tort.: 8, pi. 50, fig. 316. syn. n. 

Type locality: Pavia. 

The name perlana has wrongly been attributed to Geyer, 1830 in Hübner, 1796 ff. (Leraut, 1997: 229). 



Acknowledgements 

R. Gaedike (Eberswalde, Germany) kindly furnished a copy of Frölich's contribution to the Tortrices of 
Hübner 's Sammlung europäischer Schmetterlinge. Peter Huemer (Innsbruck, Austria) and Ole Karsholt 
(Copenhagen, Denmark) gave valuable comments to the manuscript. We are grateful to our colleague 
Bradley Sinclair (Bonn, Germany) for useful comments and for correcting the English. 



Literature 

[Denis, J. N. C. M. & Schiffermüller, I.] 1775. Ankündung eines systematischen Werkes von den Schmet- 
terlingen der Wienergegend herausgegeben von einigen Lehrern am k. k. Theresianum. - Wien. 323 
pp., pis. 1 a and b. 

Fabricius, J.C. 1798. Supplementum Entomologiae systematicae. - Proft et Storch, Hafniae 
(KYbenhavn). iii+572 pp. 

Freyer, C. F. 1833. Neuere Beiträge zur Schmetterlingskunde mit Abbildungen nach der Natur. 1. - 
Augsburg (published by the author), iv+182 pp., 96 pis. 

Frölich, F. A. G. 1828. Enumeratio Tortricum Württembergiae. - Dissertât, inaug., Tübingen. 102 + ii pp. 

Guenée, A. 1845. Essai sur une nouvelle classification des microlépidoptères et catalogue des espèces 
européennes connues jusqu'à ce jour. - Annls Soc. ent. Fr. (2) 3: 105-192, 297-344. 

Haworth, A. H. 1811. Lepidoptera Britannica. - London. Part 3. pp. 377-512. 

Hemming, F. 1937. Hübner, 1. - Royal Entomological Society, London. 605 pp. 

Herrich-Schäffer, G. A. W. 1849. Systematische Bearbeitung der Schmetterlinge von Europa, zugleich 
als Text, Revision und Supplement zu Jacob Hübners' Sammlung europäischer Schmetterlinge. 4. 
Die Zünsler und Wickler. - In Commission bei G. J. Manz, Regensburg. [1 848]-1849-[l 855]. 288+48 
pp., 23+29 pis. 

Hübner, J. 1799-1833 ("1796" ff.). Sammlung europäischer Schmetterlinge. Horde 7. Tortrices-Wickler. - 
Augsburg, ii+16 pp., 53 pis. [Title of the text: Sammlung europäischer Schmetterlinge. Errichtet von 



Notalepid. 25(1): 17-21 21 

Jakob Hübner. vii. Horde. Die Wickler. Tortrices Linn. Fortgesetzt von C. Geyer. Mit Beschreibungen 

von Herrn Dr. v. Frölich, Medizinal-Rath und Leibmedikus. - Augsburg, 1830. ii+16 pp.] 
Hübner, J. 1816-1826 ("1816"). Verzeichniß bekannter Schmettlinge [sie]. - Augsburg (published by 

the author). 432 pp. 
International Commission on Zoological Nomenclature, 1999. International Code of Zoological 

Nomenclature. - Fourth Edition. International Trust for Zoological Nomenclature, London, xxix+306 

pp. 
Karsholt, O. & J. Razowski 1996. The Lepidoptera of Europe. A distributional checklist. - Apollo Books, 

Stenstrup. 380 pp. 
Leraut, P. J. A. 1997. Liste systématique et synonymique des Lépidoptères de France, Belgique et Corse 

(deuxième édition). - Alexanor (Supplement). 526 pp. 
Obraztsov, N. S. 1956. Die Gattungen der Palaearktischen Tortricidae. I. Allgemeine Aufteilung der 

Familie und die Unterfamilien Tortricinae und Sparganothinae. 2. Fortsetzung. - Tijdschr. Ent. 99: 

107-154. 
Pierce, F. N. & J. W. Metcalfe 1915. Descriptions of two further additions to the British Tortricina. - 

Entomologist's mon. Mag. 51 (series 3,1): 324-327. 
Razowski, J. 1966. World fauna of the Tortricini (Lepidoptera, Tortricidae). - PaDstwowe Wydawnictwo 

Naukowe, Krakow. 576 pp., 41 pis. 
Razowski, J. 1984. Tortricini. -In: Microlepidoptera Palaearctica 6. - Verlag G. Braun, Karlsruhe. 376 

pp., 101 pis. 
Razowski, J. 1995. Catalogue of the species of Tortricidae (Lepidoptera). Part IV: Palaearctic 

Olethreutinae: Microcorsini, Bactrini, Endotheniini and Olethreutini. - Acta zool. cracov. 38: 285- 

324. 
Razowski, J. 2001. Die Tortriciden (Lepidoptera, Tortricidae) Mitteleuropas. Bestimmung - Verbreitung 

- Flugstandort - Lebensweise der Raupen. - Frantisek Slamka, Bratislava. 319 pp., 24 pis. 
Rebel, H. 1907. Neue palaearctische Microheteroceren. - Dt. ent. Z. Iris 19 ('1906'): 227-242. 
Treitschke, F. 1830. Die Schmetterlinge von Europa (Fortsetzung des Ochsenheimer'schen Werkes). 8. 

- Fleischer, Leipzig. 312 pp. 

Zimsen, E. 1964. The type material of J. C. Fabricius. - Munksgaard, Copenhagen. 656 pp. 



Book Review 

Emmet, A. M. & J. R. Langmaid (eds.) 2002. The moths and butterflies of Great Britain 

and Ireland. - Harley Books, Great Horkesley (Colchester, England) 

Volume 4, Part 1 comprising Oecophoridae, Ethmiidae, Autostichidae, Blastobasidae, 

Batrachedridae, Agonoxenidae, Momphidae, Cosmopterigidae, Scythrididae. 326 pp., 7 pis. 

ISBN 94 65 89 66 6. Price: £ 80.00. 

Volume 4, Part 2. Gelechiidae. 277 pp., 6 pis. ISBN 94 65 89 67 4. Price: £ 80.00. 

Hardback set of volume 4, part 1 and 2: ISBN 94 6589 63 1; Price: £ 150.00. (A paperback 

edition will be published later this year). 

Though the ' Micro' -lepidoptera comprise the majority of Lepidoptera, only a minority of 
lepidopterists is focusing on these smaller moths still leading to a lack of literature for their 
identification. It is therefore highly appreciated that a further volume of "The moths and 
butterflies of Great Britain and Ireland" dealing with smaller moths has been published now. 
The two parts comprising this, volume cover many of the least familiar families of the 
Gelechioidea. No comparable British work exist on these ' micro '-lepidopteran families, which 
in terms of identification indeed comprise the most difficult species. Moreover, also continental 
entomologists are in want of this literature since many of these taxa (e.g. Agonoxenidae, 
Autostichidae, Batrachedridae, Cosmopterigidae) occurring in Britain are not treated in other 
recent literature. But continentals will again regret not to find all 'their' species in this book 
series. 

Unfortunately, Arthur Maitland Emmet (1908-2001) who was instrumental in starting this 
book series since 1975 and contributed by himself as an author for many chapters, did not live 
to see the fourth volume published - which in his eyes is the most needed. Therefore, part one 
of this volume starts with a tribute to Maitland Emmet. 

The introductory chapter by Jens Rydell & Mark Young deals with the ecology and evolution 
of Lepidopteran defences against bats. It is a fascinating reading to get know about a world 
beyond human experience: the echolocation by bats, moth hearing, and how hearing and deaf 
moths avoid the predators. Rydell & Young write in great detail on this topic, and everybody 
who wants to know more will find a quite complete bibliography at the end of the chapter. 
It follows the systematic section in the familiar arrangement of the family introduction, key to 
species, the treatment of the species including a comprehensive morphological description, the 
description of the life history and distribution, underlined by a map showing the records in 
Britain and Ireland. The text is accompanied with line drawings of morphological features 
(head, wing venation, genitalia) as well as images on typical life forms of pre-imaginal stages. 
Colour plates of the moths conclude the work. The illustrations are valuable, highly accurate 
and very esthetical throughout the book. Text and illustrations are well suitable to identify the 
species treated. Authors and publisher of volume four of "The moths and butterflies of Great 
Britain and Ireland" doubtless contributed much to a better understanding of the identification 
and life history of the Gelechioidea in Europe. This volume certainly will influence faunistic 
and systematic work on these smaller moths not only in Britain and Ireland, but also on the 
European mainland. 

Matthias Nuss 



Notalepid. 25(1): 23-38 23 

Comparison of factors influencing the habitat characteristics of 
Gortyna borelii (Noctuidae) and its larval foodplant 
Peucedanum officinale in the United Kingdom and Germany 

Zoë Ringwood*, Tim Gardiner*, Axel Steiner** & Julian Hill* 

* Faculty of Science, Writtle College, Writtle, Chelmsford, Essex, CM1 3RR, United Kingdom 
** Staatliches Museum für Naturkunde, Department of Entomology, Rosenstein 1, D-70191, Stuttgart. 
Germany 



Summary. Gortyna borelii is a rare moth species with a widespread, but very localised distribution in 
Europe. The main larval foodplant of this species is Peucedanum officinale. Both G. borelii and P. officinale 
are listed as Red Data Book species in United Kingdom and Germany. Little research has been conducted 
on the ecology of the moth and its larval foodplant in Europe. Both G. borelii and P. officinale inhabit a 
range of grassland habitats in Germany, but are restricted to maritime grasslands in Britain. The aim of 
the study reported in this paper was to compare the physical and vegetation characteristics and abundance 
of G. borelii at sites that support P. officinale in both countries. A field study was undertaken at five sites 
in both countries during the large larval feeding stage of G. borelii. The data collected included details of 
the soil, vegetation composition, density of P. officinale and occurrence of G. borelii larval feeding 
signs. The main findings were that P. officinale grows within a range of soil conditions, but obtains the 
greatest growth in acidic soils. Peucedanum officinale was found to occur at a lower density in areas that 
supported a high abundance of tall, coarse grass species. Conversely, a greater abundance of G. borelii 
larval feeding signs tended to be found at sites where tall, coarse grass species were dominant. The 
results are discussed and related to the management and conservation implications of P. officinale and G 
borelii in both countries. 

Zusammenfassung. Gortyna borelii ist zwar in vielen Ländern Europas verbreitet, kommt aber überall 
streng lokal an nur wenigen und eng begrenzten Fundorten vor. In Mitteleuropa ist Peucedanum officinale 
ihre einzige Raupennahrungspflanze. In Großbritannien wie in Deutschland stehen der Falter und die 
Nahrungspflanze auf den Roten Listen. Um die Zusammenhänge zwischen physikalischen Faktoren, 
Vegetationsstruktur und der Abundanz von G. borelii zu klären, wurden in beiden Ländern je 5 Standorte 
während der Raupenzeit besucht und Daten über Klima, Höhenlage, Vegetationszusammensetzung, Dichte 
von P. officinale und Raupendichte von G. borelii (anhand der Fraßspuren) registriert. Dabei zeigte sich, 
daß P. officinale auf verschiedenen Böden wächst, aber die größten Wuchshöhen auf saurem Boden 
erreicht. An Standorten, wo heute, harte Gräser große Abundanzen erreichen, kommt P. officinale nur in 
geringer Dichte vor. Dagegen wurden die meisten Raupenfraßspuren von G. borelii an Standorten ge- 
funden, wo hohe Grasarten dominierten. Die Ergebnisse werden im Hinblick auf Habitatmanagemenl 
und Schutzmaßnahmen diskutiert. 

Résumé. Gortyna borelii (Pierret, 1837) est une espèce rare, ayant une large répartition en Europe, bien 
que localisée. La plante nourricière principale de cette espèce est Peudecanum officinale. G. borelii et /' 
officinale, sont tous deux repris sur la Liste Rouge au Royaume-Uni tant qu'en Allemagne 11 n'y a eu 
que peu de recherche effectuée sur l'écologie de ce papillon et sa plante nourricière en Europe. G. borelii 
et P. officinale se trouvent tous deux dans plusieurs types d'herbages en Allemagne, alors qu'en Angleterre 
ils sont restreints à des herbages côtiers. L'objectif de l'élude rapportée dans le présent article était de 
comparer les caractéristiques tant physiques que végetationnelles, ainsi que l'abondance de G. borelii 
dans des sites qui abritent P. officinale dans les deux pays. Une étude sur le terrain a ete conduite sur cinq 
sites répartis dans les deux pays pendant la longue période correspondant à l'état larvaire de G. borelii. 
Les informations obtenues comprennent des données sur le sol. la composition de la végétation, la densité 
de P. officinale et la présence de traces de consommation par les chenilles tie G. borelii. I es résultats 
principaux de l'étude sont que P. officinale se trou\ e sur plusieurs types de sols, mais obtient une croissance 
maximale sur terrains acides. I'. officinale a été retrouvé en densité moindre en des endroits comprenant 
une grande abondance d'espèces de graminées hautes et dures. Au contraire, une plus grande abondance 
de traces de consommation larvaire de G. borelii a pu être observée sur des sites où les graminées hautes 
et dures prédominaient. Les résultats obtenus sont commentes et mis en rapport aux mesures de 
conservation et de maintien de G. borelii et de /' officinale à prévoir dans ces deux pays. 

Key words, biogeography, habitat, Gortyna borelii, larval foodplant. Peucedanum officinale. 

© Nota lepidopterologica. 01.08.2002. ISSN 0342-7536 



^ Ringwood, Gardiner, Steiner & Hill: life history of Gortyna borelii 

Introduction 

Gortyna borelii Pierret, 1837 is a large noctuid moth with a very localised, but wide- 
spread distribution in Europe. The moth has been recorded in many countries in Cen- 
tral and Southern Europe (Ippolito & Parenzan 1978; Nowacki & Fibiger 1996). In 
Britain (Bremerton et al, 1983) and Central Europe (Gyulai 1987), the species is clas- 
sified as the subspecies lunata Freyer, 1838. However, there is little evidence that the 
separation of G. borelii into subspecies is justified and therefore the taxonomic status 
of the moth remains contentious (Steiner 1998; Laszlo Peregovits, pers comm.). The 
principal larval foodplant of the moth is Peucedanum officinale Linnaeus, 1753, but 
G. borelii is also known to feed on Peucedanum longifolium L. (Gyulai 1987) and 
Peucedanum gallicum Latour (Dumont 1925-1926). 

The altitudinal range off! officinale is from sea level in Britain to about 1800 m in 
the mountains of Eastern Macedonia and Albania (Randall & Thornton 1996). The 
highest altitude at which G. borelii has been recorded is 1000 m in the Carpathian 
Basin, Romania, where it feeds on P longifolium (Gyulai 1987). The moth is found 
within a diversity of habitats: from meadows in forest clearings to limestone mountain 
ranges in Hungary (Gyulai 1987), from the Paris lowlands to the Upper Rhine Plain 
(Steiner 1998), and in regularly flooded pasture (König 1959). The populations of the 
moth in Britain are restricted to maritime habitats in south-east England. 

Gortyna borelii has a relatively recent recorded history in England: it was discovered 
in 1 968 and named Fisher 's Estuarine Moth (Fisher 1 97 1 ). The main English populations 
are located on the north Essex coast. These populations tend to occur <2m above mean 
sea level and are therefore, vulnerable to sea flooding and the habitat being affected by 
long-term sea level rise and encroachment of salt marsh (Ringwood et al, 2000). Other 
threats to the moth include inappropriate management of the sea defences, low 
population sizes and a lack of understanding of the ecological requirements of the 
species (Gibson 2000). Due to the tenuous nature of the habitat in which it is found, the 
moth is included within the British Red Data Book as Category 2 (Vulnerable) (Shirt 
1987) and P. officinale is listed as Lower Risk (Near Threatened) (Wiggington 1999). 
G. borelii was also added, in 1998, to Schedule 5 of the Wildlife and Countryside Act 
1981 (Gibson 2000). 

In Germany, G. borelii occurs mainly in the south-west of the country, especially in 
the valleys of the Rhine and its tributaries (in Baden- Württemberg and Rheinland- 
Pfalz). The species is listed within the German (Pretscher 1998) and Baden- Württemberg 
(Ebert 1998) Red Data Books as Category 1 (Threatened by Extinction), and is also 
protected under Federal Nature Protection Law 1987. Similarly, P. officinale is included 
within the German and Baden- Württemberg Red Data Books as Category 3 (Threatened) 
(Sebald et al 1992). Steiner (1998) mentions that the main threats to G. borelii in 
Germany are the fragmentation and destruction of meadows with P officinale by 
urbanisation or agricultural use, flooding and intensive mowing. 

The phenology of this species in Germany (Steiner 1998) is virtually the same as 
that in England (Heath & Emmet 1983; Skinner 1998; Gibson 2000). Diapause occurs 
in the ovum and the eggs hatch during April/May, the larval stages then develop to 



Notalepid. 25(1): 23-38 25 

August, with pupation occurring in August/September. This is followed by the flight 
period from September-October. During ovipositing, the ova are deposited beneath 
the outer leaf sheath of grass stems (Ippolito & Parenzan 1978; Platts 1981; Steiner 
1998). Observations in England have shown a preference in ovipositing for Elytrigia 
atherica, which has a loose pseudostem construction (Ringwood et ai. 2000). The 
larvae are stem borers: feeding first within the stems of P. officinale before moving 
down, during the mature larval stages, to the rootstock, where pupation occurs. 

There are plans to establish colonies of G. borelii further inland, away from the 
threats of sea level rise, to secure the long-term future of the species in England 
(Ringwood et al. 2000). However, before such plans can be developed it would be 
beneficial to examine aspects of soil conditions, vegetation structure and habitat char- 
acteristics that support populations of the species in continental Europe, away from 
maritime environments. 

The objectives of this paper are to present results from a study that compared sites 
in Germany (Baden- Württemberg) and in England that may support populations of G. 
borelii. The sites are compared in terms of climatological and geological information 
with field studies enabling details of the soil conditions, vegetation structure, density 
of P. officinale and incidence of the moth's larval feeding signs to be reported. In 
determining the habitat requirements of G. borelii factors such as larval foodplant 
density, sward composition and the effects of soil pH and nutrient status on the growth 
of P. officinale were also examined. The results are discussed in terms of environmen- 
tal management and the conservation implications for this species in each of these 
countries. 

Materials and Methods 

Ten sites in England and Germany were examined in the study. In England, the five 
sites chosen were located within 3.5 km of each other in the Walton Backwaters area 
of the north Essex coast. The close proximity of the sites chosen in England was due to 
the restricted distribution of G. borelii in this country. A view across the Walton Back- 
waters area is shown in Plate 1. The Walton Backwaters covers an area of around 800 
ha and is of particular environmental importance (Yearsley 1994). Hamford Water is 
the main creek that runs through the area and consists of constantly changing marshland 
and a number of islands. The Hamford Water is a Site of Special Scientific Interest, 
Special Protection Area and Ramsar Site (Countryside Agency 2000). The underlying 
geology of the area is a Palaeogene clay basin overlain by Neogene and early Pleistocene 
crag deposits with little or no drift geology. The mean annual temperature and pre- 
cipitation of the area are 10-1 1°C and 400-500 mm respectively. All sites are located 
at an altitude of less than 5 m OD. The five sites selected for field studies were Beaumont 
Quay, Bramble Island, Old Moze, Skipper's East and Skipper's West. Details of the 
characteristics of each of these sites are given in Table 1. 

In contrast to the English sites, the sites in Germany arc spread over a wide geo- 
graphical area and are up to 300 km apart. Four of the sites are in Baden- Württemberg 
(Speyer, Tübingen 1, Tübingen 2 and Zellerhorn) and one in Rheinland-Pfalz 



26 



Ringwood, Gardiner, Steiner & Hill: life history of Gortyna borelii 



(Oberhausen). The steep, rocky slope that characterises the Oberhausen site is shown 
in Plate 2. A description of each of the German sites is provided in Table 2 and reports 




Plate 1. The Walton Backwaters area (view towards Skipper's Island). Photo credit: Zoë Ringwood. 



Table 1. Characteristics of the English sites. 



Site 


Status 


Site description 


Altitude 
(m) 


Management 


Threats 


Beaumont 
Quay 


National 

Nature 

Reserve 


Long, rank, 
unimproved grassland 
on and behind a sea 
defense wall 


1-3 


Mown 
annually 


None 
perceived 


Bramble 
Island 


Privately 
owned 


Grassland within an 
industrial area 


4-5 


Mown 
regularly 


Intensive 
mowing 


Old 
Moze 


Privately 
owned 


Coarse unimproved 
grassland on and 
behind a steep, well 
maintained sea wall 


1-4 


None 


None 
perceived 


Skipper's 
East 


National 

Nature 

Reserve 


Coastal grassland 
located between the 
sea wall and scrub 


<2 


None 


Flooding and 

scrub 

encroachment 


Skipper's 
West 


National 

Nature 

Reserve 


Coastal grassland 
located between 
eroding sea defences 
and scrub 


<2 


None 


Flooding and 

scrub 

encroachment 



Nota lepid. 25 (1): 23-38 



27 




Plate 2. The steep, rocky slope at Oberhausen. Photo credit: Zoë Ringwood. 



Table 2. Characteristics of the German sites. 



Site 


Status 


Site description 


Geology 


Altitude 
(m) 


Management 


Threats 


Oberhausen 


Privately 
owned 


Dry grassland and 
scrub on a steep, 
rocky southerly 

lacing slope 


Permian 


180-250 


None 


Scrub 

encroachment to 
certain areas 


Speyer 


Part 


Moderately dry 


Alluvial 


100 


Mown 


I Insympathetic 




Nature 


grassland on an 






regularK 


management 




Reserve 


alluvial plain 








regime 


Tübingen 1 


Nature 
Reserve 


A southerly facing 
slope with 
unimproved 
grassland and 
scrub 


Triassic 


400-460 


Mown e\ erj 
third or fourth 
year 


None perceived 


Tübingen 2 


Nature 


Dry grassland 


I riassic 


510-530 


Removal o\ 


Scrub 




Reserve 


situated between 
vineyards and a 

forested area 






scrub ever) 
third or fourth 

v ear 


encroachment 


Zellerhom 


Nature 
Reserve 


Dry calcareous 
grassland located 
on a level area <>! a 
northerly facing 

slope 


Jurassic 


830-850 


Periodic 
mow ing 


None perceived 



RiNGWooD, Gardiner, Steiner & Hill: life history of Gortyna borelii 

that the altitude and underlying geology varies considerably between the sites. At 
Oberhausen, Speyer and Tübingen 1, the mean annual temperature is about 9°C and 
the mean annual precipitation is around 600 mm. However, at Tübingen 2 the mean 
annual temperature and precipitation are 7-8 °C and 700-800 mm respectively. 
Zellerhorn is the coldest and wettest of the sites with an average annual temperature of 
6°C and approximately 800-900 mm of rainfall recorded each year. 

Field Survey 

The five English and five German sites were surveyed between the 25 th June and 10 th 
July 2001. Ten 1 m 2 quadrats were placed randomly within the area of the main stands 
of P officinale at each of the ten sites surveyed. The number of P. officinale plants, 
height and width of each of these plants, and the height of the surrounding grass were 
measured in each of the quadrats. The percentage ground coverage was estimated by 
visual assessment (Bullock 1996) for each of the other vegetation species present 
(including grasses) in each quadrat. A sward classification system that grouped sward 
characteristics into density categories (Table 3) was used to provide information on the 
density of the sward within each of the quadrats. 

Table 3. The density categories in the sward classification system. 



Category 


Description 





>75% bare earth 


1 


Predominantly short (<0.25m) grass with 6-75% bare earth 


2 


Predominantly short (<0.25m) grass with <5% bare earth 


3 


A sward, mainly <0.5m in height, consisting of both fine leafed and coarse grass 
species 


4 


Tall (>0.5m) dense, coarse grass interspersed with patches of shorter grass 


5 


Tall (>lm), dense, coarse grass with a uniform sward height 



In addition to the quadrat surveys, fifty P. officinale plants were examined at 
each of the sites for the presence of G. borelii larval feeding signs (bore holes 
and/or frass piles within the stems, stem axils or at the base of the plant). This 
was conducted to obtain an indication of the abundance of this moth at each of 
the sites surveyed. The larval feeding signs of this species are very distinctive 
(Steiner 1985) and therefore cannot be confused with any other species of 
Lepidoptera. 

Soil samples were taken to a depth of 25 cm from every site in the survey and 
analysed for pH, available phosphorus, potassium and magnesium and 
conductivity according to MAFF (1986). 



Notalepid. 25(1): 23-38 29 

Statistical Analysis 

The data collected in the survey were non-parametric and therefore appropriate tests 
were conducted. Spearman's Rank correlation coefficient R s (Heath 1995) was 
performed to determine the relationships between mean P. officinale height and soil 
pH, conductivity and available soil magnesium, phosphorus and potassium at each of 
the sites. The test was also performed to determine the relationship between the 
proportion of P. officinale plants with G. borelii feeding signs, the mean number of P. 
officinale individuals per m 2 , mean P. officinale height and mean sward height at each 
of the sites. 

Czekanowski's coefficient (Kent & Coker 1992) was used to determine the botani- 
cal similarity between each of the sites in England and Germany. A chi-squared (% 2 ) 
test of association (Heath 1995) was conducted between the presence and absence of 
P. officinale and the most abundant grass species within quadrats in England and Ger- 
many. The English and German sites were grouped when performing this test. Mann- 
Whitney t/-test (Heath 1995) was used to determine if differences existed between the 
mean sward height at sites in England and Germany and also between the mean P. 
officinale height in both countries. 



Results 

The soil conditions at sites in England and Germany varied considerably (Table 4). 
The sites in England were characterised by soils of acidic nature and medium to heavy 
texture (predominantly sandy silt loams or clay loams). However, in Germany the 
soils were predominantly alkaline and medium to heavy texture (sandy loam, clay 
loams or clay). The exception was the site of Oberhausen which had acidic soils of 
light textural classification (loamy sand). The nutrient status of the soils varied 
considerably, for example, concentrations of available phosphorus levels ranged from 
4.0 mg/1 at Zellerhorn to 23.4 mg/1 at Bramble Island. The concentrations of available 
magnesium were very varied, ranging from 62 mg/1 at Speyer to 988 mg/1 at Tübingen 
2. Similarly, the concentrations of available potassium differed considerably between 
sites. The conductivity of soil solutions extracted from the various sites were relatively 
low in England and Germany. 

The relationship between soil pH and mean P. officinale height is illustrated in 
Figure 1 . There was found to be a significant negative correlation between the two 
factors (Table 5). No significant relationships were detected between P. officinale height 
and the major soil nutrients. A significant positive correlation was, however, observed 
between soil conductivity and P. officinale height (Tabic 5). 

A greater botanical species richness was recorded at the German sites (Tabic 6). At 
Zellerhorn, for example, a total of 40 species were recorded in the quadrat survey, with 
a maximum of 21 species per m 2 . Comparatively, at Skipper's East, nine species were 
noted, with a maximum of three species per m 2 . The vegetation at the English sites 
displayed some similarity in species composition (Table 7). 



30 



RiNGwooD, Gardiner, Steiner & Hill: life history of Gortyna borelii 



Table 4. Soil characteristics of the English and German sites. 



English Sites 


pH 


P(mg/1) 


Mg (mg/I) 


K(mg/1) 


Conductivity 

(uS/cm) 


Texture 


Beaumont Quay 


5.8 


20.6 


321 


451 


2345 


Clay loam 


Bramble Island 


5.4 


23.4 


399 


732 


3004 


Clay loam 


Old Moze 


5.8 


12.0 


212 


313 


2102 


Sandy silt loam 


Skipper's East 


6.2 


9.2 


324 


638 


2240 


Sandy silt loam 


Skipper's West 


6.6 


10.0 


334 


865 


2377 


Clay loam 


German sites 














Oberhausen 


6.4 


15.8 


106 


769 


1934 


Loamy sand 


Speyer 


7.9 


14.2 


62 


105 


2000 


Sandy loam 


Tübingen 1 


8.3 


5.4 


209 


355 


1992 


Clay loam 


Tübingen 2 


8.1 


7.2 


441 


988 


1971 


Clay 


Zellerhorn 


8.1 


4.0 


120 


133 


1983 


Clay loam 



1200 








^ 1100 
E 






i 
♦ England 


leight (m 

CD O 
O O 
O O 

i i 


< 
< 


► 
► 


■ Germany 


a 800 

<0 


I 


i * 


T 


o 700. 

E 






il 


Z 60 ° ~ 








S 500 - 
o 

400 
300 




i 


*i 


i 


! ' i 




j 


5 5.5 


6 6.5 7 7.5 
Soil pH 


8 8.5 9 



Figure 1. Relationship between soil pH and mean P. officinale height (s. e. bars shown). 



For example, Beaumont Quay was particularly similar to Old Moze and Skipper's 
East. The coarse grass species Arrhenatherum elatius and Elytrigia atherica dominate 
these three sites (Table 8). In comparison, the German sites displayed a lower level of 
similarity in species composition (Table 7), especially between Zellerhorn and Tübingen 
2, and Speyer and Tübingen 1. In addition to the differences in species richness at 



Notalepid. 25(1): 23-38 



31 



Table 5. The correlation (R s ) between mean P. officinale height and soil pH, nutrient content and 
conductivity. * - significant atp<0.05. 



Correlation Factors 


R s (probability level) 


Soil pH 


-0.732 (p<0.0 16)* 


Soil magnesium 


+0.515 (p<0. 128) 


Soil phosphorous 


+0.479 (p<0. 162) 


Soil potassium 


+0.139 (p<0.701) 


Soil conductivity 


+0.733 (p<0.016)* 



Table 6. Botanical characteristics of English and German sites. 



English Sites 


No. spp. 


Mean no. spp. / m 2 


Range in No. spp. / m 2 


Beaumont Quay 


21 


5.9 


2- 13 


Bramble Island 


19 


7.1 


3- 10 


Old Moze 


10 


4.9 


3-6 


Skipper's East 


9 


2.5 


1 -3 


Skipper's West 


12 


3.7 


3-6 


German sites 








Oberhausen 


17 


5.0 


3-7 


Speyer 


24 


7.4 


4- 10 


Tuebingen 1 


22 


8.9 


6- 12 


Tuebingen 2 


27 


8.1 


4-11 


Zellerhorn 


40 


16.1 


12-21 



these sites (Table 6), the most abundant grass species were also dissimilar (Table 8). 
For example, at Zellerhorn the main grass species were Briza media and Festuca 
pratensis, in comparison with A. elatius and Bromopsis erecta at Tübingen 2. The sites 
in England and Germany display a low level of similarity in grassland botanical char- 
acteristics (Table 7). In fact, the only similarity between certain sites in England and 
Germany was the presence of P. officinale. 

The incidence of P. officinale was found to be associated with the coarse grass 
species A elatius (yj\ 8.74, PO.01) and Elytrigia spp. (% 2 : 10.50, PO.01) in England 
(Table 9). Peucedanum officinale did not tend to occur in great abundance with these 
two coarse grass species and therefore the association was negative. In Germany, P. 
officinale was negatively associated with the presence of B. erect a (% : : 5.40, P<0.05). 
A difference (Mann-Whitney test, Z = 6.61, PO.001) was detected between mean 
sward height in England and Germany, with the English sites supporting taller swards 
(Table 8). A difference (Mann-Whitney test, Z = 7.61, PO.001) was also found in 
mean P. officinale height between the sites in England and Germany with a clear trend 
of mean height of the larval host plant being greater at English sites. The relationship 
between mean P. officinale height and mean sward height at the sites (R s - 0.903. P<0.00 1 ) 
in the study is illustrated in Figure 2. 



32 



Ringwood, Gardiner, Steiner & Hill: life history of Gortyna borelii 



The proportion of P. officinale plants with G. borelii feeding signs at the English sites 
ranged from 0.04 at Bramble Island to 0.54 at Skipper's East (Table 8). However, in 
Germany G. borelii was not recorded from Zellerhorn, whereas at Tübingen 2 the 
proportion of P. officinale with larval feeding signs was 0.34. The relationship be- 
tween the mean number of P. officinale individuals per m 2 and the proportion of P 
officinale plants with G. borelii feeding signs is illustrated in Figure 3. A negative 
correlation was observed between the two factors (Table 10). There was no significant 
relationship found between mean P. officinale height and the proportion of P officinale 
with G. borelii feeding signs, or between mean sward height and the proportion of P 
officinale plants with G. borelii feeding signs (Table 10). 



1200 - 






i 


r 


i P. officinale height (mm) 

CJl O) ^J CO CD O -»■ 

o o o o o o o 
o o o o o o o 


L 


J-, 
J— 


L 1 

— 1 


L 




♦ England 
■ Germany 








| 400- 
300 - 


^L 


I—, 






200 




' 




1 ' 


3( 


30 400 500 


600 700 800 


900 1000 1100 






Mean sward height (mm) 







Figure 2. Relationship between mean sward height and mean P. officinale height (s. e. bars shown). 



Discussion 

Many environmental differences between the sites in England and Germany were ob- 
served, including climate, topographical variation, soil, habitat and vegetative compo- 
sition. Climatic differences are due to many variables, for example, the coastal nature 
of the English sites and the fact that the climate of the German sites is continental. P. 



Notalepid. 25(1): 23-38 



33 





<N 
























s 
























(U 

B 


















1 


sC 




IS 




















d 




:3 
























H 
























_ 
























B 






















se 


0) 

ex 

s 
















, 


<* 




V 


S 


















d 


d 


33 


= 3 






















B 


H 






















ri 
























E 














































la 
























« 


'_ 






















u 


Ol 

CL 














1 


d 


(N 

ri 

d 


o 
d 




= 
























0) 
























s 

.S 














m 


<N 


00 


ON 














i 


ri 


(N 


(N 


(N 
















d 


d 


d 


d 



















































09 
























- 
























U 

CL 

a 

'J2 


M 










ci 


f- 


«o 


o 


s 




U 








1 


m 


(N 


—< 


ri 


rn 




£ 










d 


d 


d 


d 


d 




y; 
























09 
























u 
























Cl 
Cl 

3 










9 


co 


es 


CN 


_ i 


o 








1 




(N 


<N 


— 


•— i 


-r 




u 








d 


d 


d 


d 


d 


d 
























Efl 
























« 
























JJ 


a> 






















as 





































u-> 


o 


-i- 


m 


00 




J£ 


■c 






1 


m 


m 


(N 


ci 


— 


— 1 


rj 


Ti 








ö 


d 


d 


d 


d 


© 


d 


a 
_ 



















































E 
e 
























3 




fN 


_ 


ON 


ON 


nO 


ro 


r*- 


ri 




3 




X 


^o 


r<~j 


<N 


m 


— 


— 


ri 




o 


















d 
























aa 
























_o 
























E 


■3 


^ 


O 


t 


m 


OC 


■«fr 


m 


vO 


_ 




_n 


-î 


"3- 


-r 


>o 


CM 


r | 


— 


— 


f, 




■^ 
























E 


y. 


— 


° 


c -' 


° 


° 


° 


■ 


ö 







aa 




































































































O 




~ 


^ 


c 




















— 




u 






î 


B 
































5 


N 


r 


!fl 


3 




; 3 


'j 











B 


2 


y 


g 


_£ 


Jj 


VI 


Zl. 










g 




g 


C~ 


y 


y 


Z 


-H 








U 


s 


-i 
tf 


12 


_c 


T 


- 


H 


N 



a; 

t4-l 

O 

o 

o 
ex 

o 

— 

ex 






03 (U 

'53 Ej 

-p -§ 
ll' J 

^ LU 

ci o 
Ko 

B f 

-S .& 



B T3 






■C 
© 1 

S. es 

© 

eu 


d 


rn 


o 
d 


(N 

rj 

d 


c 
d 




-r 
d 


(N 

d 


oc 

- 
d 


oc 
O 

d 


q 
d 


s 

0) 

•o 
■a 
« 

B 

.2 
■5 


^t 


^3" 


tj- 


m 


m 




(N 


m 


(N 


■sr 


(N 


El 

WD 

'3 ^ 
■= E 

05 , 

E 42- 
a» 


oc 
oc 


r i 
(N 


-r 


r- 


X 




r- 
X 




r ) 


ON 


in 


d. 

Q. 
in 
<n 

ex; 

s 
M 
TJ 
s 

3 

< 




;/. 


~i. 


5 


1 




^ 


aq 


a« 


53 

q 

— 


58 


S 
'7 

"ëx 

e 


M 

U 

a 

C/2 


Ö 

y 


U 

g 


y. 




B 

B 
- 

B 


f 1 

c 

Z 




o 
f 

£ 


u 
u 


— 

u 

V 

N 



34 



Ringwood, Gardiner, Steiner & Hill: life history of Gortyna borelii 



. 0.6 i 
I 

5 0.5 

(0 

c 

! 0.4 



0.3 



o 

£ 
o 

q; o.2 



o 
c 
o 

r 
o 
a 
o 



0.1 




♦ England 
M Germany 



Mean P. officinale density (individuals per m ) 



Figure 3. Relationship between mean P. officinale density (s. e. bars shown) and the proportion of P. 
officinale plants with signs of G. borelii larval feeding. 

Table 9. Associations between P. officinale and the most abundant grass species in grouped English and 
German sites. Given are % 2 values (with 1 d.f.). NR - not recorded. * - significant at/?<0.05; ** - 
significant at p<0.0\ . 



Grass species 


England 


Germany 


Arrhenatherum elatius 


8.74** 


1.70 


Brom ops is erecta 


NR 


5.40* 


Dae ty lis glomerata 


0.70 


0.30 


Elytrigia spp 


10.50** 


0.93 


Festuca spp 


0.65 


0.02 


Holcus lanatus 


0.28 


0.08 



officinale showed a degree of adaptability in relation to its ability to withstand a vari- 
ety of climatic conditions and altitudes observed in this study. However, the absence of 
the moth at Zellerhorn is suggested to be in response to poor adaptation to the adverse 
climatic conditions at the site. 

In England, P. officinale is a plant of coastal grassland, growing on heavy clays and 
recent alluvial deposits (Thornton 1990). The German populations are generally found 
in calcareous grasslands, particularly near rivers and in mountainous meadows (Randall 



Nota lepid. 25 (1): 23-38 35 

Table 10. The correlation (R s ) between the proportion of P. officinale plants with G. borelii feeding signs 
and P. officinale density, mean P. officinale height and mean sward height. * - significant at/?<0.05. 



Correlation Factors 


R s (probability level) 


P. officinale density 


-0.644 (p<0.044)* 


Mean P. officinale height 


+0.398 (p<0.255) 


Mean sward height 


+0.379 (p<0.280) 



& Thornton 1996). The grasslands in both countries, however, tend to be unimproved. 
The English populations occur within species-poor unimproved grassland, whereas in 
Germany the plant tends to grow in species-rich meadows (Table 6). 

The grassland areas in England that support P. officinale display a level of similar- 
ity, but the vegetation composition of the German sites was more varied (Table 7). 
This may be due to the differences in altitude and climate within the sites in Germany 
(Table 2), or the fact that the German sites were generally located a considerable dis- 
tance from each other. Peucedanum officinale was observed in greatest abundance at 
sites where it was not in competition with dominant, coarse grass species, such as A. 
elatius, E. atherica and B. erecta. It was observed that very dense swards where these 
species are abundant support a very low density of P. officinale. Randall & Thornton 
(1996) state that initial establishment of P. officinale is reduced by dominant grass 
species. This is tentatively supported by the observations that P. officinale was signifi- 
cantly negatively associated with A. elatius, B. erecta and Elytrigia spp. (Table 9), and 
did not tend to occur in great abundance with these coarse grass species. 

The mean sward and P. officinale height were significantly greater within the Eng- 
lish sites. This may be due to a number of factors, including climate, altitude, topogra- 
phy and soil conditions. The climate and altitude at the German sites were very differ- 
ent to those in England (Tables 1 & 2). The topographic conditions in Germany were 
predominantly quite extreme with steep rocky slopes at several sites. These conditions 
tend to support thin, well-drained soils, which do not provide optimal growing condi- 
tions for many species of plant. The survey results indicate that pH (Figure 1) and soil 
conductivity may be important factors in determining the growth of P. officinale, but 
that this plant species is tolerant of a range of soil conditions. However, the relation- 
ship between P. officinale height and soil conductivity may be misleading, as although 
a significant positive correlation was calculated between these factors (Table 5), the 
soil conductivity levels at all the sites were relatively low and the range of conductiv- 
ity was relatively narrow. Also, P. officinale does not grow on salt marsh in England 
even though it is associated to coastal habitats. 

The density off! officinale within a sward was found to have an influence on the 
abundance of G. borelii. Sites in the study with a low density of P. officinale were 
generally observed to have the greatest proportion of G. borelii larval feeding signs 
(Figure 3). The sites in England with the greatest proportion of G. borelii larval feed- 
ing signs support very tall and dense swards (Table 8). Hart (1999) also observed that 



•JV Ringwood, Gardiner, Steiner & Hill: life his tory of Gortyna borelii 

the most favoured sites for the larvae occur where P. officinale grows amongst long, 
rank grass. The reasons for this may be due to the ovipositing requirements of this 
species. Ringwood et al (2000) observed that in England G. borelii has oviposition 
preferences for Elytrigia spp., but the moth has also been observed egg laying on A. 
elatius and D. glomerata (Ringwood et al 2002 and unpublished data). These coarse 
grass species tend to dominate grasslands, but also restrict the abundance of P. officinale. 
It is, however, essential for coarse grasses to be present, providing an abundance of 
oviposition hosts for the moth in England. However, the host plants for ovipositing in 
Germany have not been recorded and further studies are required. The results from this 
study suggest that B. erecta and A. elatius are potential oviposition host plants in Ger- 
many, as they are the predominant grass species at most of the sites. The availability of 
suitable grass species during the flight period may be an important management con- 
sideration. 

Inappropriate mowing regimes at some of the English and German sites may pose 
a threat to the survival of the moth and P. officinale. For instance, at Bramble Island 
(Table 1) and Speyer (Table 2) the sites were mown regularly and neither appears to 
support a large colony of G. borelii (Table 8). Another serious threat to colonies in 
both countries is scrub encroachment, which is particularly serious at Skipper's East 
and West and Tübingen 2. We suggest that some form of scrub control is necessary, 
with mowing being the most practical solution at most of the sites. However, the inten- 
sity and time of year when mowing is conducted needs very careful consideration. 
Gibson (2000) states that mowing during the flight period (September-October) may 
be detrimental to G. borelii as adult moths and eggs may be damaged. August may be 
a more appropriate time of year to mow as the larva is feeding and pupating under 
ground (Hart 1999). However, mowing at this time of year may prevent the grass 
growing sufficiently to provide suitable oviposition sites. Further research aimed at 
determining the most appropriate management is being undertaken in England. 

Management recommendations in England must also include the consideration of 
sea level rise and the risk of sea flooding at certain sites. Skipper's Island, which is 
thought to contain over 70% of the English G. borelii population (Tarpey 1999), is 
under serious threat from the impending rise in sea level. Indeed, almost the entire 
English population of this moth may be lost at any time as a result of a single surge 
tide. Thus, the establishment of populations of this species further inland may be para- 
mount to its survival in England. The German populations are able to persist a consid- 
erable distance from the sea, in a wide range of habitats, soil conditions and at altitudes 
with a more extreme climate. This may indicate that English populations may be able 
to persist at locations away from coastal environments. However, further research is 
needed into the ecological requirements of P. officinale and G. borelii in both coun- 
tries. 

G. borelii has a widespread, but very localised European distribution. In many coun- 
tries where it is found, the species is rare and has some form of legal protection. The 
main reason for the rarity of this moth is probably the limited distribution of P. officinale. 
As the plant has been found to grow within a diversity of unimproved grasslands, it is 
thought that the limited distribution may be largely due to the human actions of urbani- 



Notalepid. 25(1): 23-38 37 

sation, agricultural intensification and other changes in land use. It must now be de- 
cided whether human intervention should be used to the benefit of both the moth and 
its foodplant by establishing colonies of P. officinale and consequently securing the 
future of G. borelii. 



Acknowledgements 

The authors would like to thank English Nature, the Cambridgeshire and Essex branch of Butterfly 
Conservation and the Environment Agency for providing funding for this study. We are also grateful to 
the Essex Wildlife Trust and Exchem Organics for allowing access to their land. A special thank you is 
given to Martin Heywood, Gavin Sheill and Leon Woodrow for all their help with the fieldwork. Finally, 
we thank the anonymous referees who gave useful comments on an earlier draft of this paper. 

References 

Bremerton, R. F., B. Goater & R. I. Lorimer 1983. Noctuidae: Cuculliinae to Hypeninae. pp. 36-413. - 

In: Heath, J. & Emmet, A. M. (eds.), The moths and butterflies of Great Britain and Ireland 10. - 

Harley Books, Colchester. 
Bullock, J. 1996. Plants. -In: W. J. Sutherland, Ecological census techniques: a handbook. Cambridge 

University Press, Cambridge. - p. 111-138 
Countryside Agency. 2000. The state of the countryside. - Countryside Agency, Wetherby. 
Dumont, C. 1925-1926. Observations biologiques sur les Hydroecia françaises. - Encycl. ent. 1: 53-72. 
Ebert, G. 1998. Gefährdung und Schutz. -In: Ebert, G. (ed.), Die Schmetterlinge Baden-Württembergs 

7. Nachtfalter V. - E. Ulmer Verlag, Stuttgart. - p. 1 1-20. 
Fisher, J. B. 1971. Gortyna borelii Pierret (ssp. lunata Freyer?): a new British Moth. - Entomologist's 

Rec. J. Var. 83: 51-52. 
Gibson, C. 2000. The conservation of Gortyna borelii lunata Freyer (Lep: Noctuidae). - Entomologist's 

Rec. J. Var. 112: 1-5. 
Gyulai, P. 1987. Notes on the distribution of Gortyna borelii lunata Freyer in the Carpathian Basin. 

Nota lepid. 10: 54-60. 
Hart, C. 1999. An estimation of the range and population levels of Fisher's Estuarine Moth (Gortyna borelii 

lunata Freyer) (Lep.: Noctuidae) in Essex, July and October 1996. - Br. J. Ent. Nat. Hist. 11: 129-138. 
Heath, D. 1995. An introduction to experimental design and statistics for biology. - UCL Press Limited. 

London. 
Heath, J & Emmet, A M. (eds.) 1983. The moths and butterflies of Great Britain and Ireland 10. I larle) 

Books, Colchester. 
Ippolito, R. & Parenzan, P. 1978. Contributo alia conoscenza della Gortyna Ochs. Europee. 

Entomologica, 14: 159-202. 
Kent, M. & Coker, P. 1992. Vegetation description and analysis a practial approach. Belhaven Press, 

London. 
König, F. 1959. Beiträge zur Kenntnis der Lebensweise von Hydroecia leueographa Bkh. I olia I at. 

Hung. 13:481-493. 
MAFF. 1986. The analysis of agricultural materials. - HMSO, London. 
Nowacki, J. & Fibigcr, M. 1996. Noctuidae. In: karsholt. (). & J. ftazowski, I he I epidoptera of 

Europe. A distributional checklist. Apollo Books. Stenstrup. p. 251 2 l M 
Platts, J. 1981. Observations on the egg-laying habits of Gortyna borelii lunula in the wild. 

Entomologist's Rec. J. Var: 93: 44. 
Pretscher, P. 1998. Rote Liste der Grossschmetterlinge (Macrolepidoptera). In: M. Binot, k. Bless, P. 

Boye, H. Gruttke & P. Pretscher (eds.), Rote l iste gefährdetet Merc Deutschlands. Schriftenr. 

Landschaftspfl. Natursch. 55: 84 111. 
Randall, R. E. & Thornton, G. 1996. Biological flora of the British Mes Peucedanum officinale I J. 

Ecol. 84: 475^185. 



38 



Ringwood, Gardiner, Steiner & Hill: life history of Gortyna borelii 



Ringwood, Z., J. Hill & C. Gibson 2000. A study of Gortyna borelii lunata Freyer (Lep.: Noctuidae): 
Results from the first season of behavioural observation sessions. - Entomologist's Rec. J. Var. 112: 
93-99. 

Ringwood, Z., J. Hill and C. Gibson. 2002. Observation on the ovipositing strategy of Gortyna borelii 
Pierret, 1837 (Lepidoptera, Noctuidae) in a British population. - Acta zooi. hung (In press) 

Sebald, O., S. Seybold & G. Philippi 1992. Die Farn- und Blütenpflanzen Baden- Württembergs. Band 4: 
Spezieller Teil (Spermatophyta, Unterklasse Rosidae) Haloragaceae bis Apiaceae. - E. Ulmer Ver- 
lag, Stuttgart. 

Shirt, D. B. (ed.) 1987. British Red Data Books: 2 Insects. - NCC, Peterborough. 

Skinner, B. 1998. The colour identification guide to moths of the British Isles. - Viking, London. 

Steiner, A. 1985. Bemerkungen über Gortyna borelii. - Ent. Z. 95: 167-173. 

Steiner, A. 1998. Gortyna borelii. -In: G. Ebert (ed.), Die Schmetterlinge Baden- Württembergs 7. Nacht- 
falter V - E. Ulmer Verlag, Stuttgart. - p. 79-86. 

Tarpey, T. 1999. Sea Hog's Fennel {Peucedanum officinale) and Fisher's Estuarine Moth (Gortyna borelii 
lunata) in Hamford Water. - Unpublished report for English Nature. 

Thornton, G. 1990. An environmental flora of Peucedanum officinale - Hog's Fennel. - Dissertation, 
Board of Continuing Education, University of Cambridge. 

Wiggington, M. J. 1999. British Red Data Books 1 Vascular Plants (3 rd edition). - JNCC, Peterborough. 

Yearsley, I. 1994. Islands of Essex. - Ian Henry Publications Ltd., Romford. 



Notalepid. 25(1): 39-59 39 

Experimental evidence for specific distinctness of the two wood 
white butterfly taxa, Leptidea sinapis and L. reali (Pieridae) 

Anja Freese & Konrad Fiedler 

Animal Ecology I, University of Bayreuth, Universitätsstr. 30, D-95440 Bayreuth, Germany 
e-mail: konrad.fiedler@uni-bayreuth.de 



Summary. In mating experiments in a flight cage females, and to a lesser extent the males, of Leptidea 
sinapis und L. reali discriminated during mate choice. As a consequence only intraspecific matings 
occurred within these two morphologically defined taxa. The possibility of speciation through sexual 
selection and female choice is discussed. The response of both Leptidea species towards four food plants 
{Lotus corniculatus, Lathyrus pratensis, Vicia cracca, Medicago sativa) was experimentally studied. 
Ovipositing females in choice tests showed significantly different preferences, with L. reali favouring L. 
pratensis, while L. sinapis preferably laid eggs on L. corniculatus. Both species largely rejected M. 
sativa. With regard to fitness parameters such as prepupal weight, developmental duration and growth 
rate, rank orders of the tested food plants were equal for both Leptidea species. Lotus corniculatus was 
the optimal host, followed by Lathyrus pratensis and Vicia cracca, with Medicago sativa being least 
favourable. Interspecific differences in life-history parameters were small. L. reali grew on average 
slightly larger, while L. sinapis had shorter development times and higher growth rates. The extent of 
protandry was 2 days in both Leptidea species. In food-choice tests fourth (= final) instar larvae of both 
Leptidea species preferred L. corniculatus; M. sativa was rarely chosen. Ranking of food plants in choice 
situations was similar in the two Leptidea species and matched their ranking with regard to larval fit- 
ness. Discrepancies between preference and performance occurred in L. reali (relative rank of I. pratensis 
versus L. corniculatus) and point towards an evolutionarily young, not yet fixed ecological differentia- 
tion between the two Leptidea species. Our experimental findings support the notion that L. reali and L. 
sinapis are true biospecies with ethological reproductive isolation, but only minimal differentiation with 
regard to ecology and life-history. 

Zusammenfassung. In Verpaarungsversuchen in einem Flugkäfig diskriminierten vor allem die Weib- 
chen, aber nur begrenzt die Männchen, von Leptidea sinapis und L. reali bei der Partnerwahl. Infolge- 
dessen kam es ausschließlich zu intraspezifischen Kopulationen innerhalb der beiden morphologisch 
definierten Taxa. Die Möglichkeit der Aufspaltung beider Arten durch sexuelle Selektion und Weibchen- 
wahl wird diskutiert. Die Reaktion beider Leptidea- Aritrx gegenüber 4 Fraßpflanzen (Lotus corniculatus. 
Lathyrus pratensis, Vicia cracca, Medicago sativa) wurde experimentell geprüft. Bei der Eiablage zeig- 
ten die Weibchen in Wahlversuchen signifikant unterschiedliche Präferenzhierarchien, wobei L. reali 
zugunsten von L. pratensis diskriminierte, während L. sinapis bevorzugt auf L. corniculatus ablegte. 
Beide Arten mieden M. sativa weitgehend. Für beide Leptidea- Arien galt dieselbe Rangfolge der Pflanzen- 
arten in Bezug auf deren entwicklungsphysiologische Qualität (gemessen über Präpuppengewichte, 
Entwicklungsdauer und Wachstumsrate). Lotus corniculatus war die hochwertigste Pflanzenart, gefolgt 
von den relativ gleichwertigen Arten Lathyrus pratensis und Vicia cracca und an letzter Stelle Medicago 
sativa. Zwischenartliche Unterschiede in den Lebenszyklusparametern waren gering. /.. reali wurde im 
Mittel etwas größer, L. sinapis dagegen zeigte kürzere und raschere Entwicklung. Das Ausmaß der 
Protandrie war mit 2 Tagen Entwicklungsdifferen/ bei beiden Leptidea- Anew gleich. In l'utterwahl- 
versuchen wählten Raupen im vierten (= letzten) Larvalstadium beider Leptidea- Avxcn bevorzugt /.. 
corniculatus, M. sativa wurde kaum angenommen. Die Rangfolge der Fraßpflanzen in Wahlsituationen 
galt für beide Leptidea-Arien gleichermaßen und stimmte mit der Rangfolge der ernährungs- 
physiologischen Eignung übercin. Diskrepanzen /wischen Eiablagepräferenz und Eignung der Fraß- 
pflanzen traten bei L. reali auf (relativer Rang von /.. pratensis versus /.. corniculatus) und deuten auf 
eine junge, noch nicht gefestigte ökologische Differenzierung der beiden Leptidea-Axten hm. Nach die- 
sen experimentellen Befunden sind L, reali und /.. sinapis echte Biospezies mit ethologischer 
Fortpflanzungsbarricre, aber nur geringfügig differenziert im Hinblick auf Ökologie und Lebenszyklus. 

Résumé. Lors d'expériences d'accouplement en cage de vol, les femelles, et en moindre mesure les 
mâles, de Leptidea sinapis et de !.. reali curent une attitude discriminante lors du choix du partenaire. In 
conséquence, seulement des accouplements intraspeciliqucs eurent lieu parmi ces deux taxons morpho- 
logiquement définis. La possibilité d'une spéciation par selection sexuelle et par choix par la femelle est 
discutée. La réponse des deux espèces de Leptidea envers quatre plantes nourricières (Lotus < ornicu/attis. 
Lathyrus pratensis. Vicia cracca. Medicago sativa) a etc étudiée expérimentalement, lors de la ponte 
durant des tests de choix, des différences significatives furent observées, /.. reali favorisanl /.. pratensis 

© Nota lepidopterologica. 01.08.2002. ISSN 0342-7536 



^"" Freese & Fiedler: Specific distinctness of Leptidea sinapis and L. reali 

alors que L. sinapis pondait de préférence sur L. corniculatus . Les deux espèces rejetèrent largement M. 
sauva. Eu égard aux paramètres de fitness tels que le poids prépupal, la durée de développement et le 
degré de croissance, les ordres par degré pour les plantes nourricières utilisées lors de ces expériences 
furent les mêmes pour les deux espèces. Lotus corniculatus était la plante-hôte optimale, suivie de Lathyrus 
pratensis et de Vicia cracca, Medicago sativa étant la moins appropriée. Les différences interspécifiques 
au niveau des paramètres biologiques étaient faibles. L. reali atteignit une taille moyenne légèrement 
supérieure, alors que L. sinapis avait une durée de développement inférieure et un degré de croissance 
plus important. La protérandrie était de 2 jours pour les deux espèces. Lors de tests de préférence 
nourricière, les chenilles au quatrième (et ultime) état des deux espèces de Leptidea préférèrent L. 
corniculatus; M. sativa était rarement retenue. La classification en ordre de préférence des plantes nour- 
ricières en situations de choix était similaire pour les deux espèces de Leptidea et correspondait à leur 
classification eu égard au fitness larvaire. Des oppositions entre préférence et performance étaient appa- 
rentes chez L. reali (rang relatif de L. pratensis par rapport à L. corniculatus) et semblent indiquer une 
différenciation très récente des deux espèces de Leptidea du point de vue évolutif, qui n'est pas encore 
fixée écologiquement. Nos observations expérimentales sont à l'appui de la notion que L. sinapis et L. 
reali sont de vraies bio-espèces reproductivement isolées du point de vue éthologique, mais ne manifes- 
tant q'une différenciation minimale aux niveaux écologique et biologique. 

Key words. Biospecies, ethological reproductive isolation, life-history, preference, performance, 
sibling species, sexual selection, female choice, hostplant relationships. 

Introduction 

Though there is still no universal consensus about how to define a 'species' (Hey 
2001), this category remains the central unit for many branches of biology such as 
phylogenetics or biodiversity research. Among zoologists the biospecies concept is 
often accepted as the operationally most useful one (e.g. Collins 1991, Luckow 1995). 
A biospecies is defined as a 'group of actually or potentially interbreeding natural 
populations, which are reproductively isolated from other such groups' (Mayr 1942). 
Although this concept has not gone unchallenged and many alternatives are still dis- 
puted in the literature (Hey 2001), its major advantage is that it allows for an objective 
experimental testing of species boundaries. The two major approaches to test for spe- 
cific distinctness of two putative entities are (1) to measure gene flow between natural 
populations or (2) to attempt crossings under controlled environmental conditions. 
Such tests then reveal at which positions in the continuum between complete repro- 
ductive isolation and free gene flow two entities are situated. 

In practical taxonomy, however, recognition of species is frequently based on 
phenotypic differentiation alone. This 'morphospecies concept' is at odds with evolu- 
tionary theory, since static morphological entities cannot evolve per se. Morphospecies 
are categories subjectively defined by human observers on the grounds of 'similari- 
ties' and are a priori not natural entities. Yet, since phenotypic differentiation fre- 
quently is based on genotypic divergence, the morphospecies concept remains a useful 
surrogate for species as true biological entities as long as relevant information about 
reproductive isolation is non-existent. 

In recognizing species boundaries among taxonomically complex species groups 
(such as sibling species), phenotypic evidence almost always predates, and mostly 
even stimulates, research on potential reproductive isolation. Thereby, the morpho- 
logically based hypothesis on the existence of two (or more) species is tested in the 
framework of the biospecies concept. 

Even in well studied taxa and regions, such as butterflies in central Europe, occasion- 
ally new phenotypic entities continue to be discovered that are then described as new 



Notalepid. 25(1): 39-59 41 

species. The wood white butterflies of the genus Leptidea provide one of the most 
interesting examples in the past 15 years. A number of ecological and behavioural 
studies had dealt with 'Leptidea sinapis (Linnaeus, 1758) sensu lato' (e.g. Wiklund 
1977a, 1977b, Wiklund & Solbreck 1982, Warren 1984, 1985; Warren et al. 1986). 
Yet, in 1988 Real (1988) recognized on the grounds of genitalia studies that this well 
known taxon might rather comprise a sibling species complex: L. sinapis s. str. and a 
newly separated taxon, L. reali Reissinger, 1989 (= L. lorkovicii Real, 1988). Females 
(Real 1988) as well as males (Lorkovic. 1993) can be diagnosed by means of genitalia 
measurements. External characteristics such as wing colours are less suitable, since 
they vary strongly within both taxa in a similar way. Only extreme wing phenotypes 
appear to allow for a reliable discrimination (Mazel 2000, 2001a). 

The status of L. reali as a distinct species was immediately accepted in many pub- 
lications including identification guides (e.g. Tolman & Lewington 1998). Faunistic 
studies revealed thatZ. sinapis andZ. reali co-occur over wide areas of Europe (Mazel 
2000, 2001a, 2001b). Only few authors (Lorkovic. 1993; Kudrna 1998) remained more 
sceptical and called for detailed research to substantiate the hypothesis of specific 
distinctness between L. reali andZ. sinapis. One reason for this wide and rapid accept- 
ance of the specific status of L. reali might be found in the high value currently placed 
on genitalia characters in Lepidopteran taxonomy. Disregarding the fact that genitalia, 
like any other morphological feature, exhibit phenotypic plasticity and intraspecific 
variation (Goulson 1993; Monti et al. 2001), differences in genitalia morphology are 
readily accepted as indicators for the existence of true biospecies. Underlying this 
conception is the lock-and-key hypothesis (e.g. Kullenberg 1947; Shapiro & Porter 
1989), according to which genitalia differences were to provide prezygotic reproduc- 
tive isolation barriers. However, support for this hypothesis is scant (Mikkola 1992; 
Sota & Kubota 1998), and there is increasing evidence that in many cases genitalic 
differentiation is more related to sexual selection and cryptic female choice (Eberhard 
1993; Arnqvist 1998) rather than maintaining reproductive isolation. 

Apart from confirmations of the genitalic differentiation, critical studies on the 
status of both Leptidea forms as biospecies were lacking thus far (e.g. Lorkovic. 1 993). 
Similarly, published indications of some ecological divergence between both forms 
are all derived from anecdotal observational evidence, without controlling for any con- 
founding variables and without any statistical evaluation of the results. For example, 
differential preferences of females for egg-laying substrates have been postulated (e.g. 
Lorkovic. 1993; Kristal & Nässig 1996), with L. reali preferentially ovipositing on 
Lathyrus spp. while L. sinapis should lay eggs more freely on Lotus corniculatus or 
Vicia cracca. 

Therefore, the aim of the present study is two-fold: (1) to assess by means of mat- 
ing experiments under controlled conditions whether L. reali and L. sinapis butterflies 
recognize each other as distinct species and thus really avoid hybridization; and (2) to 
assess whether the two forms differ from each other with regard to egg-laying, food 
acceptance or larval performance on a range of hostplants that have been recorded to 
be utilized by the L. sinapis complex. 



^■^ Freese & Fiedler: Specific distinctness of Leptidea sinapis and L. reali 

Material and methods 

Egg-laying experiments. Butterflies from both Leptidea forms were brought 
into the laboratory for egg-laying. Insects were sampled during the emergence of both 
generations (1 st generation: May, 2 nd generation: mid July to mid August) in the vicin- 
ity of Bayreuth and Würzburg (northern Bavaria). 

To test for oviposition preferences, field-caught females were placed singly in glasses 
(2 litres) covered with gauze and lined with moist filter paper. A small vial with con- 
centrated sucrose solution was added for nourishment. Glasses were placed in an envi- 
ronmental chamber (25 °C constant, L:D regime 18:6 h). 

Each female was offered simultaneously three small bunches of oviposition 
substrates, viz. Medicago sativa, Lathyrus pratensis, and Lotus corniculatus in the 
first generation and Lathyrus pratensis, Lotus corniculatus and Vicia cracca (all 
Fabaceae) in the second generation. These plant species have been recorded frequently 
as hostplants (Thomas & Lewington 1991; Bink 1992; Ebert & Rennwald 1993) and 
were readily available in sufficient supply. Care was taken to only offer young foliage 
of each plant species in approximately equal amounts. Every day the bunches were 
exchanged and the numbers and placement of all eggs laid during the preceding day 
was noted. Egg-laying was followed for each experimental female until her death. For 
each female taxonomic identity was subsequently assessed by dissecting the genitalia. 
All these females could be unequivocally assigned to one of the two morphospecies 
using the genitalic characters described in the literature. 

For statistical evaluations only females were considered who laid at least 10 eggs in 
captivity. For each individual the proportions of eggs laid on any available food plant 
species was calculated, taking her lifetime fecundity as 100%. These proportions were 
then compared between the two Leptidea species. 

Effects of food plants on performance and fitness. Until hatching, eggs 
were kept in the same environmental chamber as the adult butterflies. Offspring of each 
female was kept separately throughout the entire development. Upon hatching, larvae were 
transferred in groups of two individuals into transparent plastic vials (250 ml) lined with 
moist filter paper. To circumvent diapause and standardize developmental conditions, 
caterpillars and pupae were placed in an environmental chamber under long day conditions 
(25 °C constant, L:D regime 18:6 h). Fresh food was supplied in excess every second day. 
During the fourth instar caterpillars were reared individually to avoid food competition. 

We simultaneously reared offspring of the first generation of both species in no- 
choice tests on either Lathyrus pratensis, Lotus corniculatus or Medicago sativa, re- 
spectively. Offspring of the second generation received Lathyrus pratensis, Lotus 
corniculatus or Vicia cracca, respectively. Plants of the genus Medicago have rarely 
been recorded as Leptidea hostplants (e.g. Bink 1992). By including M. sativa we 
aimed to test how strongly larval performance was affected if larvae were forced to 
develop on this apparently less preferred hostplant species. Within each generation 
larvae were randomly assigned to the food treatments. 

For each caterpillar the following parameters were recorded: duration of larval de- 
velopment, duration of the fourth larval instar, mass at the beginning of the fourth 



Nota lepid. 25 (1): 39-59 43 

larval instar, prepupal mass, duration of pupal phase. The relative growth rate in the 
final larval instar was calculated from these data as: RGR = [In (prepupal weight) - In 
(initial weight)]/duration of instar. 

Previous analyses have shown that growth rate (apart from body size and develop- 
ment time) should be treated as a life-history parameter in its own right and that the 
above version of calculating growth rates has a number of statistical advantages (see 
Nylin & Gotthard 1998; Fischer & Fiedler 2001). Weights were determined on an 
electronic Sartorius MC 21 OP balance to the nearest 0.1 mg. Since prepupae had to be 
removed from their girdle for weighing, the resulting pupae were later fixed using 
double-sided sticky tape. This procedure ensured safe metamorphosis of the great 
majority of individuals (> 95%). 

Food choice experiments. For food choice experiments, fourth instar lar- 
vae of both species were placed individually in Petri dishes (12 cm diameter, height 
1 .5 cm) lined with moistened filter paper. Larvae for these tests were randomly chosen 
from the mass rearing which occurred on the two sets of three plant species each in the 
first and second generation (see above). All larvae were used for a test only once. The 
plant species on which a test larva had developed prior to the experiment was recorded 
as the factor 'Reared' for subsequent analysis, whereas the plant species chosen was 
noted as 'Selected '. Thus it was possible to account for inductions of preferences through 
earlier feeding experience. Each animal was then allowed to choose between three 
food plant species offered simultaneously in such a way that foliage of each plant 
species covered approximately one third of the area, while the centre of the Petri dish 
remained free. The test caterpillar was introduced in this centre with random orienta- 
tion. The Petri dishes were then placed in the same environmental cabinet as the other 
larvae. After 24 h we recorded on which of the three plants the caterpillars were actu- 
ally feeding. 

Food choice tests were performed with the same plant combinations as the no- 
choice performance experiments. Larvae in spring and early summer were offered 
Lathyrus pratensis, Lotus corniculatus and Medicago sativa, while those in late sum- 
mer were offered Lathyrus pratensis, Lotus corniculatus and Vicia cracca. 
Mating experiments. To obtain intra- and possibly interspecific matings, a 
flight cage (2.4 x 1 .2 x 1 .2 m) covered with gauze was placed in a greenhouse at 30 °C 
und 60% relative humidity, illuminated by strong lamps that emitted a sufficient UV 
fraction. In this cage butterflies of both sexes and species could fly freely. Since all 
individuals were marked uniquely by numbers that had been maintained throughout 
their development and since all mother butterflies had been identified based on genitalic 
dissection after their death, the taxonomic identity of each butterfly individual in the 
flight cage was known with certainty. As food sources vials w ith sucrose solution and 
bunches with natural nectar sources (L. corniculatus flowers) were offered In total, 30 
to 60 butterflies were present at each observation in the cage whose mean age was 2.2 d 
(range: 0-10 d). Observations were conducted for 2-3 h/d on 1 1 d during emergence 
of the summer generation. Whenever courtship behaviour occurred, the following data 
were recorded: the individual numbers of the butterflies involved, duration of court- 
ship sequences (measured with a stop watch), the female's reeeptiveness (indicated by 



44 



Freese & Fiedler: Specific distinctness of Leptidea sinapis and I. reali 



her bending of the abdomen towards the courting male or, alternatively, by her avoid- 
ance behaviour), and the incidence and duration of a resulting copulation. 
Statistical evaluation. Results were evaluated using standard statistical pro- 
cedures (Sachs 1997) as implemented in the package Statistica 6.0 (StatSoft 2001). 
Throughout the text, means are reported ± one standard deviation. Test statistics and 
sample sizes are given for each type of comparison. Where multiple tests on the same 
data set had to be performed, we applied a sequential Bonferroni correction (Hochberg 
1988) to maintain a table-wide significance threshold of p=0.05. 

Results 

Oviposition preferences. Females of both species laid eggs on all offered 
food plants. Some eggs were even laid on non-plant substrates such as glass, filter paper 
or gauze. Numbers of eggs laid per female were low and did not differ between species 
(L. reali: 37.2+31.8 eggs (range 2-143, n=38); L. sinapis: 33.1+35.8 eggs (range 4-129, 
n=18); Mann-Whitney [/-test: z=0.94, p>0.34; Fig. 1). Mean fecundity was thus similar 
to the value reported by Bink (1992) for 'L. sinapis sensu lato', while maximum fecun- 
dity in our samples was much higher (up to 143 eggs). Eighteen!, reali and 10 L. sinapis 
females laid enough eggs to allow for a statistical evaluation. Among these, interspecific 
differences were noted only for egg-laying onL. pratensis (Mann- Whitney U-test: z=2.52, 
p<0.01, significant after sequential Bonferroni correction). L. reali females laid a larger 
fraction of their egg-load on this plant species as compared to L. sinapis (Fig. 2). 



15 



12 



CO 

- 9 
CD y 

E 

.0) 



6- 



20 40 60 80 100 120 140 160 20 40 60 80 100 120 140 160 

L. reali L sinapis 

Egg number (life-time) 



Figure 1. Lifetime fecundity of captive Leptidea females. 



Notalepid. 25(1): 39-59 



45 



70 



~ 50 



S 40 



üü M. sativa 
I I V. cracca 
JM L. corniculatus 
■i L. pratensis 

others 18 



10 




L. reali 



L. sinapis 



Figure 2. Proportion of eggs (means ± 1 S.D.) laid by captive females of L. reali and L. sinapis when 
offered a choice between various food plants. Numbers above columns refer to numbers of females in 
the tests that laid more than 10 eggs. 



There was substantial individual variation in egg-laying preferences in both species. 
Nine L. reali females laid more than 50% of their egg-load on L. pratensis, five on L. 
corniculatus and two on V. cracca. Fori, sinapis, the respective numbers were one (L. 
pratensis), five (L. corniculatus, including one female that laid all her eggs on this 
plant species) and two (V. cracca, including one female that laid all her eggs on this 
plant species). 

A slightly different picture emerges if all eggs laid during the experiments are 
summed up. Of the 752 eggs laid by 25 L. reali females, M. sativa received 0.9%, L. 
corniculatus 33.9%, L. pratensis 40.4% and V. cracca 1 8.2% (5.2% were laid on non- 
host substrates). The respective figures for the 436 eggs laid by 15 L. sinapis females 
were: 1.6% eggs on M. sativa, 53.2% on L. corniculatus, 22.2% on L. pratensis and 
16.3%o on V. cracca (6.7% on non-host substrates). However, these cumulative data 
cannot be subjected to a statistical analysis since eggs laid by the same female cannot 
be treated as independent data points and individuals that happened to lay more eggs 
would be over-represented. 

Collectively, the oviposition experiments revealed that L. sinapis and L. reali differ 
in their oviposition hierarchies, although individuals of both species may exhibit very 
different responses. Fori, reali, the hierarchy was L. pratensis > L. corniculatus > V. 
cracca » M. sativa, whereas for L. sinapis it was L. corniculatus > V. cracca > L. 
pratensis » M. sativa. 



46 



Freese & Fiedler: Specific distinctness of Leptidea sinapis and L. reali 



Development and performance of early stages in no-choice experi- 
ments. Prepupal weights differed between sexes, with females generally being 10% 
larger than males (Fig. 3, Table 1). There was also a highly significant, albeit slight effect 
of food plant, with larvae reared on L. corniculatus achieving highest weights in both 
species and sexes, while the three other food plants were of equal quality as measured by 
prepupal weights. Finally, L. reali reached overall slightly (and significantly) higher 
weights (â : 63.2±7.5 mg; 9 : 68.2±8.8 mg) thanZ. sinapis (6: 58.0±6.6 mg; 2 : 67.7±7.4 
mg) under identical rearing conditions. This effect was more pronounced in males, al- 
though statistically the species x sex interaction just failed to reach significance. There 
was no species x food interaction suggesting that performance of the two Leptidea spe- 
cies was not differentially affected by the food plant in no-choice situations. 



85 



5 70 



55 





1 < . 1 




i « i 






=h= — ■— 




male female 

L reali 



male female 

L. sinapis 



Figure 3. Prepupal weights of L. reali and L. sinapis, according to sex and food plant, obtained under 
standardized climatic conditions (25°C constant, 16:8h L:D cycle). Filled diamonds: means; boxes: ± 1 
SD, whiskers: ± 1 SE. 



There were highly significant differences between species, sexes and food plants with 
regard to total development times (i.e. entire larval and pupal duration; Table 2, Fig. 
4). Generally, females of both species took about 2 d longer to develop. Moreover, in 
both sexes L. reali required about 1 d longer than L. sinapis to reach maturity under 
identical environmental conditions (L. reali: S : 26.2±2.7 d (n=88); 9 : 28.6±2.6 d (n=88); 
L. sinapis: S: 25.1±2.6 (n=77); 9: 27.1±2.2 d (n=91)). Developmental duration was 
shortest for both species and sexes when fed L. corniculatus, insects reared on L. 



Notalepid. 25(1): 39-59 



47 



Table 1. Results of three-way ANOVA of prepupal weights of L. sinapis and L. reali, with species, sex 
and food plant as main factors. Significant effects printed in bold. d.f. = degrees of freedom. 





d.f. 


Mean 
square 


F 


P 


Species 


1 


395.3 


7.53 


0.006 


Sex 


1 


3081.6 


58.68 


O.0001 


Food 


3 


604.0 


11.50 


O.0001 


Species x Sex 


1 


170.5 


3.25 


0.07 


Species x Food 


3 


35.6 


0.68 


0.56 


Sex x Food 


3 


65.2 


1.24 


0.29 


Species x Sex x Food 


3 


33.6 


0.64 


0.59 


Error 


297 


52.5 







pratensis required 1-2 d longer, and rearing on V. cracca or M. sauva retarded devel- 
opment by about 2-4 d as compared to L. corniculatus. 

Growth rates significantly differed between sexes (with males growing by about 
6% more rapidly) as well as between species (L. sinapis having about 12.3% higher 
growth rate thanZ. reali; Table 3, Fig. 5). Food plant species did not affect growth rate. 
There was a significant, though weak species x food interaction which was due to the 
fact that L. reali grew more slowly on V. cracca and L. pratensis, whereas growth rates 
were almost equal across all food treatments in L. sinapis. Collectively, when integrat- 
ing all three life-history parameters measured, larval performance was best on L. 
corniculatus, with only weak differences between the other three food plant species. 
Food choice by caterpillars. 

A log-linear analysis (Table 5) of food choice frequencies (Table 4) was performed. 
Since the three-way interaction Species x Reared x Selected was not significantly 
different from zero, only two-way interactions were included in the search for an opti- 
mal model. This optimal model (goodness of fit excluding structural zeros: maximum- 



likelihood % 



12 df 



7.06, p>0.85) revealed that feeding decisions of caterpillars were 



influenced by the plant species on which a caterpillar had initially fed (Reared x Se- 
lected interaction). For example, V. cracca was never chosen by larvae initially fed L. 
corniculatus. L. corniculatus was particularly often selected by larvae initially fed this 
same plant species or L. pratensis, whereas larvae initially reared on V cracca or M. 
sativa did not prefer L. pratensis over L. corniculatus. 

There was no significant Species x Selected interaction, i.e. both Leptidea species 
behaved similarly when given a choice between the food plants selected for experi- 
ments. Structural zeros (marked in Table 4) reflect that not all choice opportunities 
were possible to the larvae. Since experiments were conducted during two genera- 
tions, with two different sets of plant species, neither decisions of Vicia- reared larvae 
towards Medicago, nor decisions of Medicago-fed larvae to Vicia, were possible. 

Statistical significance of the factor Reared is biologically meaningless. This sim- 
ply shows that the numbers of caterpillars taken from the various initial food plants 
differed (due to differential availability in our rearings). The factor Selected was highly 



48 



Freese & Fiedler: Specific distinctness of Leptidea sinapis andL. reali 



32 - 

CO 

1 28 - 
3 24- 

+* 32 A 

C 

£ § 28 - 

E o 

Q. -J 24 - 

O 

<D 20 J 

Q) 32 - 

•s ?»" 

_ 'S 

c ,32 24 - 

O § 

g 20 J 

3 32 - 

Q 

.3 28 - 

Ü 

S 24- 
20 - 






























i 
















i • • 1 






- 


' n 
















_ =Hh= 






i | 


i 


1 


' T ' 




1 Î 


















i 




1 




1 ' ' ♦ 1 


1 




_j ■ -,- 




♦ 


" 


1 








1 




















1 






- ■ i 


i 






I ♦ I 






i 


1 




, i . ' 






1 f r 








male 


female male female 
L reali L. sinapis 



Figure 4. Duration of development (all larval instars plus pupal stage) of L. reali andZ. sinapis, accord- 
ing to sex and food plant, obtained under standardized climatic conditions (25°C constant, 16:8h L:D 
cycle). Filled diamonds: means; boxes: ± 1 SD, whiskers: ± 1 SE. 

Table 2. Results of three-way ANOVA of developmental times of L. sinapis and L. reali, with species, 
sex and food plant as main factors. Significant effects printed in bold. d.f. = degrees of freedom. 





d.f. 


Mean 
square 


F 


P 


Species 


1 


91.2 


16.95 


O.0001 


Sex 


3 


103.1 


19.16 


O.0001 


Food 


1 


170.0 


31.58 


<0.0001 


Species x Sex 


3 


13.3 


2.48 


0.061 


Species * Food 


1 


0.2 


0.04 


0.85 


Sex x Food 


3 


4.1 


0.75 


0.52 


Species x Sex x Food 


3 


5.4 


1.01 


0.39 


Error 


328 


5.4 







significant, indicating that the plant species offered differed strongly in their accept- 
ability. A subsequent comparison of observed against expected choice frequencies 
(under the null hypothesis of equal choice of all four food plant species) revealed that 
both Leptidea species discriminated between plants (L. sinapis: % 2 3df =25.9, pO.0001; 
L. reali: % 2 3df =30.1, p<0.0001). Identification of the plants that contributed to this 
unevenness in choice decisions showed that both Leptidea species chose L. corniculatus 
significantly more often than expected by chance (L. sinapis: % 2 ldf =10.9, pO.001; L. 



Notalepid. 25(1): 39-59 



49 







0.35 




p 






^ 








0.25 




~j 


0.15 
0.35 


■o 


<o 






3 




F 


O 


0.25 








<D 




0.15 


rc 














p 


3h 




m 










^ 


o 




o 


o 


0.25 


•— 
CD 




0.15 
0.35 




S 


0.25 
0.15 



male female 

L. reali 



[ __^ ■ I | I | 




male female 

L. sinapis 



Figure 5. Growth rate during fourth (= final) larval instar of L. reali and L. sinapis, according to sex and 
food plant, obtained under standardized climatic conditions (25°C constant, 16:8h L:D cycle). Filled 
diamonds: means; boxes: ± 1 SD, whiskers: ± 1 SE. 



Table 3. Results of three-way ANOVA of growth rates of L. sinapis and L. reali, with species, sex and 
food plant as main factors. Significant effects printed in bold. d.f. = degrees of freedom. 





d.f. 


Mean 
square 


F 


P 


Species 


1 


0.023 


8.11 


0.005 


Sex 


1 


0.018 


6.22 


0.013 


Food 


3 


0.002 


0.86 


0.46 


Species * Sex 


1 


0.006 


2.21 


0.13 


Species x Food 


3 


0.009 


3.15 


0.025 


Sex x Food 


3 


0.002 


0.79 


0.50 


Species x Sex x Food 


3 


0.0006 


0.20 


0.90 


Error 


297 


0.003 







reali: x 2 ldf =l 1 .8, p=0.0006), whereas M. sativa was strongly discriminated against (L. 



sinapis: % 



18.1,p<0.0001;L. reali: 



X I. 



= 10.1, p=0.0015; all comparisons sig- 



nificant after sequential Bonferroni correction). 

Collectively, these data demonstrate that in choice situations caterpillars of both 
Leptidea species select food plants in much the same way, the hierarchy being: /.. 
corniculatus > L. pratensis = V. cracca » M. sativa. 



50 



Freese & Fiedler: Specific distinctness of Leptidea sinapis and L. reali 



Table 4. Frequencies of food choice decisions, depending on the initial rearing plant. *: structural zeros, 
i.e. this choice opportunity was not offered to the larvae. 



Species 


Initial rearing food plant 


Selected plant after 24h 


Frequency 


Leptidea reali 


L. corniculatus 


L. corniculatus 


11 






L. pratensis 


8 






V. cracca 









M. sativa 







L. pratensis 


L. corniculatus 


32 






L. pratensis 


17 






V. cracca 


7 






M. sativa 


1 




V. cracca 


L. corniculatus 


12 






L. pratensis 


11 






V. cracca 


10 






M. sativa 


0* 




M. sativa 


L. corniculatus 


8 






L. pratensis 


8 






V. cracca 


0* 






M. sativa 


1 


Leptidea sinapis 


L. corniculatus 


L. corniculatus 


18 






L. pratensis 


10 






V. cracca 









M. sativa 


1 




L. pratensis 


L. corniculatus 


29 






L. pratensis 


20 






V. cracca 


8 






M. sativa 


4 




V. cracca 


L. corniculatus 


13 






L. pratensis 


13 






V. cracca 


4 






M. sativa 


0* 




M. sativa 


L. corniculatus 


8 






L. pratensis 


8 






V. cracca 


0* 






M. sativa 


1 



Mating experiments. We observed a total of 1 58 courtship events in the flight 
cage equipped with butterflies of both species and sexes (Table 6). Males courted not 
only females of their own species, but did so also towards heterospecific females. 
However, there was a clear difference between both species, with L. reali males court- 
ing L. sinapis females disproportionally rarely, while L. sinapis males courted 
heterospecific females even more frequently than their conspecifics (Fisher's exact 



Notalepid. 25(1): 39-59 



51 



Table 5. Log-linear analysis of decision frequencies in food choice tests. Significant effects printed in 
bold. d.f. = degrees of freedom. 





d.f. 


partial x 2 


partial p 


marginal x 2 


marginal p 


Species 


1 


0.43 


0.51 


0.43 


0.51 


Reared 


3 


54.3 


O.0001 


54.3 


<0.0001 


Selected 


3 


156.0 


O.0001 


156.0 


<0.0001 


Species x Reared 


3 


1.41 


0.70 


1.77 


0.62 


Species x Selected 


3 


2.01 


0.57 


2.37 


0.50 


Reared * Selected 


9 


22.2 


0.008 


22.6 


0.007 



Table 6. Observed frequencies of intersexual interactions in a large flight cage. 



Species of 6 


Species of 9 


courtship 


9 receptive 


copula 


6 attempts copula, 
9 unreceptive 


L. reali 


L. reali 


75 


9 


7 





L. sinapis 


L. sinapis 


26 


7 


5 


2 


L. reali 


L. sinapis 


3 











L. sinapis 


L. reali 


54 








7 


total intraspecific 


101 


16 


12 


2 


total interspecific 


57 








7 



test, p<0.0001). When courting, males settled down in front of a sitting female and 
rapidly moved around their extended proboscis. Intraspecific courting sequences lasted 
19.1±32.5 s in L. reali (n=53) and 20.2+37.6 s in L. sinapis (n=20; £/-test: z=0.75, 
p>0.4). Interspecific courtships were of similar length as intraspecific ones (male L. 
reali courting female L. sinapis (n=2): 19.4±33.7 s; male L. sinapis courting female L. 
reali (n=42): 23.5±30.9 s; £/-tests for intra- versus interspecific courtings by male L. 
reali: z=0.29, p>0.77; by male L. sinapis: z=1.76, p= 0.087). 

In 16 cases females signalled receptiveness by bending their abdomen towards the 
courting male. This response exclusively occurred towards males of the 'right' species 
and never against heterospecific males (Fisher's exact test, intra- versus interspecific 
courtships: p=0.0005). 

If a female was unwilling to mate, she either remained completely calm (more 
rarely), or she fluttered with her wings, but remained in place. Alternatively, the fe- 
male flew off. Even with intraspecific interactions, the majority of courtings did not 
result in a mating (L. reali: 88% of courtings; L. sinapis: 73%). Occasionally (Table 6) 
males tried to mate with a female even though she had not signalled receptiveness. 
Such attempts were never successful. 

We observed 12 intraspecific copulations (Fisher's exact test, intra- versus 
interspecific courtships: p=0.0015). In the four cases where no copulation occurred, 
despite the female's willingness, the male was always hindered by some obstacles 
(such as plant twigs or leaves) to achieve the proper mating position. Copulations 
lasted 47.1 ±32.7 min (n=7) in L. reali and 63.2±32.2 min (n=5) in L. sinapis with no 
significant difference between the two species (/-test: /=0.387, p>0.7). Though vari- 
ance was very large, courtships leading to successful matings were longer (median 20 s, 



-^ Freese & Fiedler: Specific distinctness of Leptidea sinapis and L. reali 

n=8) than unsuccessful intraspecific courtship sequences (median 6 s, n=63; 
Kolmogorov-Smirnov test: p<0.025). 

Not only young females were successfully courted. Two females aged four or five 
days, respectively, but still virgin, were accepted by courting males. With 36 and 48 
min, respectively, these two matings fell well within the variation observed with younger 
females. The 5 d-oldZ. reali female subsequently laid 25 fertile eggs, whereas the 4 d- 
old L. sinapis female died accidentally without having laid eggs in captivity. 

Discussion 

Ethological reproductive isolation. Our experiments in a large flight 
cage revealed that the females of L. reali and L. sinapis clearly distinguish between 
these two species. Males courted heterospecific females with the same intensity as 
conspecifics (measured by courtship duration), whereas females never signalled re- 
ceptiveness towards heterospecific males (evidenced by forward bending of the abdo- 
men). Species discrimination was less straightforward in males. While L. reali males 
very rarely courted L. sinapis females, L. sinapis males appeared not to discriminate 
against L. reali females when courting. Neither in the laboratory nor in the field (A. 
Freese, unpublished observations, identity of mates confirmed subsequently by dis- 
section after their death) did we observe interspecific matings. These observations 
provide strong evidence for a precopulatory mate choice particularly (but not only) 
through the female sex, in contrast to predictions derived from the lock-and-key hy- 
pothesis which would suggest that species discrimination occurs only at insertion of 
the male's genitalia into the female's copulatory opening. 

Due to the limited simultaneous availability of adult butterflies in sufficiently large 
numbers, our mating experiments could not be fully standardized. It was impossible to 
stock the cage for each observational sequence with the same number of individuals of 
all sexes and species. For example, L. sinapis females were in rather short supply 
which might have influenced our results. Moreover, the number of observational rep- 
licates was low. Some butterflies were present in the flight cage during more than one 
observation session, and some degree of pseudoreplication also occurred since the 
same individual butterflies happened to interact with other individuals in the cage 
more than once within one observational session. From all these reasons, the statistical 
results derived from our observational data should not be overemphasized, and further 
tests under improved conditions might produce slightly different results. Most animals 
exhibited behaviours such as food searching, courtship and mating in much the same 
way as in nature. The frequent rejection of courting males by virgin females was not a 
laboratory artefact, but also often occurred in the field (A. Freese, unpublished obser- 
vations). This contrasts with Wiklund's notion (1977a) according to which only mated 
females would exhibit avoidance behaviour against courting males. 

Our experiments with northern Bavarian stock support the concept of L. reali and 
L. sinapis being distinct biospecies, whose reproductive isolation is maintained by 
precopulatory ethological isolation mediated through (mostly female) mate choice. 
Initial evidence for such ethological isolation was reported by Lorkovic (1993) from 



Notalepid. 25(1): 39-59 53 

Croatia. Thus, species recognition and reproductive isolation are not just regionally 
limited phenomena, as it occasionally occurs in ring species or 'super- species' (Barton 
& Hewitt 1985, Harrison 1990). From his experiments on reproductive isolation be- 
tween X. sinapis ' (in retrospect it is unclear whether he experimented with true L. 
sinapis or L. reali) and L. morsei Fent., Lorkovic (1950) also concluded that the fe- 
male sex controls species-specific mating, while males attempt interspecific hybrid 
pairings. 

The role of sexual selection and female choice in speciation has been emphasized 
in mathematical models (e.g. Fisher 1930; Lande 1981; Kirkpatrick 1982) and has 
gained increasing empirical support (Panhuis et al. 2001). Sexually selected signals 
are important in speciation processes (Darwin 1871; Thornhill & Alcock 1983; West- 
Eberhard 1983). For example, Wiernasz (1989) and Wiernasz & Kingsolver (1992) 
showed that in the two closely related and morphologically similar species Pieris 
occidentalis and P. protodice no hybrids occur in nature, although postcopulatory iso- 
lation barriers do not exist. In this case the degree of melanization of the fore wings 
serves as recognition signal for the female during mate choice. 

The nature of signals responsible for precopulatory species discrimination between 
L. sinapis and L. reali remains to be uncovered. Wing melanization is unlikely to play 
an important role since it strongly varies in both species between generations (Mazel 
2000, 2001a). Only extreme phenotypes look so different to the human observer as to 
allow for species distinction. Lorkovic (1930) assumed that species-specific pheromones 
mediate recognition between Leptidea morsei and 'Z. sinapis sensu lato', and this also 
seems the most likely explanation in the sibling species pair L. sinapis I L. reali. 

Androconia are well known from many Pieridae (Halfter et al. 1990), and their 
pheromones are important in sexual interactions (Omura et al. 2000). Close inspection 
under a stereomicroscope (50-fold magnification) of both Leptidea species did not 
reveal any morphologically distinct androconia on the wings (A. Freese, unpublished 
observations). This does, however, not imply that there are no glands that could dissi- 
pate a male sex pheromone. Clearly, the nature and source of this isolating signal 
deserves further research. 

Hybridization experiments by Lorkovic (1950) between 'Z,. sinapis sensu lato' and 
L. morsei revealed that enforced copulations were only possible after specialized scales 
around the genital opening of the female had been removed experimentally. Hence in 
Leptidea another factor is involved in reproductive isolation which again has nothing 
to do with the size and shape of the sclerotized genitalia apparatus. Hybrids achieved 
from these experiments were viable, but completely sterile. Whether this mode of 
reproductive isolation is also acting between L. sinapis and L. reali has not been stud- 
ied thus far. 

Ecological di f f e r e n t i a t i o n . Our experiments revealed that apart from etho- 
logical isolation between L. reali and L. sinapis ecological differences also exist, fe- 
males ranked the four tested hostplant species differentially, with L reali preferentially 
ovipositing on Lathy rus pratensis, while this plant ranked second-lowest in L. sinapis 
(which preferred Lotus corniculatus). These experimental findings are exactly in line 
with the hypothesis about hostplant preferences advanced by Lorkovic (1993) and 



•^ Freese & Fiedler: Specific distinctness of Leptidea sinapis and L. reali 

Kristal & Nässig (1996). However, in both species some individuals showed oviposi- 
tion preferences of the 'opposite' species, suggesting that this differentiation is not yet 
fixed in either of the species and may also vary regionally. For example, in the vicinity 
of Bayreuth egg-laying of females (identity subsequently confirmed by dissection) 
occurred on L. pratensis as well as L. corniculatus (A. Freese, unpublished observa- 
tions). Hence, without controlling for individual preferences and the local availability 
of oviposition substrates, chance field observations could well be misleading for infer- 
ences about hostplant preference hierarchies (Tabashnik et al 1981, Rausher & Papaj 
1983, Thompson & Pellmyr 1991). M saüva was for both Leptidea species the most 
unattractive oviposition substrate, which is in accordance with the the rarity of records 
of this plant in the literature. L. corniculatus and L. pratensis are cited most often, 
followed by V. cracca, and Medicago is mentioned least often (e.g. Wiklund 1977b; 
Henriksen & Kreutzer 1982; Warren 1984, Thomas & Lewington 1991; Bink 1992; 
Ebert & Rennwald 1993). 

Minor differences between important life-history parameters of both species also 
emerged in the rearing experiments under fully standardized environmental condi- 
tions. L. reali grew slightly larger (in particular so in the male sex) and took about Id 
longer to develop, whereas L. sinapis had higher growth rates during the final larval 
instar. This might indicate that selection has favoured life-history evolution towards 
larger body size in L. reali as opposed to more rapid development in L. sinapis. How- 
ever, variation was pronounced and it remains to be tested whether these subtle differ- 
ences would be important under more variable natural growth conditions or would 
recur with animals from geographically distant populations. 

Under the rearing regime (high constant temperature, long photoperiod) no indi- 
vidual entered diapause and all passed through four larval instars only (cf. Warren 
1984). Development across five larval instars, as occasionally reported in older sources 
as being characteristic for first generation larvae (Emmet & Heath 1990), never oc- 
curred. We can at present not ascertain whether these Leptidea species never pass 
through a five-instar pathway. In other butterflies, instar number is indeed a more 
plastic trait that varies between populations and may also be associated with diapause 
or subitaneous development (Fischer & Fiedler 2002). 

Both Leptidea species exhibited distinct protandry, with development time being about 
2d shorter in males (cf. Wiklund & Solbreck 1982). The extent of protandry did not differ 
between species. Protandry was realized by a combination of higher growth rates and 
smaller body size in males, while the females took more time (mainly in the final larval 
and pupal stage) and grew about 10% larger. Larger body size in females probably re- 
flects selective advantages such as increased fecundity (Wiklund & Karlsson 1988, 
Wickman & Karlsson 1989, Honek 1993). This should be particularly relevant in egg- 
limited insects like Leptidea species with a mean lifetime fecundity of but 30-40 eggs. 

Protandry should be selected for if females mate only once and virgin females quickly 
become rare during population emergence (Wiklund 1977a; Wiklund & Solbreck 1982; 
Zonneveld & Metz 1991). Under such conditions, males may be forced to accept se- 
vere trade-offs between body size and speed of development (Fischer & Fiedler 2001). 
Larval food plant affected most life-history traits in no-choice experiments, but spe- 



Notalepid. 25(1): 39-59 55 

cies-specific effects (i.e. species x food interactions) were seen only with growth rates. 
L. reali achieved relatively low growth rates when fed. V. cracca and L. pratensis. 
Overall, however, the different plant species offered in our experiments had largely 
similar effects on performance and fitness of L. reali and L. sinapis. L. corniculatus 
turned out to be the most favourable plant with regard to body size and duration of 
development. L. pratensis and V. cracca were almost equally suitable for both species, 
while M. sativa was overall the least favourable plant. Mortality (L. reali: 66.2 ± 16.6%; 
L. sinapis: 49.9 ± 30.0%) of larvae was also highest when fed M. sativa. Thus, the 
hierarchy of food plants according to larval performance was for both Leptidea species 
L. corniculatus > L. pratensis = V. cracca > M. sativa. 

In choice situations larvae of both Leptidea species preferred plants almost exactly 
as would be expected according to the performance hierarchy. Discrimination against 
M. sativa was very strong, and also both species clearly favoured L. corniculatus. In 
addition, feeding experience had a strong influence on feeding choices. Remarkably, 
earlier feeding on L. pratensis did not increase the likelihood of accepting that same 
plant later in a choice situation. Even in L. reali (where females prefer L. pratensis for 
oviposition), more Lathyrus-fQd larvae switched to Lotus than vice versa. 

Although in Lepidoptera with relatively sedentary larvae the female's choice of a 
hostplant for oviposition has usually the highest impact on larval survival, the ability 
to make a choice also may have selective advantages for the caterpillars. For example, 
when caterpillars fall off their hostplant after an attack, or if a plant individual does not 
provide sufficient resources, larvae must be able to find and select a proper new hostplant 
(Bernays & Chapman 1994). 

While the caterpillars' choices perfectly matched their performance, egg-laying 
decisions and offspring performance showed a discrepancy in L. reali, where a plant 
species offering less than optimal performance (i.e. Lathyrus pratensis) was preferred 
for oviposition. Theoretically one would expect female preference and offspring per- 
formance to be tightly correlated to maximise fitness (Thompson & Pellmyr 1991; 
Gratton & Welter 1998). However, apart from phytochemical and nutritional differ- 
ences between hostplant species, factors such as the incidence of predators, parasitoids 
or competitors may cause discrepancies between preference and performance 
(Thompson 1988a; Thompson & Pellmyr 1991). Thus, the validity of the performance 
hierarchies, as extracted from our experimental study, needs to be assessed under field 
conditions. Yet there is thus far no reason to assume that levels of prédation, parasit- 
ism, or competition should differ between, for example, L. corniculatus and L. pratensis 
in the case of the two Leptidea species. 

Oviposition preferences of butterflies are often heritable and vary within and across 
populations (Thompson 1988b; Singer et al. 1988; Nylin & Janz 1996). Although we 
did not test for heritability of preferences, individual variation was pronounced in both 
Leptidea species. Any reduction in gene flow between both forms (with genetically 
different preferences) should, on the long run, improve the preference-performance 
correlation within each group (Via 1986). The discrepancy between preference and 
performance in L. reali could then be explained by the hypothesis that the time passed 



56 



Freese & Fiedler: Specific distinctness of Leptidea sinapis and L. reali 



since the split of the two taxa has not yet been sufficient for a clear preference-per- 
formance correlation to evolve (Thompson 1988a). 

In herbivorous insects, heritable differences in hostplant preferences may be the 
driving force towards speciation, even in sympatry, provided that genetical prefer- 
ence-performance correlations or assortative hostplant related matings occur (e.g. 
Felsenstein 1981; Via 1986, Singer et al. 1988). InZ. sinapis andZ. reali, with their 
strong overlap with regard to larval hostplants and the only incipient segregation with 
regard to preference hierarchies, it seems very unlikely that these subtle differences 
have caused or even facilitated speciation. Rather, it is likely to assume given the 
results presented here that incipient speciation was mediated by sexual selection and 
female mate choice, with the weak ecological segregation evolving as a chance by- 
product (possibly via genetic drift: Schlüter 2001). 

Prospects. The results presented here demonstrate that L. sinapis and L. reali are 
in all likelihood two different biospecies separated by ethological reproductive isola- 
tion barriers. The two species are only weakly differentiated in ecological terms, and 
speciation may not yet have reached the level of complete interruption of gene flow. 
For example, the occasional occurrence of individuals with 'odd' genitalia measures 
in the offspring of females of both species (A. Freese and K. Fiedler, unpublished 
results) might indicate that limited introgression still takes place. To test this possibil- 
ity rigorously, measures of gene flow by means of allozyme electrophoresis or DNA 
techniques will be required (Geiger 1988; Pollock et al. 1998). 

The notion that 'Z. sinapis sensu lato' in fact comprises a sibling species pair also 
raises the question as to whether earlier ecological studies on the species complex 
remain valid (e.g. Wiklund 1977a, 1977b; Wiklund & Solbreck 1982; Warren 1985; 
Warren et al 1986). In retrospect, it will be difficult to unequivocally determine with 
which of the two species these studies were done (unless voucher specimens were still 
retained). Distributional areas of both species overlap widely in Europe, and even 
syntopic occurrences are known. Our investigations demonstrate the very strong simi- 
larities between both Leptidea species in terms of ecology and life-history. Also with 
regard to nature conservation issues, problems recognized for 'L. sinapis sensu lato' 
(Dennis 1977; Warren 1985; Warren et al. 1986; SBN 1987; Ebert & Rennwald 1993) 
are most likely relevant for both of its component species. For example, all hostplant 
species are restricted to rather early successional stages of vegetation, fecundity is 
equally low, and there is much overlap in body size, emergence times or longevity. 
Thus, threats to the existence of one species will also affect the other, and recovery 
from population reductions should also not differ. Nevertheless, the case of the two 
Wood Whites is again a reminder that it is not only most worthwhile to examine puta- 
tively 'common' and 'well-known' species more thoroughly, but also to fully docu- 
ment results and retain voucher specimens for subsequent validation. 

Acknowledgements 

We are grateful to Jörg Hager, Roswitha Mühlenberg, Claudia Ruf, Christian H. Schulze and Wolfgang 
Völkl for their support with rearing caterpillars, experiments and obtaining specimens in the field. Sören 
Nylin provided most useful critical comments on the manuscript. The district government of Bayreuth 
kindly issued a permit to study these legally protected species. 



Notalepid. 25(1): 39-59 t _ 57 

Literature 

Arnqvist, G. 1998. Comparative evidence for the evolution of genitalia by sexual selection. - Nature 

393: 784-786. 
Barton, N. H. & G. M. Hewitt 1985. Analysis of hybrid zones. - Annu. Rev. Ecol. Syst. 16: 113-148. 
Bernays, E. A. & R. F. Chapman 1994. Host-plant selection by phytophagous insects. - Chapman & 

Hall, New York. 
Bink, F. A. 1 992. Ecologische Atlas van de Dagvlinders van Noordwest-Europa. - Schuyt & Co, Haarlem. 
Collins, M. M. 1 99 1 . Speciation: a review of concepts and studies with special reference to the Lepidoptera. 

-J. Res. Lepid. 30:45-81. 
Darwin, C. 1871. The descent of man, and selection in relation to sex. - Murray, London. 
Dennis, R. L. H. 1977. The British butterflies - their origin and establishment. - E. W. Classey, Faringdon. 
Eberhard, W. G. 1993. Evaluating models of sexual selection: genitalia as a test case. - Am Nat. 142: 

564-571. 
Ebert, G. & E. Rennwald 1993. Die Schmetterlinge Baden- Württembergs 1, Tagfalter I. 2 nd ed. - E. 

Ulmer, Stuttgart. 
Emmet, A. M. & J. Heath (eds.) 1990. The moths and butterflies of Great Britain and Ireland 7(1) 

(Hesperiidae to Nymphalidae). ix + 370 pp. - Colchester: Harley Books. 
Felsenstein, J. 1981. Skepticism towards Santa Rosalia, or why are there so few kinds of animals? - 

Evolution 35: 124-139. 
Fischer, K. & K. Fiedler 2001 . Dimorphic growth patterns and sex-specific reaction norms in the butterfly 

Lycaena hippothoe sumadiensis. - J. Evol. Biol. 14: 210-218. 
Fischer, K. & K. Fiedler 2002. Life-history plasticity in the butterfly Lycaena hippothoe: local adaptations 

and trade-offs. - Biol. J. Linn. Soc. 75: 173-185. 
Fisher, R. A. 1930. The genetical theory of natural selection. - Clarendon Press, Oxford. 
Geiger, H. 1988. Enzyme electrophoresis and interspecific hybridization in Pieridae (Lepidoptera) - 

The case for enzyme electrophoresis. - J. Res. Lepid. 26: 64-72. 
Goulson, D. 1993. Variation in the genitalia of the butterfly Maniola jurtina (Lepidoptera: Satyrinae). - 

Zool. J. Linn. Soc. 107: 65-71. 
Gratton, C. & Welter, S. C. 1998. Oviposition preference and larval perfonnance of Liriomyza helianthi 

(Diptera: Agromyzidae) on normal and novel host plants. - Env. Ent. 27: 926-935. 
Halfter, G. & W. Peters & S. Löser 1990. Duftschuppen einheimischer Tagfalter. - Ent. Mitt. Löbbecke- 

Museum & Aquazoo 6: 1-90. 
Harrison, R. G. 1990. Hybrid zones: windows on evolutionary process. - Oxford Surv. Evol. Biol. 7: 69-128. 
Henriksen, H. J. & I. B. Kreutzer 1 982. The butterflies of Scandinavia in nature. - Skandinavisk Bogfoiiag, 

Odense. 
Hey, J. 2001. The mind of the species problem. - Trends Ecol. Evol. 16: 326-329. 
Hochberg, Y. 1988. A sharper Bonferroni procedure for multiple tests of significance. - Biomctrika 75: 

800-802. 
Honek, A. 1993. Intraspecific variation in body size and fecundity in insects: a general relationship. - 

Oikos 66: 483-492. 
Kirkpatrick, M. 1982. Sexual selection and the evolution of female choice. - Evolution 36: 112. 
Kristal, P. M. & W. A. Nässig. 1996. Leptidea reali Reissinger, 1989 auch in Deutschland und einigen 

anderen europäischen Ländern (Lepidoptera, Pieridae). - Nachr. ent. Ver. Apollo, Frankfurt, N. F. 

16: 345 361. 
Kudrna, O. 1998. Die Tagfalterfauna der Rhön. - Ocdippus 15: 1 158. 
Kullenbcrg, B. 1947. Der Kopulationsapparat der Insekten aus phylogenetischem Geschichtspunkt. 

Zool. Bidr. Uppsala 25: 79-90. 
Lande, R. 1981. Models of speciation by sexual selection on polygenic traits, hoe. Natl. Acad. Sei. 

USA 78: 3721 3725. 
Lorkovic, Z. 1930. Verwandtschaftliehe Beziehungen m der morsei-major-sinapis-Gnxppe des Genus 

Leptidea. - Z. österr. Ent. Ver. 15: 85 113. 
Lorkovic, Z. 1950. Neue ostasiatische Arten und Rassen der Gattung Leptidea nebst Nomenklatur- 
berichtigungen. - Period. Biol. (Zagreb) 2/3: 57-76. 



CO 

JO Freese & Fiedler: Specific distinctness of Leptidea sinapis and L. reali 

Lorkovic, Z. 1993. Leptidea reali Reissinger, 1989 (= lorkovicii Real, 1988), a new European species 

(Lepid., Pieridae). - Nat. Croat. 2: 1-26. 
Luckow, M. 1995. Species concepts: assumptions, methods, and applications. - Syst. Bot. 20: 589-605. 
Mayr, E. 1942. Systematics and the origin of species. - Columbia Univ. Press, New York. 
Mazel, R. 2000, 2001a. Le polymorphisme de deux "espèces jumelles» Leptidea sinapis L. et L. reali 

Reissinger en France (Lepidoptera: Pieridae). - Linn. Belg. 17: 277-288; 18: 37-43. 
Mazel, R. 2001b. Leptidea sinapis L., 1758 -Z. reali Reissinger, 1989, le point de la situation (Lepidoptera: 

Pieridae, Dismorphiinae). - Linn. Belg. 18: 199-202. 
Mazel, R. & R. Leestmans 1996. Relations biogéographiques, écologiques et taxinomiques entre Leptidea 

sinapis Linné etZ. reali Reissinger en France, Belgique et régions limitrophes (Lepidoptera: Pieridae) 

-Linn. Belg. 15: 317-328. 
Mikkola, K. 1992. Evidence for lock-and-key mechanisms in the internal genitalia of the Apamea moths 

(Lepidoptera, Noctuidae). - Syst. Ent. 17: 145-153. 
Monti, L., M. Baylac & B. Lalanne-Cassou 2001. Elliptic Fourier analysis of the form of genitalia in two 

Spodoptera species and their hybrids (Lepidoptera: Noctuidae). - Biol. J. Linn. Soc. 72: 391^00. 
Nylin, S. & K. Gotthard 1998. Plasticity in life-history traits. - Annu. Rev. Ent. 43: 63-83. 
Nylin, S. & N. Janz 1996. Host plant preferences in the comma butterfly (Polygonia c-album): Do 

parents and offspring agree? - Ecoscience 3: 285-289. 
Omura, PL, S. Morinaka & K. Honda 2000. Chemical nature of volatile compounds from the valvae and 

wings of male Delias butterflies (Lepidoptera: Piéride). - Ent. Sei. 3: 427^32. 
Panhuis, T. M., R. Butlin, M. Zuk & T. Tregenza 2001. Sexual selection and speciation. - Trends Ecol. 

Evol. 16:364-371. 
Pollock, D. D., W. B. Watt, V. K. Rashbrook & E. V. Iyengar 1998. Molecular phylogeny for Colias 

butterflies and their relatives (Lepidoptera: Pieridae). - Ann. ent. Soc. Am. 91: 524-531. 
Rausher, M. D. & Papaj, D. R. 1983. Host plant selection by Battus philenor butterflies: evidence for 

individual differences in foraging behavior. - Anim. Behav. 31: 341-347. 
Real, P. 1988. Lépidoptères nouveaux principalement Jurassiens. - Mem. Comité Liaison pour les 

Recherches Ecofaunistiques dans le Jura, Besançon: 17-24. 
Sachs, L. 1997. Angewandte Statistik - Anwendung statistischer Methoden. 8. ed. - Springer, Berlin. 
SBN (= Schweizerischer Bund für Naturschutz) 1987. Tagfalter und ihre Lebensräume. Arten - Gefähr- 
dung - Schutz. - Fötorotar, Basel. 
Schlüter, D. 2001. Ecology and the origin of species. - Trends Ecol. Evol. 16: 372-380. 
Shapiro, A. M. & A. H. Porter 1989. The lock-and-key hypothesis: evolutionary and biosystematic 

interpretation of insect genitalia. - Annu. Rev. Ent. 34: 231-245. 
Singer, M. C. & D. Ng & C. D. Thomas 1988. Heritability of oviposition preference and its relationship 

to offspring performance within a single insect population. - Evolution 42: 977-985. 
Sota, T. & K. Kubota 1998. Genital lock-and-key as a selective agent against hybridization. - Evolution 

52: 1507-1513. 
StatSoft 2001. Statistica for Windows 6.0. - StatSoft Inc., Tulsa/Oklahoma. 
Tabashnik, B. E. & H. Wheelcock, J. D. Rainbold & W. B. Watt 1981. Individual variation in oviposition 

preference in the butterfly, Colias eurytheme. - Oecologia 50: 225-230. 
Thomas, J. & R. Lewington 1991. The Butterflies of Britain and Ireland. - Dorling Kindersley, London. 
Thompson, J. N. 1988a. Evolutionary ecology of the relationship between oviposition preference and 

performance of offspring in phytophagous insects. - Entomol. exp. appl. 47: 3-14. 
Thompson, J. N. 1988b. Variation in preference and specificity in monophagous and oligophagous 

swallowtail butterflies. - Evolution 42: 118-128. 
Thompson, J. N. & O. Pellmyr 1 99 1 . Evolution of oviposition behavior and host preference in Lepidoptera. 

- Annu. Rev. Ent. 36: 65-89. 

Thornhill, R. & J. Alcock 1983. The evolution of insect mating systems. - Harvard Univ. Press, Cambridge. 
Tolman, T. & R. Lewington 1998. Die Tagfalter Europas und Nordwestafrikas. German ed. by M. Nuß. 

- Franckh, Stuttgart. 

Via, S. 1986. Genetic covariance between oviposition preference and larval performance in an insect 
herbivore. - Evolution 40: 778-785. 



Notalepid. 25(1): 39-59 59 

Warren, M. S. 1984. The biology and status of the Wood White Butterfly Leptidea sinapis (L.) (Lepidoptera: 

Pieridae), in the British Isles. - Ent. Gaz. 35: 207-223. 
Warren, M. S. 1985. The influence of shade on butterfly numbers in woodland rides, with special reference 

to the Wood White Leptidea sinapis. - Biol. Conserv. 33: 147-164. 
Warren, M. S. & E. Pollard & T. Bibby 1986. Annual and long-term changes in a population of the wood 

white butterfly Leptidea sinapis. - J. Anim. Ecol. 55: 707-719. 
West-Eberhard, M. J. 1983. Sexual selection, social competition, and speciation. - Quart. Rev. Biol. 58: 

155-183. 
Wickman, P.-O. & B. Karlsson 1989. Abdomen size, body size and the reproductive effort of insects. - 

Oikos 56: 209-214. 
Wiernasz, D. C. 1989. Female choice and sexual selection of male wing melanin pattern in Pieris 

occidentalis (Lepidoptera). - Evolution 43: 1672-1682. 
Wiernasz, D. C. & J. G. Kingsolver 1992. Wing melanin patterns mediates species recognition in Pieris 

occidentalis. - Anim. Behav. 43: 89-94. 
Wiklund, C. 1977a. Courtship behaviour in relation to female monogamy in Leptidea sinapis 

(Lepidoptera). - Oikos 29: 275-283. 
Wiklund, C. 1977b. Oviposition and spatial separation of breeding and foraging habitats in a population 

of Leptidea sinapis (Lepidoptera). - Oikos 28: 56-68. 
Wiklund, C. & B. Karlsson 1988. Sexual size dimorphism in relation to fecundity in some Swedish 

butterflies. - Am. Nat. 1: 132-138. 
Wiklund, C. & C. Solbreck 1982. Adaptive versus incidental explanations for the occurrence of protandry 

in a butterfly, Leptidea sinapis L. - Evolution 36: 56-62. 
Zonneveld, C. & J. A. J. Metz 1991. Models on butterfly protandry: virgin females are at risk to die. - 

Theor. Popul. Biol. 40: 308-321. 



Book Review 

Pro Natura - Schweizerischer Bund für Naturschutz (ed.) 2000. Schmetterlinge und ihre 
Lebensräume. Arten, Gefährdung, Schutz. Schweiz und angrenzende Gebiete. Band 3: 
Hepialidae, Cossidae, Sesiidae, Thyrididae, Lasiocampidae, Lemoniidae, Endromidae, 
Saturniidae, Bombycidae, Notodontidae, Thaumetopoeidae, Dilobidae, Lymantriidae, Arctiidae. 
Fotorotar AG, Egg (Switzerland). Pp. i-xii, 1-914 (incl. 34 colour-plates). Price CHF 83.75. 

Under the authorship of the "Lepidopterologen- Arbeitsgruppe" (Lepidopterological working 
group) and with support by many contributors, the third volume of "Schmetterlinge und ihre 
Lebensräume" (Lepidoptera and their habitats) has been completed in the year 2000 already. 
The book is arranged into an introductory and a systematic part, followed by water-colour 
plates of the moths and a comprehensive register of lepidopterous names, a host-plant index, 
an index of localities, bibliographic references, a glossary of technical terms, and a common 
index. 

The introductory chapter is devoted to the conservation of habitats where Lepidoptera live, a 
descriptive catalogue of these habitats is given and two chapters inform about economically 
important species and insect pheromones. 

The systematic chapter is arranged according to families. This requires some basic criticism. 
The classification used in this book series is based on a 'Macrolepidoptera' concept of pre- 
phylogenetic times. In contrast, already Minet (Ent. Scand. 22 (1991): 69-95) indicated a 
monophyletic Macrolepidoptera that excludes the Hepialidae, Cossidae, Sesiidae, and 
Thyrididae. Other groups of evidently monophyletic origin such as the Noctuoidea comprising 
Arctiidae, Lymantriidae, Noctuidae (including Dilobinae), and Notodontidae (including 
Thaumetopoeinae) are still separated, and most of these family-groups are misplaced in 
Bombycoidea! Also, there is no evidence that the Thyridoidea are related to the Pyraloidea as 
stated on page 253. Both taxa are currently assigned to a monophylum comprising six 
superfamilies plus the Macrolepidoptera in an unresolved polytomy. 

Each family-chapter starts with a short introduction to the family, a checklist of their species 
occurring in Switzerland, an annotated key to these species, and an overview of their phenology. 
For each species, a description and high quality colour photographs of all stages, their life- 
history, a map of records within Switzerland, a description of their habitat preferences are 
given and needs for their conservation are discussed. The text is accompanied with additional 
information, e.g. the reader gets to know about precopulatory behaviour in Hepialidae, 
pheromone reactions of clearwing moths, or the occurrence of species outside Switzerland. By 
this comprehensive and well illustrated information, the book provides a useful tool for 
lepidopterists, conservationists, landscape planners and ecologists. The price of the book is 
quite modest relative to the 914 richly illustrated pages providing valuable information much 
relevant even outside Switzerland. 'Schmetterlinge und ihre Lebensräume' is a valuable book 
for European Lepidopterology and a perfect book to start with if you are looking for a certain 
species in the wild! 

Matthias Nuss 



Notalepid. 25(1): 61-78 . 61 

Notes on systematics of the Erebia dabanensis species complex, 
with special consideration of the dabanensis-youngi and 
anyuica-occulta pairs of sibling species (Nymphalidae: 
Satyrinae) 

Alexei G. Belik* & Dmitry G. Zamolodchikov** 

* P. O. Box 1594, RU-4 10028 Saratov, Russian Federation, e-mail: belik@san.ru 
** Forest Ecology and Production Center RAS, Novocheremushkinskaya, 69, RU-1 17418 Moscow, 
Russian Federation, e-mail: dzamolod@cepl.rssi.ru 



Summary. There are two pairs of closely related taxa in the Erebia dabanensis species complex which 
deserve special attention. These pairs are: Erebia dabanensis Erschoff, 1871 - E. youngi Holland, 1900; 
and E. anyuica Kurentzov, 1966 - E. occulta Roos & Kimmich, 1983. Relationships of the taxa within 
these pairs are analysed. A study of the comparative morphology of the male genitalia demonstrates that 
each discussed taxon is a distinct species. This conclusion is supported by statistically significant differ- 
ences in the size proportions of the valvae in the male genitalia, as well as by results of a cluster analysis. 
For the first time, two putatively endemic Nearctic species, i.e. E. youngi and E. occulta, are discovered 
in the Palaearctic region, at Northeast Chukotka, thus revealing trans-Beringian distributions in both 
cases. All previous records of E. occulta in the Palaearctic refer to E. anyuica. The use of the name E. 
anyuica Kurentzov, 1966 constitutes a considerable problem. This is because of the somewhat obscure 
original description, while the single type specimen (holotype by monotypy) might be lost. The name E. 
anyuica Kurentzov, 1966 should preferably be used for the endemic Palaearctic species, previously 
considered as conspecific with E. occulta, until a thorough re-investigation of the Kurentzov collection 
has been performed. Only then the holotype may be rediscovered or a neotype will be validly desig- 
nated. The recent designation of a neotype of E. anyuica (Korb 1999) is considered invalid, as it does not 
meet the requirements of the ICZN. 

Zusammenfassung. Zwei Artenpaare aus dem Erebia-dabanensis-Komplex werden detailliert unter- 
sucht: Erebia dabanensis Erschoff, 1871 -E. youngi Holland, 1900 sowie E. anyuica Kurentzov, 1966 - 
E. occulta Roos & Kimmich, 1983. Eine vergleichend-morphologische Studie der männlichen Genital- 
apparate belegt, daß alle vier Taxa als distinkte Morphospezies anzusehen sind. Dies wird durch statis- 
tisch signifikante Unterschiede in Genitalmaßen wie auch durch Befunde einer Clusteranalyse belegt. 
Erstmalig werden zwei zuvor als endemisch-nearktische Taxa angesehene Arten (E. youngi, E. occulta) 
aus der Paläarktis (von der nordöstlichen Tschuktschen-Halbinscl) gemeldet. Diese beiden Arten haben 
demnach trans-beringische Verbreitungsareale. Alle früheren Meldungen von E. occulta aus der Paläarktis 
betreffen in Wirklichkeit E. anyuica. Der Taxonname E. anyuica Kurentzov, 1966 ist problembehaftct, 
da die Originalbeschrcibung wenig präzise und der Holotypus möglicherweise verschollen ist. Solange 
nicht durch gründliche Recherche im Originalmaterial von Kurentzovs Sammlung genaueres über das 
Schicksal des Holotypus bekannt ist, sollte der Name E. anyuica Kurentzov, 1966 nur für die in der 
Paläarktis endemische Art verwendet werden, die bis vor kurzem als konspezifisch mit E. occulta ange- 
sehen wurde. Nur dann könnte der Holotypus wiederentdeckt werden oder ein Neotypus festgelegt wer- 
den. Die rezente Festlegung des Neotypus von E. anyuica (Korb 1999) wird als ungültig angesehen, da 
sie nicht den internationalen Nomenklaturregeln entspricht. 

Résumé. Le complexe d'espèces & Erebia dabanensis comprend comprend deux paires de taxons qui 
méritent une attention particulière, à savoir Erebia dabanensis Erschoff, 1 871 - E. youngi 1 loi land. 1 900 
et E. anyuica Kurentzov, 1966 - E. occulta Roos & Kimmich, 1983. Les liens de parente des taxons au 
sein de ces paires sont analysées. Une étude morphologique comparative des genitalia mâles démontre 
que chacun des taxons discutés constitue une espèce distincte. Celte conclusion esi fondée sur des diffé- 
rences statistiquement significatives au niveau des proportions quantitatives des valves, ainsi que sur les 
résultats d'une analyse de cluster. Pour la premiere Ibis, deux espèces jusqu'à présent supposées être des 
endémiques ncarctiques, à savoir E. youngi et E. occulta, ont été découvertes dans la région paléai cli- 
que, dans le nord-est de la région de l'Anadyr, révélant ainsi des aires de repartition transita ingiennes 
dans les deux cas. Toutes les mentions précédantes d'il, occulta de la region paléarctique s'appliquent à 
E. anyuica. L'usage du nom E. anyuica Kurentzov. 1966 pose un problème considérable, à cause de la 
description originale quelque peu obscure, alors que le spécimen-type unique (holotype par monotypie) 
pourrait être perdu. Il est préférable, à l'heure actuelle, d'utiliser le nom E. anyuica Kurentzov, 1966 

© Nota lepidopterologica, 01.08.2002, ISSN 0342-7536 



62 



Belik & Zamolodchikov: Systematics of the Erebia dabanensis species complex 



pour désigner l'espèce paléarctique endémique, précédemment considérée comme étant conspécifique 
avec E. occulta, jusqu'à ce qu'une nouvelle étude approfondie de la collection de Kurentzov ait été 
entreprise. Alors seulement l'holotype pourrait être redécouvert ou, le cas échéant, un néotype pourrait 
être désigné validement. La désignation récente d'un néotype pour E. anyuica (Korb 1999) est considé- 
rée comme étant invalide, vu qu'elle ne correspond pas aux conditions imposées par le Code. 

Pe3M)Me. B KOMnjieKC bh^ob Erebia dabanensis bxo^ht, b nacTHOCTH, flBe napti 6jiH3Kopo£CTBeHHBix 
TaKCOHOB, KOTopbie 3acjiy5KHBaiOT cneuHajiBHoro paccMOTpeHHH. 3th napbi: Erebia dabanensis Erschoff, 
1871 - E. youngi Holland, 1900 h E. anyuica Kurentzov, 1966 - E. occulta Roos et Kimmich, 1983. 
IlpoaHajTH3HpoBaHBi B3aHMOOTHomeHHfl TaKCOHOB b flaHHBix napax. H3yneHHe cpaBHHTejiBHofi 
Mop(hojiorHH reHHTanHH caivmoB noKa3BiBaeT, hto Kaac/jbiH H3 oöcyjK^aeMbix TaKCOHOB aBjiaeTca 

CaMOCTOHTeJIBHBIM BHflOM. TaKOH BBIBO^ nOflTBepîKAaeTCfl KaK npOBepKOH CTaTHCTHHeCKOH 

AOCTOBepHocTH pa3JiHHHH b nponopunax BajibB reHHTajiHH caMu;oB, TaK h pe3yjibTaTaMH KJiacTepHoro 
aHajiH3a. BnepBbie zrBa 3imeMHHHbix HeapKTHHecKHX BH^a E. youngi Holland, 1900 h E. occulta Roos 
et Kimmich, 1983 oÔHapy)KeHbi b IlajieapKTHKe, Ha ceBepo-BOCTOKe MyKOTKH. Bee npe/rbmymne yKa3aHHfl 
Ha Haxo^KH E. occulta b naneapKTHKe othochtca k BH/jy E. anyuica. noKa3aHO, hto Hcnojib30BaHHe 
Ha3BaHHH E. anyuica Kurentzov, 1966 npe/jCTaBjiaeT 3HaHHTejibHyio npoôneMy. 3to CBjnaHO h c 

He/IOCTaTOHHO ^eTaJIBHblM OnHCaHHeM BHfla, H C TeM, HTO eßHHCTBeHMH THnOBOH 3K3eMnJHÎp (rOJIOTHn 

no MOHOTHnHHH) Mor 6bitb yTepflH. TeM He MeHee, npeACTaBJiaeTCH npe/moHTHTenBHBiM HcnojiB30BaTB 
Ha3BaHHe E. anyuica Kurentzov, 1966 fljia 3H,n;eMHHHoro najieapKTHHecKoro Bima, npeÄfle CHHTaBineroca 
KOHcneuH^HHHBiM c E. occulta, AO Tex nop, noKa He öyneT nepeHccneßOBaHa kojijickhhh KypeHHOBa. 
Tor^a CTaHeT bo3moähbim jihöo oÖHapy^cHTB ronoTun, jihöo npOH3BecTH BajiH^Hoe o6o3HaneHHe 
HeoTHna. He^aBH^H nonBiTKa 0Ö03HaHeHH5i HeoTHna E. anyuica (Korb 1999) npH3HaeTca 
HeaeficTBHTejiBHOH KaK He cooTBeTCTByiomaa TpeöoBaHHHM MK3H. 

Key words. Erebia, sibling species, taxonomy, Chukotka, Beringian distributions. 



In the present paper we attempt to clarify the systematics of the Erebia dabanensis 
complex in its most complicated and confused part. We specifically ask whether each 
taxon in the two pairs dabanensis-youngi and anyuica-occulta is in fact a separate 
species, or the taxa in these pairs are conspecific. 

In July 1998, the second author visited the interior region of the Chukotskiy Penin- 
sula (Northeast Chukotka, Russia) near the lake Ioni (65°48' N, 173°22' W). There he 
collected two species of the genus Erebia Dalman, 1816, which apparently belonged 
to the Erebia dabanensis complex. After thorough examination and comparative study 
these species turned out to be Erebia youngi Holland, 1900 and Erebia occulta Roos & 
Kimmich, 1983. This is the first proven record in the Palaearctic region of these two 
putatively endemic Nearctic species, as demonstrated below. 

1. Erebia dabanensis Erschoff, 1871 (= E. tundra Staudinger, 1887) and Erebia 
youngi Holland, 1900. 

1.1. Introduction 

There is a long-standing discussion in the literature about the relationships between E. 
dabanensis and E. youngi: whether the latter taxon is conspecific with the former one, 
as well as whether these taxa are sympatric or allopatric (Warren 1936, 1969, 1981; 
dos Passos 1972; Troubridge & Philip 1983; Scott 1986; Tuzov et al 2000). Because 
of the great phenetic similarity of E. youngi with E. dabanensis, it is often impossible 
to identify specimens of these taxa on the sole basis of details of the wing pattern and 
coloration, without studying the male genitalia. 

Erebia tundra Staudinger, 1887 is a junior subjective synonym of E. dabanensis 
Erschoff, 1871 (see Belik, in press). Kurentzov (1970) considered £. tundra as a sepa- 



Notalepid. 25(1): 61-78 63 

rate species, distributed at the Northeast of Eurasia from East Yakutiya to East Chukotka, 
but he appears to have been confused completely about the taxonomy of the E. 
dabanensis species complex. His figures for the male genitalia of E. dabanensis and E. 
tundra match the genitalia structure of E. kozhantshikovi Sheljuzhko, 1925, and vice 
versa. Kurentzov's key to Erebia (using wing pattern and coloration only) is inconsist- 
ent for these three taxa. Thus, it is impossible to decide what Kurentzov meant by the 
name "E. tundra". After the publication of Kurentzov's book (1970) the systematics of 
the E. dabanensis species complex remained confused completely for a while. Ac- 
cordingly, in some later publications E. tundra was considered as a separate species, 
too (Korshunov 1972; Kogure & Iwamoto 1993). 

Troubridge & Philip (1983) convincingly demonstrated that E. dabanensis and E. 
youngi are two different species, separated well by the stable differences in the male 
genitalia structure. They also proved that in the Nearctic only E. youngi occurs, with 
all previous records of E. dabanensis from North America referring actually to E. 
youngi. In the literature, no records exist about E. youngi occurring in the Palaearctic. 
Thus, it was concluded that E. dabanensis and E. youngi are two closely related allopatric 
species, with the Bering Strait as natural boundary between their areas of distribution. 

With our discovery of E. youngi in the Palaearctic the problem of the relationship 
with E. dabanensis came up again, since both taxa are sympatric in the East Palaearctic. 
Specifically, the possible occurrence of a cline in the male genitalia structure from E. 
dabanensis to E. youngi within the Palaearctic part of the range could not be excluded. 

1.2. Material examined and methods 

65 Canada, Yukon Territory: Nickel Creek; 1 5 Richardson Mts., Windy pass; 55 Russia, NE. Chukotka, 
20 km SE of lake Ioni, valley of Gil'mimleveyem river; 105 Russia, NW. Chukotka, Bilibino district, 
5-20 km NW of Bilibino; 105 Russia, Magadan region: Khasyn district, vicinity of Palatka; 3 5 BoFshoy 
Anngachak mtn. range, vicinity of the Jack London lake; 105 Russia, Chita region, Udokanskiy mtn. 
range, 20-26 km SE of Udokan, upper stream of Naminga river; 105 Russia, Chita region, Kyra dis- 
trict, ca. 67 km WNW of village Kyra, Sokhondo Mts., upper stream of Bukukun river; 95 Russia, 
Buryat republic, East Sayan Mts.: Tunkinskiye Gol'tsy mtn. range, Mt. Khulugaysha; 15 Kitoyskiye 
Gol'tsy mtn. range, between the sources of Irkut and Kitoy rivers, vicinity of Il'chir lake; 1 5 Russia, 
Krasnoyarsk territory, Taymyr autonomous region, Putorana plateau: vicinity of Talnakh; 55 ca. 100 km 
E of Noril'sk, E. extremity of the lake Lama; 105 Russia, Tyumen' region, Yamal-Nenets autonomous 
region, Polar Ural Mts., 10-20 km NW of Kharp. 

To distinguish E. dabanensis and E. youngi, Troubridge & Philip (1983) introduced a 
method to compare the length of the spined ridge of the valvae (in the male genitalia) 
expressed as per cent ratio of the length of the costal edge of the valvae. Initially, we 
followed this method in the present work (Fig. 1). 

Unpaired two-tailed Student's Mests were used to determine whether samples from 
the studied populations differ significantly in average relative length of the spined 
ridge of the valvae. Significance was accepted when/?<0.01. 

Finally, we measured a larger number of quantitative parameters to perform a clus- 
ter analysis for a higher reliability and better visualization. The following parameters 
were used: L - length of the spined ridge of the valva, expressed in per cent of the total 
length of the costal edge of the valva; L fw - length of the forewing; C - curvature of the 
dorsal edge of the spined ridge of the valva, of negative value if the edge is concave, 



64 



Belik & Zamolodchikov: Systematics of the Erebia dabanensis species complex 




Fig. 1. Male valva of E. dabanensis, showing method used for measurements. Distance "A" is the length 
of the costal edge of the valva, measured from the point where the vertical process of the basal end meets 
the costa to the tip. Distance "B" is the length of the spined ridge of the valva. -^ — =L , where "L" is the 
relative length of the spined ridge of the valva expressed in per cent. Distance "C" indicates the curva- 
ture of the dorsal edge of the spined ridge of the valva. 

positive if the edge is convex. Population averages of L, L^ and C are shown in Table 1. 
A hierarchical cluster analysis (single linkage method, based on the matrix of Euclidean 
distances) was carried out to identify groups of similar populations. Prior to doing so, 
the population parameters (L, L fw and C) were z-transformed (mean = 0, standard 
deviation = 1) to exclude influences of different scaling. All calculations were per- 
formed using the software package STATISTICA (StatSoft 1995). 



1.3. Results 

Troubridge & Philip (1983) demonstrated that in Nearctic specimens of E. youngi the 
length of the spined ridge of the valva, expressed in per cent of the total length of the 
costal edge of the valva, averages 43 % (range 36^17 %), while in Palaearctic speci- 
mens of E. dabanensis it averages 55.8 % (range 47-67 %). Our aims were: a) to 
determine if these differences could be used for the sure diagnosis of the Palaearctic 
specimens of E. youngi and of E. dabanensis', and b) to check for the possible exist- 
ence of a cline in this parameter toward E. youngi throughout the distribution area of 
E. dabanensis. 

The data presented in Table 1 demonstrate quite clearly that the length of the spined 
ridge of the valva could be used as a good taxonomic character to differentiate E. 



Notalepid. 25(1): 61-78 



65 



Table 1. Morphometric data of male E. youngi and E. dabanensis. N - number of specimens examined. 
L- length of the spined ridge of the valva in male genitalia, expressed as per cent of the total length of 
the costal edge of the valva. L fw - forewing length. C - curvature of the dorsal edge of the spined ridge 
of the valva; negative value if the edge is concave, positive if the edge is convex. 



Species 


Locality 


N 


Range of L 
(%) 


Average L 

(%) 


Average 
L fw (mm) 


Average C 
(mm) 


E. youngi 


Yukon 


7 


40.47-53.49 


48.8 


21.8 


2.4 


NE Chukotka 


5 


43.05-50.63 


46.7 


19.3 


2.3 


Average for 
species 






47.7 


20.5 


2.3 


E. dabanensis 


NW Chukotka 


10 


57.69-67.39 


61.8 


20.2 


-2.0 


Magadan region 


13 


56.25-64.71 


61.5 


22.1 


-2.1 


NE Transbaikal 


10 


60.00-71.70 


64.0 


21.6 


-2.0 


S Transbaikal 


10 


58.33-66.66 


62.9 


20.5 


-2.2 


E Sayan 


10 


54.00-64.00 


59.4 


20.9 


-1.9 


Putorana plateau 


6 


46.65-56.82 


51.7 


19.9 


-1.1 


Polar Ural 


10 


53.19-66.07 


56.6 


20.8 


-1.4 


Average for 
species 






56.9 


20.6 


-0.9 



youngi from E. dabanensis in most cases. By this parameter, there is no noticeable 
cline leading from the West to the East from E. dabanensis into E. youngi throughout 
the giant area of the distribution of E. dabanensis. An opposite pattern occurs: the 
length of the spined ridge of the valva in E. dabanensis first decreases towards the 
west with the minimum found in the population of the Putorana plateau. Then, further 
west it increases again in the population of the Polar Ural. 

Statistical analysis of data on relative lengths of the spined ridge of valvae (Table 2) 
demonstrates that differences in means between populations of E. dabanensis and E. 
youngi are significant, with one single exception. By this parameter, E. dabanensis 
from the Putorana plateau is indistinguishable from E. youngi from the NE Chukotka 
and Yukon. 

Thus, the length of the spined ridge of the valva could not be used alone as the 
ultimate means to separate E. dabanensis from E. youngi. Otherwise, one should con- 
sider the population of the Putorana plateau as belonging to E. youngi. This is highly 
improbable, taking into account the large distance (ca. 3800 km) between the Putorana 
population and the nearest locality of E. youngi at NE Chukotka, without any linking 
populations (with the same valva morphology) in between. 

We found additional specific differences in the male genitalia of E. dabanensis and 
E. youngi. In E. youngi the whole valvae are relatively shorter than in E. dabanensis in 
specimens of similar size (cf. Figs. 4-5 with Fig. 3). To check this, we measured the 



66 



Belik & Zamolodchikov: Systematics of the Erebia dabanensis species complex 



cq 



R 

■8 


Cd 

Ö 
cd 

u. 
O 

PU 














i 


ON 

© 
© 


R 
R 


cd 

en 












1 


© 
© 
© 


© 


•5 

R 
R 


13 

Cfl 

C 
cd 

H 

00 










i 


O 
Ö 


© 
© 

© 

V 


© 
© 

©* 


.«2 
K 
R 

-Co 

-a 










i 


o 
m 

© 


NO 

© 
© 

© 


© 
© 
© 
V 


© 
© 

© 

V 


R 
R 

■3 


G 

^ .2 

Cd <u 

s u 






1 


o 

ö 


o 

Ö 


oo 
© 

Ö 


© 
© 
© 
V 


© 

© 

© 


R 

cu 
R 

^3 

-Cj 

-§ 


cd 

M 

> O 




1 


r- 

ON 

r-; ■ 

Ö 


oo 

ON 

Ö 


m 

o^ 

Ö 


Ö 


© 
© 
© 
V 


© 

© 


g, 


cd 
M 

O 
id 

U 


1 


o 
© 
© 
V 


© 

© 
© 
V 


© 
© 
© 
V 


© 
© 
© 
V 


© 
© 
© 

V 


o 
© 


© 
© 
© 
V 


'B3q 

R 


c 
> 


un 
wn 

ö 


© 
© 

© 

V 


© 
© 
© 
V 


© 
© 
© 
V 


© 
© 

© 

V 


© 
© 

© 

V 


es 

© 


© 
© 
© 




© 

- 


03 

O 


cd 

O 

> * 

ri -d 


c 

cd 

cd 5 
cd üo 


'cd 
X) 
ce 
C 


"cd 
M 
'cd 
X) 

Cfl 

a 

H 

00 


Ö 

03 
>> 

C3 
OO 

w 


od 

cd 
•— 
O 

3 
Ph 


Id 

u, 

ÎD 

-S 

"o 

Pu 


"3 

a 

00 




'Sc 

R 
S 


•2 

R 

R 

■8 


•S 
S3 
g» 

R 

■a 


•S3 

R 
R 

•a 


•S 

R 

^J 
R 

«Ci 

■a 


■S 

53 

R 

R 

■a 


Et 
R 
«CS 

■8 


•2 

R 
-Ci 

■S 



t+n 









t/i 




ö 




o 












03 








3 




ex 




O 




CX 




-a 




(U 




d 








£ 




o3 




X 




<u 




d 




eu 




0; 




£ 








<u 




X) 




, — ,, 




cd 












cd 












d 




<\t 




ÖJJ 




<1> 








cti 




s 




d 








■> — ' 




<iï 




rri 




> 








es 




> 




<U 




-a 








<+-: 









eu 




01) 




-o 








Uh 




T3 




(l> 




d 


-a 






o. 





c« 


x> 


eu 


r^ 









eu 


4= 


d 

■a 


öl) 


o, 


d 






03 


> 




crt 


O 


<u 


© 

V 


d 


A 















d 



d 


OJ 










t|H 


T3 


T3 


-H 


ri 


O 


03 







en 


ifl 


(U 


d 


1 1 


W) 






_ 


cyî 






d 




<i> 


<^ 


TD 




ri 


s 


00 


sr 


-H 


c-î 


O 


-O 


C^ 


-s 


3 

CO 


c-q 


<1> 




ûi 


-0 
c 






fN 








<U 


bs) 


-Q 


R 


1? 


s. 



Nota lepid. 25 (1): 61-78 



67 



forewing length, as parameter to characterise the size of the specimen, in the same 
specimens of which the valvae had been measured. Furthermore, the following fea- 
tures in the structure of the male genitalia could serve well to distinguish E. youngi and 
E. dabanensis. As already stated by Troubridge & Philip (1983), the most significant 
structural difference between E. youngi and E. dabanensis is in the male valva. That of 
E. dabanensis has a much longer, more pointed or narrower tip than that of E. youngi. 
Moreover, in E. dabanensis the dorsal edge of the spined ridge of the valva is almost 
always concave (as in Figs.l & 3); only rarely it is straight. In E. youngi this spined 
ridge is almost always more or less convex (Figs. 4, 5) and again very rarely straight. 
In Nearctic specimens of E. youngi this dorsal edge it is always convex (K. Philip and 
J. Troubridge, pers. comm.). 

The cluster diagram (Fig. 2) based on forewing length, as well as curvature and 
length of the dorsal edge of the spined ridge of the valvae demonstrates clearly that all 
examined populations are separated into two clear main groups. In one group are united 
all Palaearctic populations from the Polar Ural to NW Chukotka, in the other group are 
united the Palaearctic population of NE Chukotka and the Nearctic ones from the Yu- 
kon Territory. This phenetic result supports well the hypothesis of specific distinctness 
of E. dabanensis and E. youngi. The fact that the group of populations of E. dabanensis 
looks as quite heterogeneous, is not surprising taking into account the giant area of its 
distribution. It ranges across ca. 4200 km from Polar Ural to NW Chukotka, forming a 
number of named subspecies. 



Yukon 

NE Chukotka 

NW Chukotka 

S Transbaikal 

E Sayan 

Polar Ural 

Magadan region 

NE Transbaikal 

Putorana plateau 



0.5 1 1.5 

Linkage distance 



2.5 



Fig. 2. Phenetic cluster diagram of is. youngi and E. dabanensis populations from different localities 

(three variables, Euclidean distances, agglomeration algorithm: single linkage). 



68 



Belik & Zamolodchikov: Systematics of the Erebia dabanensis species complex 



Table 3. Morphometric data of male E. occulta and E. anyuica. N - number of specimens examined. L- 
length of the spined ridge of the valva in male genitalia, expressed as per cent of the total length of the 
costal edge of the valva. L fw - forewing length. C - curvature of the dorsal edge of the spined ridge of the 
valva; negative value if the edge is concave, positive if the edge is convex. 



Species 


Locality 


N 


Range of L 

(%) 


Average L 

(%) 


Average 
Lf W (mm) 


Average C 
(mm) 


E. occulta 


Yukon 


19 


65.31-75.56 


70.2 


19.7 


-1.7 


NE. Chukotka 


4 


71.82-77.57 


74.1 


19.3 


-0.9 


Average for 
species 






72.1 


19.5 


-1.3 


E. anyuica 


NW. Chukotka 


3 


62.00 - 65.52 


64.3 


22.3 


-1.7 


Magadan region 


12 


54.90 - 63.93 


60.9 


23.1 


-0.3 


Yakutiya 


■ 5 


58.00 - 60.00 


57.6 


22.0 


1.3 


NE. Transbaikal 


11 


55.17-65.52 


60.6 


22.7 


1.0 


S. Transbaikal 


10 


59.65 - 65.52 


63.2 


23.6 


0.9 


E. Sayan 


11 


56.00-64.15 


61.2 


22.0 


0.5 


Average for 
species 






61.3 


22.6 


0.3 



1.4. Conclusion 

Summarising the aforementioned arguments, we conclude that E. youngi is a bona 
species, separated morphologically from the very closely related species E. dabanensis. 
Further investigations in the interior regions of Chukotka should reveal whether there 
is some natural boundary between E. dabanensis and E. youngi, or whether there a 
narrow intermediate zone exists where these two species might occur in sympatry. All 
literature records of E. dabanensis from East Chukotka should be considered as doubt- 
ful so far; perhaps they refer to E. youngi. 

We cannot judge yet about the subspecific status of the NE Chukotkan population 
of E. youngi. First, the number of available specimens is still low. Second, we have 
insufficient comparative material of all three known North American subspecies of E. 
youngi available to study. Finally, the status of the taxon tschuktscha Herz, 1903 re- 
mains uncertain. It was originally described as a "variety" of E. dabanensis, based of a 
single specimen taken at Provideniya Bay (NE Chukotka). From the original descrip- 
tion alone it is impossible to decide to which species of the E. dabanensis complex this 
taxon should belong. Unfortunately, the first author (A.B.) has not yet found the type 



Nota lepid. 25 (1): 61-78 



69 




Fig. 3. E. dabanensis, male, left valva, lateral view. Russia, Chita region, Kyra district, Sokhondo Mts., ca. 
67 km WNW of village Kyra, upper stream of Bukukun river, 1990-2025 m, 18.VI.1999, A.G. Belik leg. 




Fig. 4. E. youngi, male, left valva, lateral view. Russia, NE. Chukotka, 20 km SE of lake Ioni, valley of 
Gil'miml'veeni river, 22.VII.1998, D.G. Zamolodchikov leg. 



70 



Belik & Zamolodchikov: Systematics of the Erebia dabanensis species complex 



Fig. 5. E. youngi, male, left valva, lateral view. Canada, Yukon Territory, Nickel Creek, 4200 ft., 
28.VI.1987, MX. Grinnell leg. 



specimen of E. dabanensis tschuktscha in the collections of Zoological Institute of the 
Russian Academy of Sciences (St. Petersburg) where it should be deposited. 

2. E. anyuica Kurentzov, 1966 and Erebia occulta Roos & Kimmich, 1983 (=phellea 
Philip & Troubridge, 1983). 

2.1. Introduction 

Our discovery in NE Chukotka is the first proven record of the putatively endemic 
Nearctic species E. occulta for the Palaearctic region. All previous literature records 
of E. occulta from the Palaearctic in fact referred to E. anyuica Kurentzov, 1966 (= 
anyuka, anjuika, anjuica auct) (Troubridge & Philip 1983; Tuzov 1993; Korshunov & 
Gorbunov 1995; Korshunov 1996; Tuzov et al 1997; Streltzov 1998; Korb 1999). 
And otherwise, all recent records of E. anyuica from the Nearctic referred to E. occulta 
(Layberry et al. 1998). All these records were based on the misinterpretation (or, on 
the lack of the sufficient proof) of the fact that E. occulta and E. anyuica are two 
separate species. In the present article, arguments are presented to support that E. occulta 
and E. anyuica are two different species. 

E. phellea Philip & Troubridge, 1983 is a junior subjective synonym of E. occulta 
Roos & Kimmich, 1983 (Philip & Roos 1985). Korb's statement (1999), according to 
which Dubatolov ( 1 992) synonymized E. phellea with E. occulta, is not true. Dubatolov 
(1992) placed £. occulta into the synonymy of E. anyuica, indeed. A further statement 
of Korb {Joe. cit.) that E. phellea is a separate species, which occurs sympatrically 



Notalepid. 25(1): 61-78 71 

with E. anyuica and E. occulta at the same locality (sicl) near Magadan, is absolutely 
wrong. This author apparently was unaware of the individual variability both in the 
male genitalia structure and in the wing pattern and coloration. Moreover, he states 
that in E. phellea the valva were more than two times wider than the aedeagus, while in 
E. occulta the valva were of the same width as the aedeagus. On the figure of the male 
genitalia of E. phellea Korb refers to (Korb, 1999:1369, Fig. 2), it is obvious that the 
valva merely is flattened, the membrane of the interior side of the valva is spread, thus 
the valva looks so wide in the dorsoventral aspect. 

The use of the name E. anyuica Kurentzov, 1966 constitutes a serious nomenclatural 
problem (Belik 1996). Though the solution of this problem is beyond the scope of the 
present paper, some comments are necessary here. The name was often attributed to 
some Palaearctic butterflies belonging to the Erebia magdalena species complex 
(Kogure & Iwamoto 1992; Tuzov 1993; Korshunov & Gorbunov 1995). There was 
also an attempt to apply the name E. jakuta Dubatolov, 1 992 (E. anyuica jakuta 
Dubatolov, 1992 in the original combination) to the Palaearctic species previously 
considered as E. occulta (Korshunov 1998). We suggest that the name E. anyuica 
Kurentzov, 1966 should be used exclusively for the Palaearctic species that previously 
was considered as E. occulta. This is necessary for the stability of the nomenclature 
and to finish the permanent confusion derived from the application of the name to 
butterflies belonging to very different species groups of the genus Erebia Dalman, 
1816. A thorough investigation of Kurentzov's collection (deposited at the Institute of 
Biology and Pedology of the Russian Academy of Sciences, Vladivostok) should be 
undertaken to find out if there are left any remains of the single type specimen (holotype 
by monotypy) of E. anyuica, which specimen is presumed to be lost (Azarova 1986). 

The recent designation of a neotype of E. anyuica (Korb 1999) must be considered 
as premature and invalid. It does not meet the requirement of ICZN, which allow a 
designation of a neotype: ICZN (1999) Art. 75.3.4. Korb's reasons for believing the 
holotype is lost are based exclusively on the report of Azarova (1986). Korb did not 
take any steps to reinvestigate Kurentzov's collection to trace the holotype. Mean- 
while, there exists a specimen in Kurentzov's collection (quite worn, without abdo- 
men, as the genitalia were presumably dissected, and with no type label), which could 
be the holotype of E. anyuica (Yu. Chistyakov, pers. comm.). Further, there exists a 
separate stock of genitalia preparations in Kurentzov's collection, where the genitalia 
of the holotype could be stored (V. Dubatolov, pers. comm.). Yet, nobody has checked 
this storage with the special aim to find the genitalia of E. anyuica. At last, though 
Korb states "the neotype is forwarded to Zoological Institute of Russian Academy of 
Sciences (St.-Petersburg)" (Korb 1999), he did not forward it there in fact, so far (A. 
Lvovsky, pers. comm.). 

2.2. Material examined and methods 

\96 Canada, Yukon Territory, Richardson Mts., Dempster 1 1 \vy., km 416-466; 46 Russia. NI- Chukotka, 
20 km SE of lake Ioni, valley of GiFmimleveyem river; 2 ' Russia. NW Chukotka. Bilibino district: ca. 
10 km NW of Bilibino; \6 Anyuyskiy mtn. range, vie. of Stadukhino; 12(5 Russia, Magadan region, 
Khasyn district, vicinity of Palatka; 1 6 Russia, Sakha- Yakutiya republic: Oymyakon district, ca. 58 km 



72 



Belik & Zamolodchikov: Systematics of the Erebia dabanensis species complex 



WSW of Oymyakon, at the confluence of Suntar and Agayakan rivers; 4â Tompo district, ca. 180 km 
ENE of Khandyga, Suntar-Khayata mtn. range, upper stream of Khandyga river; 1 1 S Russia, Chita 
region, Udokanskiy mtn. range, 20-26 km SE of Udokan, upper stream of Naminga river; 10 c? Russia, 
Chita region, Kyra district, ca. 67 km WNW of village Kyra, Sokhondo Mts., upper stream of Bukukun 
river; 10 c? Russia, Buryat republic, East Sayan Mts., Kitoyskiye Gol'tsy mtn. range, between the sources 
of Irkut and Kitoy rivers, vicinity of Il'chir lake. 

When studying the male genitalia of E. anyuica and E. occulta, we noticed that in E. 
anyuica the spined ridge of the valvae is relatively shorter than in E. occulta. So, we 
initially used the method of Troubridge & Philip (1983) to compare the length of the 
spined ridge of the valvae (in male genitalia) expressed in per cent of the length of the 
costal edge of the valvae (Fig. 1). Statistical comparisons of E. anyuica and£. occulta 
populations were performed as described above using Mests and a cluster analysis 
(see chapter 1.2.). 

2.3. Results 

Troubridge & Philip (1983) demonstrated that in E. occulta the length of the spined 
ridge of the valvae, expressed in percents of the total length of the costal edge of the 
valvae averages 67.2 % (range 62-72 %). However, these authors were unaware of the 
possible specific independence of the Palaearctic butterflies that they considered as E. 
occulta, too. Their measurements of the valvae of both the Nearctic and Palaearctic 
specimens are mixed together in the published value (K. Philip, pers. comm.). So, 
from the mentioned work nothing can be taken as to possible differences between E. 
occulta and E. anyuica. Later it was stated, without any sufficient proof, that the dif- 
ference of the male genitalia of E. occulta from the male genitalia of "E.jakuta" is "so 
noticeable that there is no need for explanations" (Korshunov 1998). 

Thus, our aims were as follows. First, to determine if there are some stable differ- 
ences between the male genitalia of E. occulta and E. anyuica, which could be used for 
the sure diagnosis of the Palaearctic specimens. Second, to check the possible exist- 
ence of a cline toward £. occulta throughout the area of the distribution of E. anyuica. 

The data presented in the Table 3 demonstrate clearly that the length of the spined 
ridge of the valva can be used as a good taxonomic character to differentiate E. occulta 
from E. anyuica in most cases. There is no noticeable cline leading from the West to 
the East from E. anyuica to E. occulta throughout the huge range of E. anyuica, span- 
ning about 3750 km between the known westernmost (E Sayan) and easternmost (NW 
Chukotka) populations of E. anyuica. The length of the spiny ridge of the valva is 
almost constant throughout the range of the species (Table 3). At the same time, the 
distance between the known easternmost population of E. anyuica at NW Chukotka 
and the newly discovered population of E. occulta at NE Chukotka is just about 860 
km. However, there is a clear difference in the length of the spined ridge of the valvae 
between these populations. Statistical analyses of data on relative lengths of the spined 
ridge of valvae (Table 4) demonstrates that the differences in means between populations 
of E. anyuica and E. occulta are significant without exceptions. This leaves no doubt 
that E. anyuica and E. occulta should be considered as separate species. 

Further, we tried to find more parameters to separate E. anyuica and E. occulta. 
First, we noticed that in E. anyuica the whole valvae are relatively shorter than in E. 



Notalepid. 25(1): 61-78 



73 



DA 



U— i 


c 


o 




r- 


■a 




S3 


~.\ 




G 


■- 


U 


u- 




c_ 


<L) 
> 


g 


' ~ 


Cd 


TS 


^-^ 






'1 




iL, 


o 


c 


o 


•"" 


V 


C/3 


S 


C 


C/5 

o 




c 


m 


— 


— 


1 



2 fC 



=3 ei 



ß 

Si 

^ a 
« CJ 



è 

5 

^ 


cd 

'S 

X) 

in 












1 


ON 

o 
©' 


ö 

g 
"*3 


'S 

Z c 

c3 

s- 

H 










1 


© 
© 


oo 
m 

© 


1*3 


.2 
"3 








1 


00 

o 
ö 


© 
© 

© 

V 


© 
© 


f*3 


S ri 

'S .2 

OU OD 

Cd <D 






i 


© 

© 


00 

© 


© 
© 


r- 

00 

r-- 

© 


a 
i*i 


03 




l 


oo 
© 
© 


© 

© 

© 


© 

© 


© 

Ö 


ON 
© 
© 


t*i 


od 

uu o 
z | 

U 


1 


O 

© 
©* 


© 
© 

© 
V 


© 

© 

© 
V 


© 
© 
© 
V 


© 
© 
© 
V 


© 
© 
© 

V 


c 
faq 





o 
ö 


00 

© 
© 
© 


© 
© 
© 
V 


© 
© 
© 
V 


© 
© 

© 
V 


© 
© 
© 
V 


© 
© 
© 
V 




'S 

u 

o 

-J 


Cd 
Q 

u 

UJ 

z 


c3 

M 

ü 
Z 


zij ' Sc 


> 


"S 
H J 

C3 
l_ 

f- 


"S 

Xj 
<Si 

S 


cd 

CA 

w 


y 

'S 

a 

X. 




,2 
^ 1 


5 


9 




^5 


Ckj 1 





74 



Belik & Zamolodchikov: Systematics of the Erebia dabanensis species complex 



Yukon 

NE Chukotka 

NW Chukotka 

Magadan region 

Yakutia 

NE Transbaikal 

E Sayan 

S Transbaikal 



ü 



0.5 1 1.5 

Linkage distance 



2.5 



Fig. 6. Phenetic cluster diagram of Ë. occulta and E. anyuica populations from different localities (three 
variables, Euclidean distance, single linkage). 



occulta, if body size of the butterflies (measured as forewing length) is controlled for. 
There is one more difference between the male genitalia of E. occulta and E. anyuica 
that was never mentioned in the literature before. We noticed that in the Nearctic speci- 
mens of E. occulta the dorsal edge of the spined ridge of the valva almost always 
forms an obtuse angle with the remaining spineless part of the dorsal edge of the valva 
(Fig. 9). In contrast, in E. anyuica the dorsal edge of the spined ridge of the valva 
almost always runs in parallel with the spineless part of the dorsal edge of the valva 
(Fig. 7). 

Differences in wing pattern and coloration support the idea about the specific dis- 
tinctness of E. occulta and E. anyuica. This is especially well seen in males. Through- 
out the range of E. anyuica from E Sayan to NW Chukotka there is a cline in the degree 
of the development of the fulvous submarginal elements in the forewings. Thus, the 
most developed fulvous ocelli that often are united in an almost uninterrupted band 
(on the upperside) and the most developed and wide submarginal band (on the under- 
side) occur in specimens from the western part of the range (Belik 1996: 160, pi. 1, 
figs. 1-8). In specimens from the eastern part of the species range all these submar- 
ginal pattern elements are strongly reduced (Tuzov et al 1997: 359, pi. 49, figs. 25- 
27). At the easternmost limit of the species range (NW Chukotka: Bilibino district), 
these submarginal pattern elements are practically absent at all, both on the upper- and 
underside of the fore- and hindwings. Thus, the specimens (only a few males are known) 
look totally black, sometimes with almost invisible traces of the submarginal spots on 
the forewings. 

In the specimens of E. occulta from NE Chukotka, in contrast, the fulvous submar- 
ginal elements on the forewings are normally developed, with the same range of vari- 



Notalepid. 25(1): 61-78 



75 




Fig. 7. E. anyuica, male, left valva, lateral view. Russia, Chita region, Udokanskiy mtn. range, 23 km SE 
of Udokan, upper stream of Naminga river, 1405 m, 16.VII.1998, A.G. Belik leg. 




Fig. 8. E. occulta, male, left valva, lateral view. Russia, NE. Chukotka, 20 km SE of lake Ioni, valley of 
Girmiml'veem river, 400 m, 12.VII.1998, D.G. Zamolodchikov leg. 



ations as in specimens of E. occulta from North America. If a cline were to exist from 
E. anyuica to E. occulta in the Palaearctic, then we would expect to see a gradual 
transition in the wing pattern and coloration from one form into the other. This is 
definitely not the case. 

Finally, any male specimen of E. occulta can be distinguished, more or less easily, 
from any male specimen of E. anyuica by the appearance of the hindwing underside. 
In E. occulta, the general appearance of the hindwing underside looks as more or less 
mottled with some dark grey cast. This is due to light hair-like scales (white to creamy 
tan) covering the surface and to the high proportion of pearl grey scales across the 



/Ö Belik & Zamolodchikov: Systematics of the Erebia dabanensis species complex 

entire wing. In E. anyuica the general appearance of the hindwing underside is much 
more monotonous, sooty blackish-brown or black. The hairs covering the surface of 
the wing are dark (brown to black) and pearl grey scales are absent. 

The phenogram resulting from the cluster analysis (Fig. 6) clearly demonstrates 
that all examined populations split into two main groups. In one group are united all 
the Palaearctic populations from E Sayan to NW Chukotka, in the other group are 
united the Palaearctic population of NE Chukotka and the Nearctic ones from the Yu- 
kon Territory. This supports well the hypothesis of specific distinctness of E. anyuica 
and E. occulta. That the populations of E. anyuica look quite heterogeneously is not 
much surprising, taking into account its huge range across ca. 3750 km, from E Sayan 
to NW Chukotka, where E. anyuica forms a number of subspecies. 

2.4. Conclusion 

Summarising all preceding evidence, we conclude that E. occulta is a bona species, 
separated morphologically from its close relative E. anyuica. Further investigations in 
the interior regions of the Chukotka should reveal whether there is some natural bound- 
ary between E. anyuica and E. occulta, or whether there is some narrow intermediate 
zone where these two species could occur in sympatry. We have some hints that E. 
occulta is distributed throughout the whole Chukotskiy Peninsula. First, K. Philip re- 
ported (pers. comm.) that in the collection of the Alaska Lepidoptera Survey there is a 
series of specimens from the mouth of Cheutakan river (65° 38-39' N, 176° 51' W). 
These specimens look almost like Seward Peninsula (Alaska) material, instead of re- 
sembling the rather distinct form from the Magadan region, which in fact is E. anyuica. 
Second, the specimen of "E. tundra" from Egvekinot (ca. 250 km NW from the mouth 
of Cheutakan river), figured by Kogure & Iwamoto (1 993), likely belongs to E. occulta, 
but the exact determination is impossible without checking both the wing underside 
and the structure of male genitalia. 

At present, we cannot judge about the subspecific status of the NE Chukotkian 
population of E. occulta with full certainty (because of the low number of available 
specimens). There is the good probability that it belongs to the nominotypical subspe- 
cies. Troubridge &' Philip (1983) demonstrated that in North America the variation 
from the Richardson Mts. (Canada: Yukon) to the Seward Peninsula (USA: Alaska) 
does not warrant naming the extremes as subspecies. Specimens from NE Chukotka 
are quite similar to those we have from Yukon for comparison. On the other hand, in 
some specimens of E. occulta from NE Chukotka the shape of the valvae in the male 
genitalia is quite different from that of E. occulta from Yukon {cf. Fig. 8 with Fig. 9). In 
the Chukotkian specimens occurs a tendency to complete reduction of the heel-like 
projection in the distal part of the spined ridge of the valvae, while the spined ridge 
itself is longer than in Nearctic specimens and runs in parallel to the costal edge of the 
valva. This might even be used as morphological argument for a separation of the 
Chukotkian populations of E. occulta as a distinct species, but such an action is abso- 
lutely premature. We have studied male genitalia of but four specimens from NE 
Chukotka. Moreover, we had no specimens of E. occulta from Alaska to study the 



Notalepid. 25(1): 61-78 77 



Fig. 9. E. occulta, male, left valva, lateral view. Canada, Yukon Territory, Richardson Mts., Dempster 
Hwy., km 466, 3400 ft., 18.VI.1993, M.L. Grinnell leg. 



variation in the male genitalia in that part of its range, which is closest to Chukotka. 
More material of E. occulta from Chukotka should first be studied to clarify the range 
of its variation there. Finally, it should be emphasized that our findings of E. occulta 
and E. youngi in Chukotka, the first records of these putatively Nearctic species from 
the entire Palaearctic region, add two further cases to the growing list of species with 
trans-Beringian ranges. 

Acknowledgements 

We wish to thank all the persons who kindly assisted in our work. For reports of important unpublished 
information, we thank Dr. P. I. Beda (Moscow, Russia), Dr. Yu. A. Chistyakov (Vladivostok, Russia), 
Dr. V. V. Dubatolov (Novosibirsk, Russia), Dr. A. L. Lvovsky (St.-Petersburg, Russia), Dr. K. W. Philip 
(Fairbanks, USA), Mr. J. T. Troubridge (Langley, Canada). For the grant of important comparative ma- 
terials from the Magadan region, as well as for his help to A. Belik to get to NVV. Chukotka, we are very 
grateful to Mr. V V. Baglikov (Palatka, Russia). For the most warm and friendly logistic support during 
the expedition of A. Belik to NW Chukotka, we are indebted to Mr. V A. Tsyb (Bilibino, Russia). The 
material from NE Chukotka was collected during the complex ecological expedition, sponsored by Re- 
search Institute of Innovative Technologies for the Earth (Kyoto, Japan). The logistic support of the 
latter expedition by Mr. L. M. Danilov (Lorino, Russia) is greatly appreciated. For the long-standing 
great help in providing us with many important foreign literature sources our special thanks arc ad- 
dressed to Mr. John B. O'Dell (St. Albans, England) and Mr. Willy De Prins (Antwerp, Belgium); to Mr. 
Kuniomi Matsumoto (Tokyo, Japan) for his most friendly help with Japanese literature sources and for 
very useful translations of them into English; to Dr. K. W. Philip (Fairbanks, USA) for granting the book 
"The butterflies of Canada". 

References 

Azarova, N. A., 1986. A. I. Kurentzov's type material of Rhopalocera (Lepidoptera) in the collection of 
Institute of Biology and Pedology. In: Ler P. I. & V. S. Kononenko (Eds.). Systematics and ecology 
of Lepidoptera in the Far East of USSR. Vladivostok, pp. 121 1 2X [ in Russian]. 

Belik, A. G. 1996. New subspecies of Erebia anyuica Kurentzov, 1 966 and ( 'lossiana erda (( Ihristoph, 1 893) 
from the Vostochnyy Sayan mountains. Russia (lepidoptera: Nymphalidac). Phcgea 24 (4): 157 166. 

Belik, A. G. (in press). Notes on taxonomy and geographical distribution of Erebia dabanensis and 
Erebia fletcheri (Lepidoptera: Satyridae), with the description of two new subspecies from the South 
Transbaikal, Russia. - Atalanta. 

dos Passos, C. F. 1972. Designation of a lectotype for E. youngi I loi land. I ut. Rec. 84: 238 241. 



78 



Belik & Zamolodchikov: Systematics of the Erebia dabanensis species complex 



Dubatolov, V. V. 1992. New subspecies of Nymphalidae and Satyridae (Lepidoptera, Rhopalocera) from 

Yakutia. - Vestnik Zoologii 6: 40-45 [in Russian]. 
Herz, O. 1903. Beitrag zur Kenntniss der Lepidopterenfauna der Tschuktschen-Halbinsel. - Ann. Mus. 

Zool. Acad. Sei. St. -Petersburg 8: 14-16. 
ICZN 1999. International Code of Zoological Nomenclature. Fourth edition. - The International Trust 

for Zoological Nomenclature, London. Pp. i-xxx, 1-306. 
Kogure, M. & Iwamoto, Y. 1992. Illustrated catalogue of the genus Erebia in color. - Yadoriga 150: 2-33 

[in Japanese]. 
Kogure, M. & Iwamoto, Y 1993. Illustrated catalogue of the genus Erebia in color (II). - Yadoriga 154: 

2-38 [in Japanese]. 
Korb, S. K. 1999. On taxonomy of Erebia anyuica (Lepidoptera, Satyridae). - Zool. J. Mose. 78 (1 1): 1368- 

1370. [in Russian]. 
Korshunov, Yu. P. 1972. Catalogue of Rhopalocera (Lepidoptera) from the USSR. - Ent. Obozr. 51 (1): 

136-154. [in Russian]. 
Korshunov, Yu. P. & P. Yu. Gorbunov 1995. [Butterflies of the Asian part of Russia.] - Ekaterinburg, 

1995,202 p. [in Russian]. 
Korshunov, Yu. P. 1996. [Addenda and corrigenda to the book "Butterflies of the Asian part of Russia".] 

- Novosibirsk, 1996, 66 p. [in Russian]. 
Korshunov, Yu.P. 1998. [New descriptions and specifications to the book "Butterflies of the Asian part of 

Russia".] - Novosibirsk, 1998, 70 p. [in Russian]. 
Kürentzov, A. I. 1966. New forms of the family Satyridae (Lepidoptera) in the fauna of the Far East. - 

In: Cherepanow, A. I. (Ed.). New species of fauna of Siberia and ajoining region. Novosibirsk, 34- 

38 [in Russian]. 
Kurentzov, A. I. 1970. The butterflies of the Far East USSR. - Leningrad, Nauka, 164 p., 14 pi. [in 

Russian]. 
Layberry, R. A., Hall, P. W., & Lafontaine, J. D. 1998. The butterflies of Canada. - Toronto, Buffalo, 

London. Univ. Toronto Press Inc., 280 p., 32 pi. 
Philip, K. W. & Roos, P. 1985. Notes on Erebia occulta (Lepidoptera, Satyridae). - J. Res. Lepid. 24 (1): 

81-82. 
Roos, P. & Kimmich, H. P. 1983. Eine neue Art der Erebia alberganus-GruppQ aus Nordkanada (Lep.: 

Satyridae). - Ent. Z. 93 (6): 69-77. 
Scott, J. A. 1986. The butterflies of North America. A natural history and field guide. - Stanford, California, 

Stanford University Press, 583 p., 64 pi. 
StatSoft 1995. STATISTICA 5.0 for Windows. - StatSoft Inc., Tulsa, Oklahoma. 
Streltzov, A. N. 1998. A new subspecies of Erebia occulta Roos et Kimmich, 1983 (Lepidoptera, Satyridae) 

from North-Eastern Transbaikalia. - Far Eastern Entomologist 53: 1-4. 
Troubridge, J. T. & Philip, K. W. 1983. A review of the Erebia dabanensis complex (Lepidoptera: 

Satyridae), with descriptions of two new species. - J. Res. Lepid. 21 (2): 107-146. 
Tuzov, V. K. 1993. The synonymic list of butterflies from the ex-USSR. - Moscow, Rosagroservice, 

1993, 73 p. 
Tuzov, V. K. 1995. Notes on the butterflies of West Chukotka (Lepidoptera, Rhopalocera). - Actias 2(1- 

2): 105-109. 
Tuzov, V. K., Bogdanov, P. V., Devyatkin, A. L., Kaabak, L. V., Korolev, V. A., Murzin, V. S., Samodurov, 

G. D., Tarasov, E. A. 1997. Guide to the butterflies of Russia and adjacent territories (Lepidoptera, 

Rhopalocera). Vol. 1. Hesperiidae, Papilionidae, Pieridae, Satyridae. - Sofia & Moscow, Pensoft, 

480 p., 79 pi. 
Tuzov, V. K., Bogdanov, P. V., Devyatkin, A. L., Kaabak, L. V., Korolev, V. A., Murzin, V. S., Samodurov, 

G. D., Tarasov, E. A. 2000. Guide to the butterflies of Russia and adjacent territories (Lepidoptera, 

Rhopalocera). Vol. 2. Nymphalidae, Danaidae, Lycaenidae, Riodinidae. - Sofia & Moscow, Pensoft, 

580 p., 88 pi. 
Warren, B. C. S. 1936. Monograph of the genus Erebia. - London, Adlard and Son Ltd., VII+407 p., 104 pi. 
Warren, B. C. S. 1969. Notes on three little-known species of the alberganus-growp of the genus Erebia. 

-Ent. Rec. 81:201-203 
Warren, B. C. S. 1981. Supplement to Monograph of the genus Erebia. - E. W. Classey Ltd., 17 p. 



Book Review 

Peter Huemer 2001. Rote Liste gefährdeter Schmetterlinge Vorarlbergs. Vorarlberger 
Naturschau im Auftrag der Vorarlberger Landesregierung, Dornbirn. Pp. 1-1 12, 1 CD-ROM. 
ISBN 3-90227 1 -00-0. Price € 1 5 .00. [in German] . To be ordered from: Vorarlberger Naturschau, 
Marktstr. 33, A-6850 Dornbirn, Austria. 

Red Data Books document the degree of threats to species and thus provide important 
information for officials, landscape planners, conservationists and others. More than 1500 Red 
Data Books have been published in the German speaking countries until 1998. Most of them 
are simple lists with species names placed in one of the categories "regionally extinct", "critically 
endangered", "endangered", "vulnerable", "near threatened", and "least concern". Moreover, 
to a large extent these lists are a matter of very subjective concern, since the authors show no 
data to underpin why they place a given species in a particular category. It is therefore not 
surprising that many of those categorised species became known to be misplaced, e.g. "extinct" 
species subsequently turned out not to be infrequent, whereas others became known to be 
much more rare than originally thought. Such circumstances are found the more frequently the 
less studied a taxonomic group is. It is therefore not surprising that the value of Red Data 
Books is often critically debated. However, there should be a tool available providing efficient 
information on which animals need more attention than others in nature conservation. Peter 
Huemer has now shown how to write a Red Data Book in an understandable manner. Based on 
comprehensive data received from collections, publications, databases and own field work he 
analysed the occurrence of all the 2307 species of Lepidoptera currently known to occur in the 
Austrian province of Vorarlberg. Additionally to the categories mentioned above, Huemer adds 
the two categories "data deficient" and "not evaluated" as well as a list of misidentifications 
and erroneously recorded species. Explanations are given of how the author defines each 
category, why each species was placed in it and how urgent the need is for active protection. 
For some species a map with distribution records from Vorarlberg is included, accompanied by 
colour photographs. Analysing the quantitative data of species records and their habitats, Huemer 
shows a significant correlation of species decline by intensification of land use, e. g. in urban 
settlement or agriculture. The legal situation for conservation with a particular emphasis of 
species of the fauna-flora-habitat directive of the EU is discussed and regional and national 
responsibilities and action requirements for conservation are shown. A list of references and a 
bibliography of the Lepidoptera from Vorarlberg conclude the work. A very useful and important 
tool of this Red Data Book is the enclosed CD-ROM. For each species, the status within the 
Red Data Book is given together with quite detailed information on their habitat, vertical 
distribution, and larval habits. This table makes the entire Red Data Book understandable and 
may function as a basic tool for forthcoming Red Data Books on Lepidoptera. The Red Data 
Book of the Lepidoptera from Vorarlberg may be called a successful step in developing intelligent 
tools for the protection of these animals. Surely, it is not the final quality we want to have. 
Peter Huemer analysed more than 85.000 data records, the bibliography of the Lepidoptera 
from Vorarlberg and all its important collections, but for as many as 269 species data remain 
deficient. Yet it is rather common in entomology that too few specialists have to deal with too 
many species. Peter Huemcr's Red Data List can be regarded as a land-mark step in the right 
direction. 

Matthias Nuss 



Notalepid. 25(1): 81-84 81 

Chazara persephone (Hübner, [1805]) or Chazara anthe 
(Hoffmansegg, 1806) - what is the valid name? (Nymphalidae, 
Satyrinae) 

SlGBERT WAGENER 

Dr. P. Sigbert Wagener, Roßbachstraße 41, D-46149 Oberhausen, Germany, e-mail: 
sigbert.wagener@kapuziner.org 

In all his publications, Koçak (for example 1982: 166; 2001: 6; see also 
Lukhtanov & Lukhtanov 1994) used the name anthe Hoffmansegg, 1804 [note 
the year of publication!] for the taxon in question. As this is in contradiction to 
most other authors who used the name anthe Ochsenheimer, 1 807 ox persephone 
Hübner, 1803 (e.g. Gaede 1931: 116; Wyatt & Omoto 1981) ox persephone 
Hübner, [1805] (Karsholt & Razowski 1996), the author of this note tried to 
establish which name really is the valid one according to the most actual ver- 
sion of the International Code of Zoological Nomenclature (ICZN 1999). 

The history of the relevant species-group names is as follows: 

Fabricius (1793) introduced in his Entomologia systematica 111(1 ): 174 the 
name Papilio persiphone for a butterfly taxon from tropical Africa. This name 
is currently understood as a junior subjective synonym, and the species in ques- 
tion is known in the combination Acraea egina egina (Cramer, [1775]) (see 
Ackery et al 1995: 236). 

Hübner ([1805]) in his Sammlung europäischer Schmetterlinge, pi. 115, figs. 
589-590, figured under the name Papilio persephone a Palaearctic butterfly spe- 
cies currently known in the combination Chazara persephone (Nymphalidae: 
Satyrinae). In the text volume to his Sammlung europäischer Schmetterlinge 
the paragraph relevant to this species appeared (on p. 21) one year later [1806]. 
Therein Hübner names "Rußland, bey Sarepta" as the type locality and remarks: 
"Aus der Sammlung des Hrn. Büringer in Gunzenhausen." This is the species 
dealt with here. 

Esper ([1805]) in the Supplementband der Europäischen Schmetterlinge 2: 
21, again published the same name Papilio persephone for a taxon today placed 
in the genus Erebia Dalman, 1816 (Nymphalidae: Satyrinae) from the Western 
Alps. According to Hemming (1937), Hübner 's plate 1 15 withpersephone came 
out before the end of 1805. As no exact publication date exists for persephone 
Esper, 1805 (Poche 1938: 19) one has to take 31 .xii. 1805 as its publication date 
according to ICZN, Article 21 . Therefore the name Papilio persephone Esper is 
a primary homonym of Papilio persephone Hübner. 

© Nota lepidoptcrologica. 01.08.2002. ISSN 0342-7536 



82 



Wagener: Chazara persephone (Hübner, [1805]) 



Hoffmansegg (1806), in his Erster Nachtrag zu seinem Alphabetischem 
Verzeichnisse von Hübner s Papilionen wrote (on p. 182) with reference to the 
species in question: "Persephone. T. 115. F. 589. 590. * Anthe Böber. Böber hat 
diesen Schmetterling in Süd Russland entdekkt, und ihn Anthe genannt. Dieser 
Name bleibt ihm mit desto mehr Recht, da der Hübnerische wegen Collision 
mit Persephone Fab. ohnehin nicht anzunehmen wäre." This is all of the text in 
Hoffmansegg's work pertinent to persephone. 

In view of these facts it remains to ascertain: (1) The taxon described by 
Fabricius, 1793 was not named Papilio persephone but persiphone. (2) Papilio 
persiphone Fabricius, 1793 and Papilio persephone Hübner, [1805] are not pri- 
mary homonyms (ICZN, Article 57.6: one-letter difference). (3) The asterisk 
(*) preceding "Anthe Böber" in the above cited text means according to 
Hoffmansegg (1804: 182) that this is "der Name, der den übrigen vorgezogen 
werden muß" [translated: "... the name that must be preferred over the others"]. 
Johann de Boeber (| 1 820 in St. Petersburg) collected insects in South Russia 
(Horn & Kahle 1937: 321). (4) There is no reason to presume, that Boeber him- 
self described and published the name anthe (cf. Horn & Schenkung 1928: 92). 
Instead, he merely gave the discovered new butterfly an informal name as it was 
the use of collectors at that time when mailing material to other persons. (5) In 
merely adopting the informal name suggested by Boeber, the real author of the 
name anthe is Hoffmansegg, 1806 in the sense of the Code. (6) One could as- 
sume that Fabricius (1793) made an inadvertent error {lapsus calami) (ICZN, 
Article 32.5.1) in writing persiphone instead of persephone. Persephone is the 
Greek name of the Roman Proserpina (Heinichen 1931: 428). Since the deriva- 
tion of the name is doubtless on etymological grounds, according to ICZN, Ar- 
ticle 19.2 indeed Papilio persephone Fabricius, 1793 could be the oldest avail- 
able name (justified emendation). But this is not the case. There is no clear 
evidence of an incorrect original spelling as it is required by ICZN, Article 32.5. 
In the text of Fabricius (1793) the name persiphone appears twice and no de- 
monstrably intentional change in the original spelling (ICZN, Article 33.2.1) is 
to find in Fabricius' own work. Therefore, Papilio persephone Fabricius, 1793 
can not be deemed as a justified emendation; it is an unjustified emendation and 
incorrect subsequent spelling (ICZN, Article 33.3) of Hoffmansegg (1806) and 
subsequent authors. (7) From the text of Hoffmansegg (1806) can not be con- 
cluded without doubt that he wished to introduce the name anthe as a replace- 
ment name for persephone Hübner, [1805]. The type material came from differ- 
ent sources: Papilio persephone Hübner from Büringer, anthe Hoffmansegg 
from Boeber. Therefore anthe Hoffmansegg, 1806 can not be deemed as an 
replacement name and not as an objective synonym, but only as a junior subjec- 
tive synonym of Papilio persephone Hübner, [1805]. 



Notalepid. 25(1): 81-84 83 

Subsequently, Ochsenheimer (1807: 169) used the name anthe with reference 
to "Hübner, Pap. Tab 115, fig. 589, 590, Text S. 21. P. Persephone" and to 
Hoffmansegg in 'Tlliger, Mag. V. ... S . 182", following the opinion of the latter. 
Neglecting these references to Hübner and Hoffmansegg, many authors during 
the 1 9 th and early 20 th century, especially of German language, incorrectly used 
the name anthe Ochsenheimer, 1807 whilst in the same time period most au- 
thors of English language correctly used the name persephone Hübner, but com- 
bining it with 1803 as publication year. 

Koçak (1982) and Lukhtanov & Lukhtanov (1994) in their publications are in 
error combining the name anthe Hoffmansegg with 1804 as the year of publica- 
tion, because Hoffmansegg (1804) in his Alphabetisches Verzeichniss zu J. 
Hübner 's Abbildungen der Papilionen ... nowhere mentions the name anthe. 

From these investigations the following synonymic list results: 

Papilio persephone auctorum: Incorrect subsequent spelling of the name 
Papilio persiphone Fabricius, 1793 (cf. Hoffmansegg 1806; Ackery et al. 
1995). 

Papilio persephone Hübner, [1805]: The oldest available name for the taxon 
currently known as Chazara persephone. 

Papilio persephone Esper, [1805]: Junior primary homonym of Papilio 
persephone Hübner, [1805]. 

Papilio anthe Hoffmansegg, 1806: Junior subjective synonym of Papilio 
persephone Hübner, [1805]. 

Papilio anthe Ochsenheimer, 1807: Error of subsequent authors in the attribu- 
tion of author to the name Papilio anthe Hoffmansegg, 1806. 

Papilio persephone Hübner, 1803: Unavailable name, error of subsequent au- 
thors in the year of publication. 

Chazara anthe Hoffmansegg, 1804: Unavailable name, error of subsequent 
authors in the year of publication. 



Acknowledgement 

The author wishes to express his cordial thanks to Prof. Dr. Otto Kraus. I lambing, for checking a former 
proof and confirming the results as well as to Prof. Dr. Konrad Fiedler, Bayreuth, for the advice to 
Ackery et al. ( 1995) and linguistic corrections of the manuscript, also to an unknown reviewer for some 
comments. 



References 

Ackery, P. R., C. R. Smith & R. I. Vane-Wright (eds.) 1995. Carcasson's African butterflies. An annotated 
catalogue of the Papilionoidea and Hesperioidea of the Afrotropical region. CSIRO Press. Easl 
Melbourne, Victoria, Australia. 803 pp. 



84 



Wagener: Chazara persephone (Hübner, [1805]) 



Esper, E. J. C. [1805]— [1830]. Die Schmetterlinge in Abbildungen nach der Natur mit Beschreibungen. 

- Walthers, Erlangen. Supplement, part 2: 1^8; pis. 117-126. 
Fabricius, J. C. 1793. Entomologia systematica emendata et aucta. - C. G. Proft, Fil. et Soc, Hafniae. 3 

(1): VI + 488 pp. 
Gaede, M. 1931. Lepidopterorum catalogus. Vol. XXIX. - W. Junk, Berlin. 759 pp. 
Hemming, F. 1937. Hübner. A bibliographical and systematic account of the entomological works of 

Jacob Hübner ... - Royal Entomological Society, London. Vol. 1. I+XXXiV+1+605 pp. 
Heinichen, F. A. 1931. Lateinisch-deutsches Schulwörterbuch. 10 th edition. - B. G. Teubner, Leipzig and 

Berlin. 648 pp. 
Hoffmansegg, J. C. v. 1804. Alphabetisches Verzeichniss zu J. Hübner's Abbildungen der Papilionen 

mit den beigefügten vorzüglichsten Synonymen. - Illiger, Mag. Insektenk. 3: 181-206. 
Hoffmansegg, J. C. v. 1806. Erster Nachtrag zu des Gr. v. Hoffmansegg alphabetischem Verzeichnisse 

von Hübner's Papilionen. Nachtrag aus den seitdem erschienenen Tafeln 115, 116, 117. - Illiger, 

Mag. Insektenk. 5: 181-183. 
Horn, W. & S. Schenkung 1928. Index litteraturae entomologicae. Serie I: Die Welt-Literatur über die 

gesamte Entomologie bis inklusive 1863. - Selbstverlag, Berlin-Dahlem. Vol. 1, 352 pp., 1 pl. 
Horn, W. & I. Kahle 1937. Über entomologische Sammlungen, Entomologen & Entomo-Museologie. 

Nachtrag. - Ent. Beih. Berlin-Dahlem, 4: 313-388. 
Hübner, J. 1796-1827. Sammlung europäischer Schmetterlinge. - Selbstverlag, Augsburg. Pis. 1-181; 

text: 1805-1823, vol. 1,74 pp. 
ICZN (International Commission on Zoological Nomenclature) 1999. International code of zoological 

nomenclature. 4 th edition. - International Trust for Zoological Nomenclature London. 306 pp. 
Karsholt, O. & J. Razowski 1996. The Lepidoptera of Europe. A distributional checklist. -Apollo Books, 

Stenstrup. 380 pp. 
Koçak, A. Ö. Critical checklist of European Papilionoidea (Lepidoptera). - Priamus 1 (4): 155-167. 
Koçak, A. Ö. & M. Kemal 2001 . Türkiye Kelebeklerinin Anadillerdeki I simlerinin Listesi (Papilionoidea, 

Hesperioidea, Lepidoptera). - Miscellaneous Papers Nr.72/73: 1-15. CESA Ankara. 
Lukhtanov, V & A. Lukthanov 1994. Die Tagfalter Nordwestasiens. (Lepidopotera, Diurna) - Herbipoliana 

3. Dr. Ulf Eitschberger, Marktleuthen. 440 pp., 56 colour plates, 19 figs., 400 distribution maps. 
Ochsenheimer, F. 1807. Die Schmetterlinge von Europa. - Gerhard Fleischer dem Jüngeren, Leipzig. 

1(1): 324 pp. 
Poche, F. 1938. Über den Inhalt und die Erscheinungszeit einzelner Hefte, die bibliographische Anord- 
nung und die verschiedenen Ausgaben von E. J. C. Esper, Die Schmetterlinge in Abbildungen nach 

der Natur mit Beschreibungen. - Festschrift zum 60. Geburtstage von Prof. Dr. Embrik Strand. Riga. 

Band 4 (1937): 1-37. 
Wyatt, C. W. & K. Omoto 1981. Butterflies of Afghanistan. - S. Sakai, Japan. 272 pp., 197 figs., 48 

colour pis. (in Japanese). 



SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e. V. 



Nota lepidopterologica wird den Mitgliedern der SEL zugesandt. Die Mitgliedschaft bei SEL steht 
Einzelpersonen und Vereinen nach Maßgabe der Satzung offen. Der Aufnahmeantrag ist an den 
Mitgliedersekretär Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgien; e-mail: 
Willy.Deprins@village.uunet.be zu richten. Das Antragsformular ist im Internet auf der Homepage 
der SEL unter http://www.zmuc.dk/EntoWeb/SEL/SEL.htm erhältlich. 

Der Mitgliedsbeitrag ist jährlich am Jahresanfang zu entrichten. Er beträgt für Einzelpersonen € 35,00 
bzw. für Vereine € 45,00. Die Aufnahmegebühr beträgt € 2,50. Die Zahlung wird auf das SEL-Konto 1 956 
50 507 bei der Postbank Köln (BLZ 370 100 50) erbeten. Mitteilungen in Beitragsangelegenheiten sind an 
den Schatzmeister Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail: Sommerer.Manfred@t- 
online.de zu richten. 

Der Verkauf von Einzelheften und älteren Jahrgängen von Nota lepidopterologica sowie der Verkauf der 
Zeitschrift an Nichtmitglieder erfolgt durch Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Däne- 
mark; e-mail: apollobooks@vip.cybercity.dk. 
Adressenänderungen bitte sofort dem Mitgliedersekretär oder dem Schatzmeister mitteilen! 

Nota lepidopterologica is sent to the members of SEL. The membership is open to individuals and 

associations as provided for by the statutes of SEL. Applications for membership are to be addressed to 

the membership secretary Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgium; e-mail: 

Willy.Deprins@village.uunet.be. The application form will be found on the SEL Homepage http:// 

www.zmuc.dk/EntoWeb/SEL/SEL.htm. 

The annual subscription is to be paid at the beginning of the year. It is € 35.00 for individuals or € 45.00 

for associations. The admission fee is € 2.50. Payments requested to SEL account no. 1956 50 507 at 

Postbank Köln [Cologne] (bank code 370 100 50). In matters concerning the subscription or payments, 

please contact the treasurer Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail: 

Sommerer.Manfred@t-online.de . 

Back numbers of Nota lepidopterologica may be obtained from, and orders of Nota lepidopterologica 

from non-members are serviced by Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Denmark; e- 

mail: apollobooks@vip.cybercity.dk. 

Changes of address should be immediately communicated to the Membership Secretary or the Treasurer. 

Nota lepidopterologica est envoyé aux membres de la SEL. L'affiliation est possible, pour les personnes 
individuelles aussi bien que pour les associations, en accord avec les statuts de la SEL. Les demandes 
d'affiliation doivent être adressées au Secrétaire des Membres Willy O. De Prins, Nieuwe Donk 50. B- 
2100 Antwerpen, Belgique; e-mail: willy.deprinsiV/willage. uunet.be. 

Le formulaire d'affiliation est disponible par le biais de la SEL homepage http://www.zmuc.dk/EntoWeb/ 
SEL/SEL. htm. La contribution annuelle est payable au début de l'année Elle est de € 35,00 pour les 
personnes individuelles et de €45,00 pour les associations. Les frais d'admission s'élèvent à (. 2.5(1. Les 
payements doivent être effectués sur le compte SEL n° 1956 50 507 auprès de la Postbank Köln 
[Cologne] (code bancaire 370 100 50). Pour toutes questions en rapport à la souscription ou aux paj ements, 
veuillez contacter le Trésorier Manfred Sommerer, Volpinistr. 72. D-80638 München, e-mail: 
Sommerer. Manfred^/ t-oniine.de. Les anciens volumes de Nota lepidopterologica peuvent être obtenus el 
les commandes concernant eetle revue de la part de non- membres effectuées auprès (W Apollo Hooks. 
Kirkeby Sand 19, DK-5771 Stenstrup. Danemark; e-mail: apollobooks@vip.cybercity.dk. 
Tous changements d'adresse doivent être communiqués immédiatement soit auprès du Secrétaire des 
Membres, soit auprès du Trésorier. 



S4i 



NOTA 
LEPIDOPTEROLOGICA 

A journal devoted to the study of Lepidoptera 

Published by Societas Europaea Lepidopterologica (SEL) 




Vol.25 No. 2/3 2002 



SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e. V. 



http://www.zmuc.dk/entoweb/sel/sel.htm 



Honorary Members 

Pamela Gilbert (GB), Barry Goater (GB), Prof. Dr. Lâszlo Gozmâny (H), Prof. Dr. 
Vladimir Kuznetzov (RU), Prof. Dr. Clas M. Naumann (D), Dr. P. Sigbert Wagener (D) 



\ v Council 

x • 

President'**-^" 

- Vice-President: 

General Secretary: 

Treasurer: 

Membership Secretary: 

Ordinary Council Members: 

Editor: 
Managing Editor: 



Prof. Dr. Niels P. Kristensen (DK) 

Dr. David Agassiz (UK) 

Dr. Christoph L. Häuser (D) 

Manfred Sommerer (D) 

Willy O. de Prins (B) 

Dr. Bernard Landry (CH), 

Dr. Elisenda Olivella (E), Dr. Laszlö Ronkay (H), 

Dr. Gerhard Tarmann (A), Dr. Alberto Zilli (I) 

Prof. Dr. Konrad Fiedler (D) 

Dr. Matthias Nuß (D) 



Copyright © Societas Europaea Lepidopterologica (SEL) 

ISSN 0342-7536 

Printed by druck-zuck GmbH, Halle/Saale, Germany 

All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or 

mechanical including photocopying, recording or any other information storage and retrieval system, without written 

permission from the publisher. Authors are responsible for the contents of their papers. 



Nota lepidopterologica 

Ajournai devoted to the study of Lepidoptera 
Published by the Societas Europaea Lepidopterologica e. V. 

Volume 25 No. 2/3 Halle / Saale, 15. 11. 2002 ISSN 0342-7536 

Editorial Board 

Editor. Prof. Dr. Konrad Fiedler, Lehrstuhl für Tierökologie I, Universität Bayreuth, 

D-95440 Bayreuth, Germany; e-mail: konrad.fiedler@uni-bayreuth.de 
Managing Editor. Dr. Matthias Nuß, Staatliches Museum für Tierkunde, Königsbrücker Landstr. 159, 

D-01109 Dresden, Germany; e-mail: nuss@snsd.de 
Assistant Editors: Dr. Enrique Garcia-Barros (Madrid, E), Dr. Roger L. H. Dennis (Wilmslow, UK), 

Dr. Peter Huemer (Innsbruck, A), Ole Karsholt (Kobenhavn, DK), Dr. Yuri P. Nekrutenko (Kiev, UA), 

Dr. Erik J. van Nieukerken (Leiden, NL), Dr. Wolfgang Speidel (Bonn) A 



Contents • Inhalt • Sommaire ^^V^fiÄAfNES 



Nieukerken, E. J. v. & Lastùvka, A.: Ectoedemia (Etainia) obtusa 

(Puplesis & Diskus, 1996) new for Europe: taxonomy, distribution and 

biology (Nepticulidae) 87 

Baran, T.: Elachista nolckeni Sulcs, 1992: morphology and bionomics of 

immature stages (Gelechioidea: Elachistidae) 97 

Huemer, P. & Karsholt, O.: A review of the genus Acompsia Hübner, 1825 

with description of new species (Gelechiidae) 109 

Kallies, A. & Spatenka, K.: Four species of Brachodidae new to the fauna 

of Europe (Sesioidea) 155 

Garcia-Barros, E.: Taxonomic patterns in the egg to body size allometry 

of butterflies and skippers (Papilionoidea & Hespcriidac) 161 

Kolev, Z.: The species of Maculinea van Eecke, 1915 in Bulgaria: 

distribution, state of knowledge and conservation status (Lycaenidae) 177 

Sommerer, M. D.: Opinion. To agree or not to agree the question of gender 

agreement in the International Code of Zoological Nomenclature 191 

Book Reviews 108, 152, 176 



Nota lepid. 25 (2/3): 87-95 87 

Ectoedemia (Etainia) obtusa (Puplesis & Diskus, 1996) new for 
Europe: taxonomy, distribution and biology (Nepticulidae) 

Erik J. van Nieukerken* & Ales Lastûvka** 

* Nationaal Natuurhistorisch Museum Naturalis, P. O. Box 9517, NL-2300 RA Leiden, The Nether- 
lands; e-mail: nieukerken@nnm.nl 
** Slavickova 15, CZ-796 01 Prostejov, Czech Republic 



Summary. Ectoedemia {Etainia) obtusa (Puplesis & Diskus), described from Turkmenistan, is for the 
first time recorded from Europe: Spain, France, Italy and Croatia. It has been reared from cocoons, 
partly found on trunks of Fraxinus ornus L., which is considered to be its probable host. The female is 
described here for the first time and the male redescribed and illustrated. A checklist and key of the 
seven Western Palaearctic species of the subgenus are provided. 

Zusammenfassung. Ectoedemia (Etainia) obtusa (Puplesis & Diskus), beschrieben aus Turkmenistan, 
wird zum erstenmal aus Europa gemeldet, namentlich aus Spanien, Frankreich, Italien und Kroatien. 
Die Art wurde aus Puppen gezüchtet, die teilweise auf Stämmen von Fraxinus ornus L. gefunden wurden; 
diese Pflanze wird daher als die wahrscheinliche Futterpflanze angesehen. Das Weibchen wird zum 
erstenmal beschrieben, und das Männchen aufs neue beschrieben und abgebildet. Eine Checkliste und 
Bestimmungsschlüssel der sieben westpaläarktischen Arten der Untergattung Etaina werden angegeben 
und Anmerkungen zum taxonomischen Status von Etaina gemacht. 

Résumé. Ectoedemia (Etainia) obtusa (Puplesis & Diskus), décrit de Turkmenistan, est rapportée de 
l'Europe pour la première fois: provenant d'Espagne, France, Italie et Croatie. Quelques exemplaires 
étaient élevés des cocons trouvés sur des troncs de Fraxinus ornus L.; cette plante est regardée comme 
plante-hôte possible. La femelle est décrit pour la première fois, et le mâle est décrit de nouveau et figuré 
en détail. Nous donnons aussi un liste des sept espèces Ouest-Paléarctiques et un table d'identification. 

Key words. Lepidoptera, Nepticulidae, Ectoedemia (Etainia) obtusa, host plants, Europe. 

Introduction 

The nepticulid subgenus Etainia (in the genus Ectoedemia), often regarded as a sepa- 
rate genus (Scoble 1983; Puplesis 1994; Puplesis & Diskus 1996) is one of the best 
characterized monophyletic entities within the family, best characterized by the unique 
dorsal apodeme on the valve in the male genitalia. It is also rather peculiar in its biol- 
ogy, since the species are not leaf-miners, but - as far as known in the Holarctic fauna 
- feed in shoots, petioles or fruits, most on Acer (Aceraceae) and one species on Arc- 
tostaphylos (Ericaceae). 

The four known European species were fully treated by Van Nieukerken & Johansson 
(1990) and Lastûvka & Lastûvka (1997), a fifth was described by Puplesis (1994). 
Puplesis & Diskus (1996) described two further Western Palaearctic species from 
Turkmenistan and provided a world checklist of the 16 known species. 

The senior author received in the early nineties some specimens from southern 
France and Italy which clearly did not belong to the four known European species. 
Initially it was considered an undescribed species, and listed as such in the French and 
Italian checklists (Karsholte/ al. 1995; Leraut 1997). Later it could be identified as the 
recently described Etainia obtusa Puplesis & Diskus, 1996. Since then the junior au- 
thor also reared this species from cocoons, collected on trunks of Fraxinus ornus L. 
Krenek (2000) beautifully illustrated one of his female specimens. 

©Nota lepidopterologica. 15.11.2002. ISSN 0342-7536 



NiEUKERKEN & Lastûvka: Ectoedemia obtusa new for Europe 



The species will be redescribed here, including the description of the unknown female 
and biology. In addition we provide a revised key to Western-Palaearctic species. 



Methods 

Genitalia preparations were embedded in euparal, following the methods in Van 
Nieukerken et al. (1990) or studied in glycerine. Photographs of genitalia were taken 
by the senior author with a Zeiss AxioCam digital camera attached to a Zeiss Axioskop 
H, using Carl Zeiss AxioVision 3.0.6 software. Drawings were prepared by the junior 
author. Morphological terms follow Van Nieukerken et al. (1990). The map was pre- 
pared with DMAP 7.0 (Morton 2000), UTM co-ordinates were taken from French 
topographical maps or calculated from the geographical co-ordinates. 



Subgenus Etainia Beirne 

A description of the subgenus and comments on its subgeneric position were provided 
earlier (Van Nieukerken 1986; Van Nieukerken & Johansson 1990). Puplesis & Diskus 
(1996) also listed the apomorphies and concluded that Etainia deserved full generic 
status on the basis of many apomorphies. Although we fully agree with the monophyly 
of Etainia and its long list of defining apomorphies, we consider that the rank of the 
taxon is only determined by its relative position in the cladogram. Van Nieukerken 
(1986) showed that Etainia most likely is the sister group of the clade Zimmermannia 
Hering + Ectoedemia Busck s. str. The other subgenera Fomoria Beirne and Laqueus 
Scoble branch off earlier in his cladogram. Hoare (1998) re-analysed VanNieukerken's 
cladogram with PAUP, and was able to confirm most clades. The monophyly of Etainia, 
Zimmermannia and Ectoedemia s. str. was even better supported, but no strong choice 
could be made between the two alternative topologies within this branch: {Ectoedemia 
{Etainia + Zimmermannia)) or {Etainia {Zimmermannia + Ectoedemia))', there was no 
support for the third alternative {Zimmermannia {Etainia + Ectoedemia)). With the 
present knowledge we prefer to keep Etainia as subgenus, since raising its rank imme- 
diately causes the need of raising most other subgenera as well. This will cause several 
tenths of name changes and new combinations, which will upset stability of nomencla- 
ture. Further work to refine the cladogram is much needed. 

Puplesis & Diskus (1996) consider the posterior process of the male genitalia to be 
an uncus. Since we do not see a hinging point with the genital capsule or gnathos, 
which normally separate the uncus, we regard this structure tentatively as a pseuduncus, 
as was suggested before (Van Nieukerken 1986). The lack of the real uncus is one of 
the apomorphies supporting the clade Etainia + Zimmermannia + Ectoedemia (see 
above). 

Diagnosis 

Etainia-species are easily recognized from other European Nepticulidae by the pres- 
ence of two non-metallic white fasciae or a antemedial fascia and an additional post- 



Nota lepid. 25 (2/3): 87-95 89 

medial costal and dorsal spot. Only Acalyptris platani (Müller-Rutz) has similar spots, 
but is overall much paler, and the male has conspicuous widened hindwings with raised 
white androconiae (Van Nieukerken & Johansson 1990). The valval apodeme in the 
male genitalia is unique and also the female genitalia are rather characteristic (see 
figures in Van Nieukerken & Johansson 1990; Lastûvka & Lastuvka 1997). 

Checklist of Western Palaearctic species 

Ectoedemia Busck, 1907 
Subgenus Etainia Beirne, 1 945 
Obrussa Braun, 1915 (preoccupied) 

1. E. (Et.) sericopeza (Zeller, 1839) (Poland) 

2. E. (Et.) louisella (Sircom, 1849) (Britain) 

sphendamni (Hering, 1937) (Denmark) 

3. E. (Et.) obtusa (Puplesis & Diskus, 1996) (Turkmenistan) 

4. E. (Et.) biarmata (Puplesis, 1994) comb. n. (Georgia) 

5. E. (Et.) decentella (Herrich-Schäffer, 1855) (Germany) 

monspessulanella (Jäckh, 1951) (Germany) 

6. E. (Et.) leptognathos (Puplesis & Diskus, 1996) comb. n. (Turkmenistan) 

7. E. (Et.) albibimaculella (Larsen, 1927) (Denmark) 

Key to males on external characters 

Note. E. biarmata from Abchazia in Georgia is not included, it is known from a single poorly pre- 
served male. It is externally very similar to E. obtusa, but has an additional valval process in the male 
genitalia (see Puplesis 1994). For other illustrations see the above mentioned books. 

1 . Forewing underside and hindwing upperside with conspicuous patch of black androcomal 

scales at base. Basal spot present 3. 

Black androconial scales absent. Basal spot present or absent 2. 

2. Forewing without basal spot, dark grey; thorax uniform dark-grey E. albibimaculella. 

Forewing with basal white spot; thorax posteriorly white (Fig. 1) /:. obtusa. 

3. Thorax white. Frontal tuft black or yellow to brown 4. 

Thorax black or fuscous. Frontal tuft yellow to ferrugineous E. sericopeza or /:. louisella. 

4. Frontal tuft black E. decentella. 

Frontal tuft yellow to brown. Forewing usually with white pattern more dominant 

E. leptognathos. 



Key to males on genitalia characters 

Illustrations in Van Nieukerken & Johansson ( 1990). Puplesis (1994) and I aStÛvka & I aStÛvka (1997). 
The genitalia of E. obtusa, E. leptognathos and E. decentella arc also illustrated here. 

1. Tegumen produced into pseuduncus, pointed or truncate 2. 

- Tegumen rounded and wide, not or hardly produced into pseuduncus ( I igs. 4. 5) 5. 



NiEUKERKEN & Lastüvka: Ectoedemia obtusa new for Europe 

Gnathos with broadly rounded central element. Valval tip broad and rounded 3. 

Gnathos with narrow pointed central element. Valval tip broad and rounded or pointed .... 4. 
Genital capsule about 550-650|um long. Tegumen very long and pointed. Transtilla with 

sublateral arms almost as long as transverse bar E. sericopeza. 

Genital capsule about 41 Oum long. Tegumen shorter, slightly truncate. Transtilla with sub- 
lateral arms approximately half length of transverse bar E. louisella. 

Valval tip triangular, pointed. Pseuduncus with relatively long point... E. albibimaculella. 
Valval tip broad and rounded. Pseuduncus relatively short and obtuse (Figs. 2, 3, 8) 

E. obtusa. 

Gnathos very broad, tegumen broadly rounded (Fig. 5) E. decentella. 

Gnathos rather narrow, tegumen slightly produced (Fig. 4) E. leptognathos. 



Key to females 

1. Thorax completely white 2. 

- Thorax brown or grey, at most with some white posteriorly and on tegulae 3. 

2. Frontal tuft black; signa very long, longest more than 500 um E. decentella. 

- Frontal tuft yellow to brown. Forewing usually with white pattern more dominant; signa 
considerably shorter, longest less than 500 urn E. leptognathos. 

3. Forewing without white spot at basis; thorax uniform dark-grey E. albibimaculella. 

- Forewing with white spot at basis; thorax with white scales on posterior tip; species only 
identifiable on genitalia 4. 

4. Tergite VIII with strong medial invagination of posterior margin; two difficult species, for 
differences see Van Nieukerken & Johansson (1990) E. sericopeza or E. louisella. 

- Tergite VIII with almost straight margin (Figs. 6, 7, 9) E. obtusa. 



Ectoedemia (Etainia) obtusa (Puplesis & Diskus) (Figs. 1-3, 6-10) 

Etainia obtusa Puplesis & Diskus, 1996: 46. Holotype S , Turkmenistan, W. Kopet Dagh, 40 km E. 
Garrygala [= Kara Kala], 800 m, [UTM 40S DH75] 26.V.1993, R. Puplesis & A. Diskus (VVPI) 
[examined]. 




Fig. 1. Ectoedemia {Etainia) obtusa. Male, Croatia, Istra. del. A. Lastüvka. 



Nota lepid. 25 (2/3): 87-95 



91 




Figs. 2-5. Male genitalia of Ectoedemia (Etainia\ ventral aspeet. 2, 3 - E. obtusa, slide FvN 3181 
(France, Les Mées). 4 - E. leptognathos, slide EvN 2920 (paratype, Turkmenistan). 5 - E. decentelia, 
slide VU 1297 (Netherlands, Overveen). Scales: 100 um. 



Ectoedemia obtusa (Puplesis & Diskus); Krcnek 2000: 36 [colour photograph] 

Ectoedemia (Etainia) sp.; Karsholt et al. 1995: 7, no 018.004.0; Leraut 1997: 82, no. 129 [listed] 



Material. Croatia: 22 d, 10 9, Istra, Labin [UTM 33T VK39], 4.iv. 1999, cocoon on Fraxinus ornus, 
emerged in iv, A. Lastûvka (coll. Lastûvka, Id RMNH), 1 ö\ Krk, Risika, 19.-25.V.2001, M. Petrû (coll. 



92 



NiEUKERKEN & Lastûvka: Ectoedemia obtusa new for Europe 




Figs. 6-7. Female genitalia of Ectoedemia (Etainia) obtusa, slide EvN 2830 (France, Les Mées): 6 - 
Abdominal terminal segments, dorsally, 7 - Bursa copulatrix with the largest signum in focus. Scales: 50 
i m (6), 200 i m (7). 



Petrù). -France: 26, 1 $, Alpes Hte Provence, Les Mées [UTM 31T GJ3879], 14.V.1989, G. R. Langohr 
(RMNH); la, Var, La Sainte Baume, Plan d'Aups [UTM 31T GJ2001L 5.vi.l991, R. Buvat; 26, Var, La 
Sainte Baume, Plan d'Aups, La Brasque [31T GJ1900], 21.vi.1991, R. Buvat (RMNH). - Italy: 16, 
Cuneo, Pezzolo v. Uzzone [UTM 32T MQ3531], 19.V.1970, reared from cocoon [host unknown], U. 
Parenti (coll. Parenti). - Spain: 1 5 , Aragon, prov. Teruel, Albarracin, [UTM 30T XK36], 23.vi.1992, A. 
Lastûvka (coll. Lastûvka). - Turkmenistan: holotype. 

Other material (not examined, data provided by R. Buvat). France: 1 6 , Bouches-du-Rhône, Auriol, 
Bois de la Lare, [UTM 31T GJ1704], 3.vi.l991, R. Buvat; 26, Var, La Sainte Baume, Plan d'Aups, 
[UTM 31T GJ2001], 16.vi.1995, R. Buvat (coll. Buvat). 

Diagnosis 

Males differ from E. sericopeza, louisella and decentella by the absence of black 
androconial scales on forewing underside and hindwing. E. albibimaculella is also 
missing these scales, but is overall paler brown, and lacks a basal spot on the forewing. 
E. biarmata is also externally very similar to obtusa. Females are very similar to 
sericopeza and louisella, only separable by differences in the terminal tergites. 



Description 

Male (Fig. 1). Forewing length 2.5-2.9 mm. Head with frontal tuft pale yellow to 
orange; collar similar. Antenna with ca. 5 1 segments (broken in most specimens); scape 
creamy white, flagellum dark brown. Thorax fuscous, posterior tip white, tegulae some- 
times with few white scales; forewing fuscous-black, with small basal white spot, a 
slightly constricted white fascia at 1/3 and a costal and dorsal spot at 2/3, sometimes 



Notalepid. 25(2/3): 87-95 



93 




Figs. 8-9. Genitalia of Ectoedemia (Etainia) obtusa, genitalia preparations AL (Croatia): 8 
female, del. A. Lastuvka. 



male, 9 



forming a second fascia; terminal cilia silvery white beyond more or less distinct cilia- 
line. Underside brown, without black androconial scales, but with a small band of 
yellow androconial scales in furrow under frenulum (often difficult to see). Hindwing 
grey, no trace of androconial scales. 

Female. Forewing length 2.6-3.1 mm, antenna with 51 segments. Otherwise as 
male. 

Male genitalia (Figs. 2, 3, 8). Capsule length 405-455 um (n=4), ca. 0.81- 
0.95 as wide as long; vinculum truncate anteriorly, fused with tegumen; tegumen forming 
pseuduncus with truncate tip with about 6-7 setae ventrally in one row. Gnathos with 
narrow, pointed central element. Valva length 1 75-223 urn, with broadly rounded tip; 
valval apodeme sinuous, pointed, about 230-260 urn long; transtilla with long trans- 
verse bar and short, but distinct ventrolateral arms. Aedeagus 325-370 urn long, with 
pair of ventral carinae, a pointed tip; vesica with 2 strong cornuti near phallotrema and 
an H-shaped circular sclerotization anteriorly near cathrema. 

Female genitalia (Figs. 6, 7, 9). T VII posteriorly with lateral rows of 1 1- 
14 setae on sclerotized plates, slightly excavated medially along anterior margin of T 
VIII; T VIII with almost straight anterior margin, ca 6-8 setae on either side: anal 
papillae with 23-27 setae Bursa total length 880 urn (n=l). Vestibulum with paired 
lobes, only slightly sclerotized. Ductus bursae with a group of spines, but occasionally 
poorly developed; corpus bursae without spines, with two obovate large reticulate signa. 
resp. measuring 302x 1 1 5 and 278x 138 urn. 

Biology. In 1999 cocoons were found by the junior author in Croatia on trunks 
oîFraxinus ornus L., in a small forest of about 60x 1 00 m, with a dominance of Fraxinus 
ornus. In total about 80 cocoons were collected from trunks in the whole area. The 



94 



NiEUKERKEN & Lastûvka: Ectoedemia obtusa new for Europe 



J j • / 


o <y* 


sr\V 




^ ( ~ ' 


< 


; r-> 1 




\ ^ 









Fig. 10. Distribution of Ectoedemia (Etainid) obtusa. 



nearest trees of Acer monspessulanum were growing at a distance of ca 40-50 m; on 
the isolated Acer and Fraxinus trees in the surroundings no cocoons were found. No 
signs of feeding were observed on the trees. In 2002 these trees unfortunately had been 
felled and in nearby localities trees of Fraxinus and Acer were mixed; here few co- 
coons were found on both tree species. Parenti also reared the specimen from Italy 
(Cuneo), but unfortunately his rearing notes have since been lost (U. Parenti in litt.). 
Puplesis & Diskus (1996) assumed Acer turcomanicum to be the host, basing on the 
host preference of several related species. On the same assumption, the senior author 
searched in vain for larvae in one of the French localities only amongst the various 
;4cer-species, unaware of the possibility of Fraxinus as host. Evaluating all the avail- 
able evidence, we consider Fraxinus ornus as the most likely host in Croatia, although 
the possibility that all larvae were transported prior to cocoon spinning from nearby 
Acer cannot be excluded totally. Fraxinus ornus is widespread in the Eastern Mediter- 
ranean region and southern Central Europe, but not native in France or Spain, although 
it has been planted there (Amaral Franco & Rocha Alfonso 1972). In France and Spain 
occur the more widespread F angustifolia Vahl and F excelsior L. We tentatively 
assume that E. obtusa feeds on several species of Fraxinus. Cocoons whitish to light 
purple, changing into greyish-brown after few days. Adults have been collected in May 
and June, cocoons were found in April. 

Distribution (Fig. 10). Southern Europe: Spain, France, Italy, Croatia and in 
Turkmenistan. To be expected elsewhere on the Balkan and in Turkey and Iran. 

Hostplant relationships. Fraxinus (family Oleaceae) - if indeed the 
host - is an interesting and unexpected addition to the hostplants of Nepticulidae. 
Previously only one species was recorded from this family: Ectoedemia (Fomorid) 
oleivora Vâri, feeding in Olea chrysophylla Lamk. (Vâri 1955; Scoble 1983); it is not 
closely related. Most species of Etainia, where the biology is known, feed on Acer 
species (Aceraceae or Sapindaceae in the system of Bremer et al. 1998). Only E. 
albibimaculella is known to feed on Ericaceae (Arctostaphylos). Oleaceae are not closely 
related to Aceraceae or Ericaceae, and most likely the feeding on Fraxinus constitutes 
a secondary hostshift. Since Acer is recorded as host in Europe, the Eastern Palaearctic 



Nota lepid. 25 (2/3): 87-95 95 

and the Nearctic region, it is very likely that it constitutes the plesiomorphic host of 
Etainia. 

Remarks. The new combination Ectoedemia obtusa was inadvertently published 
by Krenek (2000). 



Acknowledgements 

We thank the late R. Buvat (Marseille), Gerard Langohr (Simpelveld, The Netherlands), M. Petru (Praha) 
and Rimantas Puplesis for lending us their material and a gift of several specimens of E. obtusa and E. 
leptognathos respectively. 



References 

Amaral Franco, J. do & M. L. da Rocha Alfonso 1972. Fraxinus- In: T. G. Tutin, V. H. Heywood, N. A. 

Burgeset al. (eds.), Flora Europaea. - University Press, Cambridge. Pp. 53-54. 
Bremer, K., B. Bremer & M. Thulin 1998. Classification of flowering plants. Department of Systematic 

Botany, Uppsala University. - http://www.systbot.uu.se/classification/summary98.html. [Accessed 

03-02-2002.] 
Hoare, R. J. B. 1998. Systematics of Australian Nepticulid moths (Lepidoptera: Nepticulidae). - 

Unpublished thesis, Canberra, Australian National University. 248 pp. 
Karsholt, O., E. J. van Nieukerken, S. E. Whitebread & S. Zangheri 1995. Lepidoptera Zeugloptera, 

Dacnonypha, Exoporia, Monotrysia (=Micropterigoidea, Eriocranioidea, Hepialoidea, Nepticuloidea, 

Incurvarioidea, Tischerioidea). - Checkl.Spec.Faun.Ital. 80: 1-12. 
Krenek, V. 2000. Small moths of Europe. - Cesky Tesin. 174 pp. 
Lastuvka, A. & Z. Lastuvka 1997. Nepticulidae Mitteleuropas. Ein illustrierter Begleiter (Lepidoptera). 

- Konvoj, Brno. 229 pp. 
Leraut, P. 1997. Liste systématique et synonymique des Lépidoptères de France, Belgique et Corse 

(deuxième édition). - Supplement à Alexanor, Paris. 526 pp. 
Morton, A. 2000. DMAP for Windows. Version 7.0 e (32-bit). - Berkshire, UK. 
Nieukerken, E. J. van 1986. Systematics and phylogeny of Holarctic genera of Nepticulidae (Lepidoptera, 

Heteroneura: Monotrysia). - Zool.Verh. 236: 1-93. 
Nieukerken, E. J. van, E.S. Nielsen, R. Johansson & B. Gustafsson 1 990. Introduction to the Nepticulidae. 

-In: R. Johansson, E. S. Nielsen, E. J. van Nieukerken & B. Gustafsson (eds.), The Nepticulidae and 

Opostegidae (Lepidoptera) of NW Europe. Fauna Entomologica Scandinavica 23. Brill, Leiden. Pp. 

11-109. 
Nieukerken, E. J. van & R. Johansson 1990. Tribus Trifurculini- In: R. Johansson, E. S. Nielsen, E.J. 

van Nieukerken & B. Gustafsson (eds.), The Nepticulidae and Opostegidae (Lepidoptera) of NW 

Europe. Fauna Entomologica Scandinavica 23. Brill, Leiden. Pp. 239-321. 
Puplesis, R. 1994. The Nepticulidae of eastern Europe and Asia. Western, central and eastern parts. 

Backhuys Publishers, Leiden. 290 pp. 
Puplesis, R. & A. Diskus 1 996. First record of the genus Etainia Beirne from Central Asia with descriptions 

of two new species and some provisional notes on the world fauna (Lepidoptera: Nepticulidae). - 

Phegea 24(1): 41-48. 
Scoble, M. J. 1983. A revised cladistic classification of the Nepticulidae (Lepidoptera) with descriptions 

of new taxa mainly from South Africa. - Transv.Mus.Monogr. 2: 1-105. 
Vâri, L. 1955. South African Lepidoptera I. Descriptions of new leafmining Tineina. - Ann.Transv.Mus. 

22(3): 331-351. 



96 



Kozlow: Short Communication 



Short Communication 

First record of Nemophora lapikella Kozlov (Adelidae) from Japan 

During the past years, considerable progress was achieved in investigation of the moth family 
Adelidae in Japan, mainly due to the intensive work by Hirowatari (1995, 1998, 2000). To 
date, 22 species of the genus Nemophora Hoffmansegg have been recorded from Japan 
(Hirowatari, 1998); the latest nomenclatural changes and additions to the taxonomic treatment 
of Adelidae in the famous book 'Moths of Japan' (Moriuti 1982) were recently summarized by 
Sugi (2000). 

Although the faunistic lists of Adelidae from the Russian Far East (Kozlov 1997b) and 
Japan (Hirowatari 1998) do not show complete correspondence, the number of common spe- 
cies is rather high. Therefore absence of N. lapikella Kozlov, 1997, in Japan was rather confus- 
ing, because this species is distributed from the Russian Primorye to Taiwan, and is abundant 
in all parts of the distribution range (Kozlov 1997a). 

Recent investigation of thé materials kept in Taiwan Forest Research Institute (Taipei) re- 
vealed that N. lapikella is indeed present in Japan, at least in Oita Prefecture of Kyushu: two 
specimens (male and female) labelled 'Japan: Kyushy, Kurodake, 8.7.1937, S. Issiki' with 
certainty belong to this species. I suspect that many more specimens of N. lapikella can be 
discovered by careful examination of specimens determined as N. staudingerella (Christoph, 
1881). Although it is possible to distinguish well-preserved specimens of TV. lapikella from 
other species by external characters (such as the abrupt change of male antennal color from 
cupreous brown to light silver- white at the level of forewing fascia), reliable identification is 
only possible on the basis of male genitalia (figured by Kozlov 1997a, b). In particular, N. 
lapikella differs from N. staudingerella by longer vinculum (2.6-2.8 * length of valva) and 
smooth right wall of aedeagus (spinosae in N. staudingerella). 

One more species of the same species-group, N. chalybeella (Bremer, 1884), so far re- 
ported from the Russian Far East and Korea (Kozlov, 1997b), can also be discovered from 
Japan. In this species the left carinae on male aedeagus is corkscrew-shaped apically, whereas 
in both TV. staudingerella and N. lapikella carinae on the ventral wall of aedeagus are sym- 
metrical. 

Acknowledgements 

I am very much indebted to Toshiya Hirowatari for his continuous help and valuable information on Japanese Adelidae. 
I gratefully acknowledge financial support from the Academy of Finland for the exchange visit to Taiwan Forest 
Research Institute (Taipei) and thank Jung-Tai Chao and Shen-Horn Yen for their help. 

References 

Hirowatari, T. 1995. Taxonomic notes on Nemophora bifasciatella Issiki, with descriptions of its two new allied species 

from Japan and the Russian Far East (Lepidoptera, Adelidae). - Jpn.J.Ent. 63: 95-105. 
Hirowatari, T. 1998. Recent studies on the family Adelidae of Japan. -Nature Insects 33 (11): 27-29 [in Japanese]. 
Hirowatari, T 2000. Biological notes on some Japanese species of the family Adelidae (Lepidoptera). - Yadoriga 

186: 26-29 [In Japanese]. 
Kozlov, M. V. 1997a. Nemophora lapikella sp. n., a new fairy moth species (Adelidae) from South-Eastern Asia. -Nota 

lepid. 20: 39^14. 
Kozlov, M. V. 1997b. Family Adelidae. Pp. 374-289.-7«: V. S. Kononenko (ed.), Key to the Insects of Russian Far East. 

Vol. V. Trichoptera and Lepidoptera, pt. 1. - Dalnauka, Vladivostok [in Russian]. 
Moriuti, S. 1982. Incurvariidae. Pp. 51-56, pi. 1. -In: Inoue, H., Sugi, S., Kuroko, H., Moriuti, S. & Kawabe, A. 

(eds.), Moths of Japan, Vols. 1 & 2. - Kodansha, Tokyo [in Japanese]. 
Sugi, S. 2000. 'Post-MJ', Edn 2. Additions of species and changes in names of Japanese moths. - Japan Heterocerists' 

Society, Tokyo, xii + 171 p. 

Mikhail V. Kozlov 



Notalepid. 25 (2/3): 97-107 97 

Elachista nolckeni Sulcs, 1992: morphology and bionomics of 
immature stages (Gelechioidea: Elachistidae) 

Tomasz Baran 

Rzeszöw University, Institute of Biology and Environmental Protection, Rejtana 16C, 35-310 Rzeszöw, 

Poland 
e-mail: tbaran@univ.rzeszow.pl 

Summary. The previously unknown life history and morphology of early life stages of Elachista nolckeni 
Sulcs, 1992 are described. The last instar larva, pupa and mines of the species are illustrated for the first 
time. A redescription of the imago is also given. The caterpillars make Phyllonorycter-Wkt mines in the 
leaf blades of Phleum phleoides (L.) Karst. Pupation takes place on the ground. The adults fly in one 
generation from mid-May to the beginning of July. The species inhabits open, xerothermic habitats. 

Key words. Gelechioidea, Elachistidae, Elachista nolckeni, morphology, bionomics. 

Introduction 

Elachista nolckeni was described comparatively recently on the basis of specimens 
from Latvia, Poland and Estonia (Sulcs 1992). Except for these countries, the species 
has also been recorded from Austria (Sulcs, op. cit.), the Czech Republic (Liska 1998) 
and Germany (Gaedike & Heinicke 1999). In Poland it is known only from a few 
places located in the central and eastern parts of the country: the Zbocza Plutowskie 
Reserve (UTM: CE 20) (leg. T. Baran), Toruri (UTM: CD 37) (Sulcs, op. cit.), the 
Biebrzariski National Park (Göra Perewida, UTM: FE 24) (Buszko 1 996) and the Skarpa 
Dobrska Reserve (UTM: EB 68) (Buszko et al. 1996). 

So far nothing was known about the immature stages of this elachistid moth. Three 
years of field research enabled the author to elaborate the food-plant and habitat pref- 
erences as well as the morphology of the preimaginal stages. Below the adults are also 
redescribed. 

Material and methods 

The study was carried out in 1998-2000. During that period 25 larvae, 12 pupae and 
40 moths were examined. The material was collected in two reserves of xerothermic 
vegetation - the Skarpa Dobrska Reserve and the Zbocza Plutowskie Reserve. The 
first reserve comprises xerothermophilous plant communities growing on loess soil 
(Fig. 1 ); dominant plant species are: Anthyllis vulneraria L., Artemisia campestris L., 
Brachypodium pinnatum (L.) PB., Coronilla varia L., Festuca sulcata (Hack.) Nym., 
Helichrysum arenarium (L.) Moench, Inula ensifolia L., Juniperus communis L., Phleum 
phleoides (L.) Karsten, Salvia pratensis L., and Silène otites (L.) Wib. 

The second site is formed by sunny and dry slopes of the Wisla valley (Fig. 2); the 
area is rich in many species of xerothermic and steppe vegetation, such as Adonis 
vernalis L., Anemone silvestris L., Brachypodium pinnatum (L.) P.B., Hieracium 
echioides Lumnitzer, Medicago minima (L.) Grufb., Salvia pratensis F., Stipa capillata 
L. and Stipa joannis Cel. 

© Nota lepidopterologica. 15.1 1.2002, ISSN 0342-7536 



98 



Baran: Immature stages of Elachista nolckeni 



Terminology of structures in male and female genitalia follows Traugott-Olsen & 
Nielsen (1977) and Kaila (1997, 1999), whereas the terminology relating to morphol- 
ogy of the larva and pupa is according to Hinton (1946), Hasenfuss (1980) and Patocka 
(1999). Chaetotaxy was studied after maceration of larvae in 10% KOH. 




Figs. 1-2. The habitats of Elachista nolckeni in Poland: 1 
Plutowskie Reserve. 



the Skarpa Dobrska Resrve; 2 - the Zbocza 



Notalepid. 25 (2/3): 97-107 



99 



Results 

Description of stages 

Larva - last instar (Figs. 3-5). Body length 5.5-6 mm (n = 20). Head yellowish 
brown; ocellar areas blackish. Dorsal prothoracic shield well sclerotized, especially in 
posterior parts; it consists of a pair of elongate plates, enlarged posteriorly, with ir- 
regular margins. Ventral prothoracic shield weakly sclerotized in median part, variable 
in shape, but more or less X-shaped. Anal shield sclerotized, triangular, with rounded 
apex. All sclerites yellowish brown, but dorsal prothoracic plates darker posteriorly. 
Body of the larva somewhat tapered towards the last segment (2nd and 3rd thoracic 
segments broadest), from pale yellowish green to olive green; prothorax more yellow- 
ish than other segments. 

Chaetotaxy (Figs. 6-10). Thorax, Tl . - On prothoracic shield, 2 pores (a, b), 
Dl seta and proprioreceptor MXD1. XD1 and D2 close to lateral margin of the shield 
(D2 ventral to XD1). SD1 ventral to XD2 and SD2, closer to the latter. L group trisetose, 
LI ventral to L2 and L3. SV group unisetose. MV2 and MV3 (not proprioreceptors) 
almost in vertical line. VI ventral and somewhat anterior to the leg. T2-3. - Dl some- 
what dorsal to D2. SD2 dorsal to SDL L group trisetose, LI ventral to the others. SD2, 
SD1 and LI almost in vertical line. SV group unisetose. On these segments, there are 
proprioreceptors: MD1, MSD1, MSD2, MV1 and MV3 (MV2 absent). Abdomen, AI. 



i 




Figs. 3-5. The mature larva of Elachista nölckeni'. 3 - dorsal 
view of the mature larva; 4 - dorsal prothoracic shield; 5 - ven- 
tral prothoracic shield. 



100 



Baran: Immature stages of Elachista nolckeni 



CxD\/-* Dl D2^\ 




TM / 




D2 


V^MXDl 




D2 






\ SD V 

XD2 ^ 


MD1 


SD2 


MD1 


Dl 


SD1 / 




/ 


SD2 


"SDl 


L2 / L3 
LI 


MSD1 


SD1 









/ 
MSD2 L2 


/ ' 
/ L3 
LI 




Ll 


*SV1 










MV2/ / ( j 








L3 


ç--~, \J .... 
k ...X . 

MV3-^ ^ 


MV1 
MV3 


SV1 



-vi 


MV3 


SV3 l/ SVl 

'vi 


1 






I 



2-3 



/• 


' 


/ 

' o 


/ 
o 


/ 


•" 


y 


SV3 X ^SVl 

,SV2 X 


/ 


MV3 



ni-vi 



Fig. 6. Setal map (last instar): 1-3 - thoracic segments; I- VI - abdominal segments. 



- Dl widely separated ventrally from D2. SD1 dorsal and posterior to spiracle. SD2 
anterior and ventral to SD1. L group bisetose, L3 (very small seta) ventral to LI. SV 
group bisetose, but SV3 often absent. VI ventral to SV setae. On the segment, 
proprioreceptors MD1 and MV3 occur. AIL -Arrangement of the setae similar to the 
previous segment, but MD1 more remote from Dl, and SD1 closer to spiracle. AIII- 
VI. -Arrangement of MD1, D, SD and L groups as on 2nd abdominal segment. SV 
group trisetose, SV3 ventral and anterior to SV1, between SV1 and SV2. VI some- 
what posterior and ventral to SV2. MV3 anterior and ventral to VI. AVIL - Arrange- 
ment of MD1, D, SD and L setae similar to previous segments. SV group unisetose. VI 



Notalepid. 25 (2/3): 97-107 



101 



■^ 


-^ 


D2 




y 

o 


MD1 j 

SDP 

/ 

LI 





/ 




/ 


, 


/ 

SV1 


/ 

SV1 


/ 

/ 


MV3. 
VI 


IX 


VIII 





vn 



7 



SD1 





■^f AVI 



AV4 #^ 



8 



AVa 



10 



Figs. 7-10. Setal maps (last instar): 7 - abdominal segments VII-IX; 8 - abdominal segment X (dorsal 
view); 9 - abdominal segment X (lateral view); 10 - anal proleg. 



ventral and slightly anterior to SV1 . MV3 anterior and between SV1 and VI . AV1II. - 
The general arrangement of the setae similar to the 7th abdominal segment. AIX. - 5 
'long' setae (D2, SD1, LI, SV1, VI) and 2 proprioreceptors (MD1, MV3). D2 and 
SD1 in vertical line. LI ventral and somewhat anterior to SDL SV1 remote ventral ly 
from L seta. VI ventral and slightly anterior to SV1. AX. - On the sclerotized anal 
plate, there is D2 only; Dl and SD1 ventral to the plate (D3 absent). AL group with 5 
setae and 1 pore (ALa on line joining AL 1 and AL3). AV 1 and AV4 more caudally and 
more remote from each other than AV2 and AV3. AVa anterior to and between AV2 and 
AV3. 

Pupa (Figs. 1 1-12). Length of pupa: 3.7-4.1 mm (n = 10); yellow-brown. Vertex 
slightly protruding over frons, with shallow incision. Labrum triangular caudally. Pro- 



102 



Baran: Immature stages of Elachista nolckeni 



boscis extended to about one third of 
forewing length. Antenna with protru- 
sions, extended to apex of forewing. Mid 
leg extended to about a half of forewing 
length, and fore leg somewhat shorter. 
Forewing extended to posterior margin of 
6th abdominal segment or ended slightly 
before; veins raised. Dorsal and lateral 
ridges prominent; the dorsal one runs from 
vertex to posterior margin of 8th abdomi- 
nal segment, and the lateral ones run from 
posterior margin of 1st abdominal seg- 
ment to posterior margin of 8th one. On 
ventral side of 6th, 7th and 8th segments 
there are also weak ridges. On each side 
of the mesonotum there is a pair of addi- 
tional ridges. Lateral parts of mesonotum 
with raised nodules. Abdominal spiracles 
visible on lateral ridges. 

Adult male (Fig. 13). Wingspan 

9-10.5 mm (n = 15). Head and neck tuft 

white; labial palpus white, underside usually suffused with grey or ochreous-orange; 

scape of white, sometimes with ochreous-orange scales, flagellum brownish, annu- 

lated with whitish. Thorax and tegula white, often with a few ochreous-orange or black- 




Figs. 11-12. The pupa of Elachista nolckeni: 11 

ventral view; 12 - lateral view. 




Fig. 13. Elachista nolckeni, adult male. 



Notalepid. 25 (2/3): 97-107 103 

ish-brown tipped scales. Forewing white, strongly mottled with ochreous-orange; ba- 
sal part of costa dark grey-brown; white markings consisting of slightly outward bent 
fascia before middle, costal and tornal spots (costal spot distinctly beyond tornal one; 
sometimes spots form a zigzag outer fascia), basal spot (often connected with inner 
fascia) and usually weakly indicated narrow terminal streak. Many blackish-brown 
tipped scales scattered over forewing, especially in fold between basal spot and inner 
fascia, between inner fascia and outer spots as well as in tornal part; scales in dorsal 
half between inner fascia and tornal spot bigger than others and slightly raised (groups 
of such scales form small dots on the wing). Cilia between tornus and apex whitish 
tinged ochreous with grey-brown tips; cilia on dorsum whitish. Ciliary line distinct, 
blackish-brown. Hindwing grey-brownish. Costal cilia coloured as hindwing, dorsal 
cilia whitish-orange, tinged light grey-brown mainly in basal half. Abdomen grey- 
brown dorsally with pale grey and whitish scales on posterior margins of segments; 
ventrally grey-brown, strongly covered with whitish and ochreous- white scales. Anal 
tuft greyish-brown from dorsal view, and whitish ventrally. 

Female similar to male but usually smaller (wing span: 8-9.5 mm [n = 10]); 
antenna more clearly ringed; dark grey-brown suffusion at costa less distinct or invis- 
ible; anal tuft entirely whitish. 

Male genitalia (Figs. 14-17). Uncus deeply indented; uncus lobes triangu- 
lar, narrow and tapering, with a few minute setae distally. Gnathos elongate, rounded 
apically. Sacculus of valva almost straight, joining cucullus without angle. Costa con- 
vex at about the middle. Juxta lobes triangular with rounded ends and prominent lat- 
eral processes; apical parts of the lobes with a few short setae. Digitate processes 
tongue-shaped, short and setose apically. Median plate of juxta well sclerotized, more 
or less round, with a deep concavity. Vinculum without saccus, rounded. Aedeagus 
rather short and thick, distinctly broadened beyond the middle; distal end usually fun- 
nel-shaped; vesica with one boomerang-like or tooth-like cornutus. 

Female genitalia (Fig. 1 8). Papillae anales of moderate -length, covered 
with setae (the longest ones basally). Apophyses rather slender; posterior pair from 
1 .5 to 2 times longer than anterior one. Tergum 8 well sclerotized, anterior and pos- 
terior margins deeply concave. Sternum 8 sclerotized (more in anterior part) with 
more or less round ostium bursae in anterior half; lateral margins concave and ante- 
rior margin forming a semi-ring. Colliculum short as a longitudinal, lateral foldings. 
Ductus bursae rather long, membranous, covered with very minute spines at 3/4 of 
its lenght and the remaining 1/3 smooth and slightly broader than madian part. Duc- 
tus seminalis situated near to colliculum. Corpus bursae oval, with three patches of 
minute spines. 



Life history 

Eggs are laid at the basal part of a leaf 'of Phleum phleoides (L.) Karsten, in the middle 
or near a margin of the blade. Initially the larva mines in a narrow gallery (Stigmella- 
like), towards the leaf-tip; than it turns at or near the tip and mines downwards making 
a pale greenish Phyllonorycter-Uke blister, 4.5-6 mm in length (n = 12) (Fig. 19). The 



104 



Baran: Immature stages of Elachista nolckeni 






16 





18 



Figs. 14-18. Male genitalia of Elachista nolckeni: 14 - complex of valvae- vinculum; 15 - complex of 
tegumen-uncus-gnathos; 16 - complex of juxta lobes-digitate processes-median plate; 17 - aedeagus - 
examples; 18 - Female genitalia of Elachista nolckeni. 



proximal part of the blotch is rounded, irregular or divided usually into two short parts 
(galleries). The blister mine occupies an apical part or (rarely) a central one of the leaf. 
The frass is concentrated in the distal part of the mine. Because of the colour and 
twisted margins of the blade, the mine is relatively difficult to detect. During develop- 
ment (in captivity), the larvae sometimes change leaves. Pupation takes place on the 



Notalepid. 25 (2/3): 97-107 



105 




Fig. 19. Mines of the larvae of Elachista nolckeni on Phleum phleoides - examples. 

ground; in the breeding containers on the bottom among leaf litter. The pupa is an- 
chored to the substrate by a terminal segment and a silken girdle. In the laboratory, the 
pupal stage lasts 13-15 days. The larvae start feeding about mid-April and occur until 
the second half of May. Mines with mature larvae were found in large numbers in early 
May. Adults are univoltine and fly from the middle of May to the beginning of July, 
most abundantly in the first half of June. The moths may easily be found resting on 
leaves of various grasses or flying over plants during the day. The species occurs lo- 
cally in sunny, rather open places of xerothermic grasslands. In the studied sites, 
Elachista nolckeni was observed in the same places where Elachista subocellea 
(Stephens, 1834) occurs. The latter appears usually later, but especially in June both 
species may fly together. 



Discussion 

Because little information on detailed morphology of immature stages (especially of 
the larvae) of Elachistidae has been published so far, it is difficult to draw general 
conclusions of phylogenetic importance. Nevertheless, some of the presented results 



106 



Baran: Immature stages of Elachista nolckeni 



are of interest. Dl on abdominal segments 1-8 is placed distinctly ventrally to D2. 
This feature may be a synapomorphy for the group of species closely related with E. 
nolckeni, because the character state 'Dl more or less dorsal to D2' is a widespread 
condition in Elachistidae (T. Baran, unpublished) as well as in Gelechioidea and is 
therefore inferred to be plesiomorphic. Traugott-Olsen and Nielsen (1977) suggested 
that the absence of one SD seta (SD2) on abdominal segments may be a generic char- 
acter defining Elachista. E. nolckeni possesses two setae from the SD group (on ab- 
dominal segment 1-8), but SD2 is apparently far away from SD1 as compared with 
most Gelechioidea. So, if this condition is found in other elachistid species, it may turn 
out to be a synapomorphy for the family. Traugott-Olsen and Nielsen (1977) also stated 
thatis. apicipunctella Stainton, 1849 has no proprioreceptors. In the larva of E. nolckeni 
almost all known Ditrysian proprioreceptors were found. According to Hodges (1999) 
the occurrence of only one seta of the SV group on AI characterises Elachistidae s. str. 
However, results in the present paper reveal that SV3 on this segment may occur, 
although in E. nolckeni the seta sometimes disappears. Moreover, the position of setae 
from abdominal L group may have some significance in phylogeny. Here, these L 
setae have been designated as LI and L3 (the seta situated more ventrally), so L2 is 
absent. Still, it must be stressed that the homology of L setae in Elachistidae is uncer- 
tain. Hitherto only full-grown larvae have been studied and the decision which seta 
really is L3 (a subprimary seta), needs research of earlier instars. According to Minet 
(1991), the occurrence of LI and L2 on the same pinnaculum, or closely approximated 
ones, is plesiomorphic within Gelechioidea. 

With respect to wing pattern and morphology of genitalia, Elachista nolckeni is 
most similar to two other central European species of Elachistidae, viz. E. subocellea 
(Stephens, 1834) and E. collitella (Duponchel, 1843). However, it is comparatively 
easily distinguished from these species even without genitalia examination; the shift- 
ing of the costal spot towards the wing apex, in relation to tornal spot, is distinctive 
(Fig. 13). In the male genitalia the shape of the aedeagus and juxta lobes separates 
males of this moth from other species. In the female genitalia the presence of three 
patches of spines on the corpus bursae as well as the shape of sternum 8 are diagnos- 
tic. 

At the beginning of the 20th century, Toll described Elachista subcollutella on 
the basis of one specimen collected in the Ukraine (Toll 1936). This elachistid was 
later synonymised with Elachista subocellea by Traugott-Olsen & Nielsen (1977). 
E. subocellea is closely related with E. nolckeni. So, there was a possibility of 
misidentifîcation, especially because E. nolckeni was described later. Since the 
holotype of E. subcollutella is probably lost (it is missing in Toll's collection pre- 
served at the PAN, Krakow), a detailed comparison was impossible. Nevertheless, 
comparing the drawing of the E. subcollutella forewing (Toll 1936) with recent ma- 
terial of E. nolckeni and E. subocellea confirms the synonymy suggested by Traugott- 
Olsen & Nielsen (1977). E. subcollutella differs from E. nolckeni in having a trans- 
verse outer fascia. Such a fascia is typical in E. subocellea. Thus, there is no doubt 
that the elachistid described by Toll is conspecific with E. subocellea, while E. 
nolckeni is a good species. 



Notalepid. 25 (2/3): 97-107 107 

Acknowledgements 

I would like to thank Prof. Jaroslaw Buszko (Toruri, Poland) for taking the photograph of the adult. I 
am also sincerely grateful to Dr. L. Kaila (Helsinki, Finland) for critical comments on the manuscript, 
and to Prof. J. Razowski for permission to study the material of the PAN (Krakow, Poland). 



References 

Buszko, J. 1996. On the occurrence of Elachista nolckeni Sulcs (Lepidoptera, Elachistidae) in Poland. - 

Wiad. Ent. 15(1): 59. 
Buszko, J., J. Junnilainen, J. P. Kaitila, J. Nowacki, K. Nupponen & K. Palka 1996. New and rare to the 

Polish fauna species of Lepidoptera recorded in south-eastern Poland. - Wiad. Ent. 15(2): 105-115. 
Gaedike, R. & W. Heinicke (eds.) 1999. Verzeichnis der Schmetterlinge Deutschlands (Entomofauna 

Germanica 3). - Ent.Nachr.Ber. Dresden Beiheft 5: 1-216. 
Hasenfuss, I. 1980. Die Präimaginalstadien von Thyris fenestrella Scopoli (Thyrididae, Lepidoptera). - 

Bonn. zool. Beitr. 31: 168-190. 
Hinton, H. R. 1946. On the homology and nomenclature of the setae of lepidopterous larvae with some 

notes on the phylogeny of the Lepidoptera. - Trans.ent.Soc.Lond. 97: 1-35. 
Hodges, R. W. 1999. Gelechioidea. -In: Kristensen, N. P. (ed.), Handbook of Zoology IV, 35. Lepidoptera, 

moths and butterflies 1. - W. de Gruyter, Berlin, New York. Pp. 131-158. 
Kaila, L. 1997. A revision of the Nearctic species of Elachista s. 1. II. The argentella group (Lepidoptera, 

Elachistidae). -Acta Zool.Fenn. 206: 1-93. 
Kaila, L. 1999. Phylogeny and classification of the Elachistidae s. s (Lepidoptera: Gelechioidea). - 

Syst.Ent. 24: 139-169. 
Liska, J. 1998. Elachistidae. -In: Lastûvka, Z. (ed.), Checklist of Lepidoptera of the Czech and Slovak 

Republics (Lepidoptera). - Konvoj, Brno. p. 28-30. 
Minet, J. 1991 . Tentative reconstruction of the ditrysian phylogeny (Lepidoptera: Glossata). - Ent.Scand. 

22: 69-95. 
Patocka, J. 1999. Die Puppen der mitteleuropäischen Elachistidae (Lepidoptera, Gelechioidea). - 

Bonn.zool.Beitr. 48: 283-312. 
Sulcs, I. 1992. Elachista nolckeni sp. n. aus Lettland (Lepidoptera, Elachistidae). - Ent.Fenn. 3: 105- 

108. 
Toll, S. 1936. Untersuchung der Genitalien bei Pyrausta purpuralis L. und P. ostrinalis Hb., nebst Be- 
schreibung 11 neuer Microlepidopteren-Arten. - Annls. Mus. zool. Pol. 11(24): 403-413, 3 pis. 
Traugott-Olsen, E. & E. Schmidt Nielsen 1977. The Elachistidae of Fennoscandia and Denmark. - Fau- 
na ent.Scand. 6: 1-299. 



108 



Book review 



Book Review 

Nancy L. Jacobson & Susan J. Weller. A cladistic study of the Arctiidae (Lepidop- 
tera) by using characters of immatures and adults. 98 pp. Thomas Say Publications in 
Entomology: Monographs. Published by the Entomological Society of America. Price: 
members US$ 35.00, non-members: US$ 43.75. ISBN 0-9385-2294-9. 

Phylogenies of organisms are essential not only for understanding the systematic rela- 
tionships within a group, but also as a necessary template for the study of the evolution 
of behavioural, ecological or physiological characters. Due to their aesthetic appeal 
the Arctiidae have long attracted broad interest among lepidopterists. Moreover, they 
frequently serve as model organisms for the study of chemical ecology, behavioural 
physiology or mimicry. Thus, a better understanding of their phylogeny is in urgent 
need. Historically, the higher classification of arctiid moths has undergone manifold 
changes, and uncertainties persist. Today most approaches to resolve phylogenetic 
relationships resort to molecular markers - which are expensive to study and notori- 
ously difficult to obtain from older collection materials. In the present booklet, for the 
first time an attempt is made to rigorously infer the phylogeny of the Arctiidae using 
cladistic methods, but using more 'classical' morphological characters. By combining 
66 characters of larvae, pupae and adults sampled over 40 arctiid and 8 outgroup spe- 
cies, the authors provide a series of cladograms using maximum parsimony methods. 
Three monophyletic subfamilies can be recognized {viz. Lithosiinae, Syntominae and 
Arctiinae). Other well-known groups need to be redefined to attain the status of mono- 
phyletic groups, while again others emerge as clearly polyphyletic. All characters used 
and their scorings are extensively documented in photographs and drawings. Simi- 
larly, all data matrices and relevant trees for subgroups are presented, which makes the 
study a most valuable source also for further analyses. The appearance of the numer- 
ous scanning electron micrographs could have been improved through printing on a 
high-quality glossy paper. Also not all line drawings are of the highest quality, yet they 
suffice to show the relevant information. In view of the large diversity of the Arctiidae 
this booklet is just a step towards elucidating the phylogenetic history. A more com- 
plete taxon- sampling (in particular with regard to early stages) will result in better 
resolution. The price of the booklet seems to be high for a slender volume printed and 
bound in a rather modest way. Nevertheless, for the time being I clearly recommend 
this booklet to all those interested in Arctiidae phylogeny and evolution. It is also 
reassuring to see that a combined usage of morphological characters from adults and 
immatures still can contribute a lot to phylogenetics. Thus, the booklet by Jacobson 
and Weller hopefully stimulates further such studies in under-explored Lepidopteran 
taxa - molecular systematics is not always the single best choice in the 21 st century. 

Konrad Fiedler 



Nota lepid. 25 (2/3): 109-15 1 1 09 

A review of the genus Acompsia Hübner, 1825, with description 
of new species (Gelechiidae) 

Peter Huemer* & Ole Karsholt** 

* Tiroler Landesmuseum Ferdinandeum, Naturwissenschaftliche Sammlungen, Feldstraße lia, A- 

6020 Innsbruck, Austria. E-mail: p.huemer@tiroler-landesmuseum.at 
** Zoologisk Museum, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen, 

Denmark. E-mail: Okarsholt@zmuc.ku.dk 



Abstract. The Palaearctic genus Acompsia is revised and two subgenera are considered: Acompsia Hübner, 
1825 and Telephila Meyrick, 1923. Altogether 17 species are dealt with in detail and genitalia and adults 
are figured. 7 new species are described: Acompsia (A.) pyrenaella sp. n. (Spain: Pyrenees), A. (A.) 
ponomarenkoae sp. n. (Albania, Greece), A. (A.) schepleri sp. n. (Turkey), A. (A.) fibigeri sp. n. (Turkey), 
A. (A.) bidzilyai sp. n. (Russia: Transbaikalia), A. (A.) caucasella sp. n. (Russia: Caucasus) and A. (T.) 
syriella sp. n. (Syria). Lectotypes for A. maculosella (Stainton, 1851), A. dimorpha Petry, 1904 and A. 
minorella (Rebel, 1899) and a neotype for A thpunctella ([Denis & Schiffermüller], 1775) are designated. 

Zusammenfassung. Die paläarktische Gattung Acompsia wird revidiert und zwei Untergattungen wer- 
den berücksichtigt: Acompsia Hübner, 1825 and Telephila Meyrick, 1923. Insgesamt 17 Arten werden 
detailliert behandelt und Genitalien sowie Adulte abgebildet. 7 neue Arten werden beschrieben: Acompsia 
(A.) pyrenaella sp. n. (Spanien: Pyrenäen), A. (A.) ponomarenkoae sp. n. (Albanien, Griechenland), A. 
(A.) schepleri sp. n. (Turkey), A. (A.) fibigeri sp. n. (Türkei), A. (A.) bidzilyai sp. n. (Russland: 
Transbaikalien), A. (A.) caucasella sp. n. (Russland: Kaukasus) und A. (T.) syriella sp. n. (Syrien). 
Lectotypen fur A maculosella (Stainton, 1851), A. dimorpha Petry, 1904 and A minorella (Rebel, 1899) 
sowie ein Neotypus für A. tripunctella ([Denis & Schiffermüller], 1775) werden designiert. 

Key words. Lepidoptera, Gelechiidae, Acompsia, revision, new species. 



Acompsia is a genus of 17 species of gelechiid moths whose members are mainly 
distributed in montane areas of Europe. The definition of the genus is somewhat dis- 
puted and pending on authors includes or excludes taxa of Telephila Meyrick, 1923 
(see below). However, the taxonomy of species was regarded as well known until very 
recently. The discovery of a new species in the Italian Alps (Huemer 1998) revealed a 
number of additional taxonomic problems within the genus. Specimens hitherto as- 
signed to A. tripunctella frequently proved misidentified and sometimes turned out to 
belong to undescribed taxa. Consequently a review of the genus appeared necessary. 

Abbreviations of museums and private collections: 

BLDZ - coll. G. Baldizzone, Asti, Italy; BUSZ - coll. J. Buszko, Toruh, Poland; BMNH - The Natural 
History Museum, London, UK; DEI - Deutsches Entomologisches Institut im ZALF e. V., Eberswalde, 
Germany; GRÜN - coli. T. Grünewald, Landshut, Germany; HEND - coli. H. Hendriksen, Farevejle, 
Denmark; MNG - Museum der Natur, Gotha, Germany; NHMW - Naturhistorisches Museum, Vienna. 
Austria; TLMF - Tiroler Landesmuscum Ferdinandeum, Innsbruck, Austria; ZMKU Zoological Mu- 
seum. University of Kiev, Ukraine; ZMUC Zoologisk Museum, University of Copenhagen. Denmark; 
ZMUH - Zoological Museum, University of Helsinki, Finland; ZSM Zoologisehe Staatssammlung, 
Munich, Germany. 



© Nota lepidopterologica. 15.1 1.2002. ISSN 0342-7536 



*■ *■" Huemer & Karsholt: The genus Acom psia 

Check-list of Acompsia 

Acompsia Hübner, 1825 

Subgenus Acompsia Hübner, 1825 

A.(A.) cinerella (Clerck, 1759) 

A. (A.) pyrenaella sp. n. 

A.{A.) antirrhinella (Millière, 1866) 

A.{A.) maculosella (Stainton, 1851) 

A.(A.) dimorpha Petry, 1904 

A. {A.) subpunctella Svensson, 1966 

A.{A.) delmastroella Huemer, 1998 

A.(A.) muellerrutzi Wehrli, 1925 

A.{A.) caucasella sp. n. 

A.(A.) minorella (Rebel, 1899) 

A. (A.) tripunctella ([Denis & Schiffermüller], 1775) 

A.(A.) ponomarenkoae sp. n. 

A.(A.) schepleri sp. n. ' ' 

A.{A.)fibigeri sp. n. 

A. (A.) bidzilyai sp. n. 

Subgenus Telephila Meyrick, 1923 

A.(T.) schmidtiellus (Heyden, 1848) 
A.(T.) syriella sp. n. 

Key to the species (external characters) 

Several Acompsia species are very similar in external characters, and the key should only be taken as a 
guidline. In cases of doubt the genitalia should be examined. Females of A. muellerrutzi, A. caucasella 
sp. n., A. schepleri sp. n., A.fibigeri sp. n., A. bidzilyai sp. n. and A. syriella sp. n. are unknown. 

1. Segment 2 of labial palpus with scale brush; forewing orange-brown or yellow 2 

- Segment 2 of labial palpus slender; forewing brown 3 

2. Forewing orange-brown mottled with some black scales A. schmidtiellus 

- Forewing straw yellow mottled with many blacks scales A. syriella sp. n. 

3. Forewing unicolorous, without any markings A. cinerella 

- Forewing with more or less distinct spots 4 

4. Forewing light ochreous brown, with dark subterminal fascia A. caucasella sp. n. 

- Forewing dark brown to greyish brown, rarely dark ochreous brown, without subterminal 
fascia 5 

5. Forewing with dark subcostal patch at about two-thirds A. maculosella 

- Forewing without subcostal patch 6 

6. Forewing with small subbasal patch of dark scales A. bidzilyai sp. n. 

- Forewing without subbasal patch of dark scales 7 

7. Forewing light greyish brown, with indistinct light fascia at four fifths A. minorella 

- Forewing ochreous brown to fuscous grey-brown, without light fascia 8 

8. Forewing fuscous grey-brown; female distinctly brachypterous A. dimorpha 

- Forewing ochreous brown to light greyish brown; female smaller than male, not strongly 
brachypterous 9 

9. Adult small (wingspan male 14-17 mm); forewing dark to light greyish brown, without 
darker veins and without darker dots along termen 10 

- Adult larger (wingspan male 17-24 mm); forewing light ochreous brown or rarely light 
greyish brown, with or without dark veins, usually with darker dots along termen 12 



Nota lepid. 25 (2/3): 109-151 111 

lO.Forewing dark grey-brown with four black spots A. muellerrutzi 

- Forewing light greyish brown to shining olive-brown 11 

ll.Forewing light greyish brown, mottled with light yellow; female of same size as male 

A. subpunctella 

- Forewing olive brown, slightly shining; female smaller and more narrow-winged than male 

A. delmastroella 

12. Forewing (in male) with one black spot 13 

- Forewing (in male) with three black spots 14 

13. Forewing with stripes of black scales between veins; apex rounded A. schepleri sp. n. 

- Forewing without stripes of black scales; apex weakly pointed A. fibigeri sp. n. 

14. Forewing with very distinct spots, terminal dots well developed; female about size of male 

A. antirrhinella 

- Forewing with distinct though small spots; female smaller than male 15 

15. Forewing with or without terminal dots; female slightly brachypterous, with narrower 
forewings than male A. tripunctella 

- Forewing with terminal dots; female reasonably brachypterous, with forewing only half as 
broad as in male 16 

16. Moderately small moths (male 17-21 mm, female 15 mm); forewing with groups of black 
scales between veins; female reasonably brachypterous, with forewing only half as broad 
as in male (southwestern Europe) A. pyrenaella sp. n. 

- Moderately large moths (male 20-24 mm, female 16-17 mm); forewing with scattered 
black scales; female reasonably brachypterous, with forewing only half as broad as in male 
(southeastern Europe) A. ponomarenkoae sp. n. 



Acompsia Hübner 1825 [1816]: 409 

Type species: [Phalaena] cinerella Clerck 1759: pi. 11, fig. 6, by subsequent designation (Duponchel 
1838: 19) (see Sattler 1973: 164). 

Brachycrossata Heinemann 1870: 323 (junior objective synonym). 

Type species: [Phalaena] cinerella Clerck 1759: pi. 11, fig. 6, by subsequent designation (Meyrick 

1925: 141) (see Sattler 1973: 177). 
Telephila Meyrick, 1923: 626. 
Type species: Ypsolophus schmidtiellus Heyden 1848: 954, by original designation. 

Adult. Antenna brown, in most species indistinctly lighter ringed, in male with 
short cilia. Head, thorax and tegula in all species concolourous with forewing, head 
often with lighter scales above eye. Forewing sub-rectangular to almost sub-triangu- 
lar, light to dark brown (occasionally orange or yellow), without or with up to four 
black spots and often black stripes or patches; termen from rounded to emarginated 
below apex, in some species with black spots at end of veins. Hindwing broadly sub- 
rectangular, only with a slight emargination beyond apex. Tip of abdomen yellow. 
Female in most species smaller than male; in some species slightly to reasonably 
brachypterous, most pronounced in A. dimorpha (females of 6 species unknown, per- 
haps brachypterous). 

Male genitalia. Uncus broad, sub-rectangular, fused with tegumen; gnathos 
with small culcitula, covered with microtrichia, distal part a strong and long hook; 
tegumen about twice width of uncus, with parallel outer margin, anteriodorsal margin 



1 1 9 

1 ljL Huemer & Karsholt: The genus A compsia 

with moderately weak emargination, pedunculi small; valva separated into 
ventroanterior (sacculus) and dorsoposterior lobes (cucullus); cucullus distally dilated, 
with straight posterior margin and broad semioval setose apical part; sacculus a lobe, 
distal part densely covered with microtrichia, fused with vinculum by a membrane; 
vinculum consisting of two long and narrow, distally usually enlarged sclerites, distally 
fused by a membrane; juxta absent; anellus with two small setose humps dorsally; 
aedeagus weakly inflated, apicoventrally with rounded plate, apicodorsal part with or 
without dentate sclerite at base of vesica, vesica with (sg. Acompsiä) or without (sg. 
Telephila) spiralled sclerotized distal part. 

Female genitalia. Papillae anales large; apophyses posteriores about 1 .5 to 
three times length of apophyses anteriores; apophyses anteriores about length of seg- 
ment VIII; segment VIII sclerotized dorsally and ventrally, without specialised sclerites; 
sclerotized sternite occasionally prolonged into antrum, membranous in between; os- 
tium submerged under the margin of segment VIII; antrum broadly funnel-shaped; 
ductus bursae short, with sclerites near corpus bursae; corpus bursae large, pyriform, 
with (sg. Acompsia) or without (sg. Telephila) strong sclerite at entrance of ductus 
seminalis at right hand side and about middle to anterior third of corpus bursae; left 
hand side of corpus bursae with patch of microtrichia and small appendix bursae. 

Distribution. Species of Acompsia are mainly restricted to mountains of the 
Western Palaearctic region. Several taxa are endemic to limited areas, whereas only 
one species, A. cinerella, is widely distributed throughout Europe and Palaearctic Asia. 
Records from outside the Palaearctic region apply to other genera (see below). 

Biology. Host-plant relationships within the genus are largely unknown. Mosses 
and herbaceous plants (Scrophulariaceae, Plantaginaceae, Onagraceae and Lamiaceae) 
are reported as host-plants. The adults (especially the males) are usually attracted to 
light; females of several species fly little and are rare in collections or even unknown. 
Most of the species live in the montane to alpine zone, preferably in various types of 
meadows and woodland edges. 

Systematic position. Acompsia is considered as a member of the gelechiid 
subfamily Dichomeridinae, which is defined by several synapomorphic character states 
such as the presence of parategminal sclerites, divided valva, anteriorly tube-like 
tegumen with well developed ventral wall and specialised muscles (Ponomarenko 1992; 
1997a). The phylogeny and taxonomy of the Dichomeridinae has been studied in de- 
tail by Ponomarenko (1997a), according to whom two genera, Helcystogramma Zeller, 
1877 and Acompsia (including Telephila, see below) form a more ancestral branch, 
defined by the absence of a juxta as synapomorphy. Acompsia s. 1. is characterised by 
two apomorphic characters: a) sacculus with stretched apex, superposed ventrally and 
b) aedeagus with separate dorsal plate (Ponomarenko 1997a: 307). According to this 
author Acompsia s. str. is a monophyletic entity, based on the sclerites of ductus bursae 
near the entrance to corpus bursae. It remains doubtful to us whether sclerites of the 
ductus bursae are meant as they occur in both subgenera. However the sclerites at the 
entrance of the ductus seminalis may be regarded as an apomorphy of Acompsia s. str. 

The genus Telephila Meyrick, 1923, was established to include one European and 
one Australian species, and placed next to Dichomeris Hübner, 1818 (Meyrick 1925: 



Nota lepid. 25 (2/3): 109-151 



113 



173-174). The European species, A. schmidtiellus (Heyden, 1848), and A syriella sp. 
n. differ from the species here included in Acompsia s. str. by the presence of an apical 
tuft on segment 2 of the labial palpus, and by the distomedially curved sacculus. The 
latter was regarded as a synapomorphy for Telephila by Ponomarenko (1997a). We 
consider none of these two and further characters (Table 1) being of generic impor- 
tance within the Dichomeridinae. In accordance with Ponomarenko (1997b: 10) and 
Eisner et al. (1999: 57) we therefore treat Telephila as a synonym of Acompsia, how- 
ever, giving it subgeneric rank. 

Table 1. Important diagnostic characters of subgenera Acompsia and Telephila 



Character 


Subgenus Acompsia 


Subgenus Telephila 


Labial palpus segment 2 


without ventral scale brush 


with strong ventral scale brush 


Sclerites of vinculum 


distally enlarged 


without distal broadening 


Vesica 


distal part sclerotized, spiralled 


distal part not sclerotized, nor 
spiralled 


Entrance of ductus seminalis 
into corpus bursae 


with strong sclerite 


without sclerite 



Meyrick ( 1 925 : 1 42) treated the genera Cathegesis Walsingham, 1910, and Oxypteryx 
Rebel, 1911, as synonyms of Acompsia. Oxypteryx, with its only species jordanella 
Rebel, 1911, has been treated as separate from Acompsia since Amsel (1935: 265). 
Cathegesis, with its three Neotropical species (angulifera Walsingham, 1897, 
psoricopterella (Walsingham, 1 892) and vinitincta (Walsingham, 1 9 1 0)) (Meyrick 1925: 
142; Becker 1984: 49) is not congeneric with Acompsia (Sattler, pers. comm.). 

In the past a number of non-Palaearctic species have been assigned to Acompsia 
and Telephila. Meyrick (1925) listed 15 species in Acompsia and four in Telephila. 
In addition to the four species listed above the following have been transferred to 
other genera: formos el la (Hübner, 1825) (= ehurnella ([Denis & Schiffermüller], 
1775)), flavella (Duponchel, 1844) and pallidipulchra (Walsingham, 1904) to 
Mirificarma Gozmâny, 1955 (Pitkin 1984); labradorica (Möschler, 1864) to 
Chionodes Hübner, 1825 (Hodges 1983: 22); delotella (Busck, 1909) and vaccin ici la 
(Busck, 1915) to Dichomeris Hübner (Hodges 1986: 46, 76), oenochyta (Meyrick, 
1921) to Leuronoma Meyrick, 1918(Janse 1958: 43) and sphenopis (Meyrick, 1921) 
to Schizovalva Jamse, 1951 (Janse 1960: 224). Ypsolophus plasticus Meyrick, 1904, 
from Australia, which was included in Telephila by Meyrick (1923: 626), is a 
Dichomeris (Sattler, pers. comm.). Gaede (1937: 386) also placed Rhinosia striolella 
Turati, 1924, in Acompsia, but it is a synonym of Mirificarma pallidipulchra 
(Walsingham, 1904) (Pitkin 1984: 24). 

Acompsia tenebrosella Lucas, 1955, described from a single male from Morocco 
(Lucas, 1955: 255) was stated to be related to A. cinerella. We have been unable to 
study the holotype, but based on the short description which is not accompanied by 
any figure we are of the opinion that tenebrosella is not an Acompsia. 



■*- ^ Huemer & Karsholt: The genus Acompsia 

Remarks. Characters mentioned under the generic description apply to all spe- 
cies and are not repeated. 

Species of Acompsia may best be identified by external characters such as the wing 
colour, presence/absence of spots, size and wing-shape. In the male genitalia the most 
reliable specific characters are found in the shape of the sacculus and the aedeagus. 
The female genitalia are rather similar between the various species with usually only 
minor differences in the anterior sclerotizations of sternite VIII, length of the ductus 
bursae, size of corpus bursae and the field of microtrichia. 

The sequence of species is based on important genitalic characters mainly the dorsal 
sclerotizations of the aedeagus. The short, weakly dentate sclerite is regarded as the 
plesiomorphic state. In one group of sg. Acompsia this sclerite is gradually reduced, 
whereas in the other it is developed to a large spine. However, the sequence does not 
necessarily reflect the phylogeny of the group which still requires further investiga- 
tion. 

Subgenus Acompsia 

Acompsia {Acompsia) einer ella (Clerck, 1759: pi. 11, fig. 6) (Phalaena) 

Phalaena murinella Scopoli 1763: 256. 
Tinea ardeliella Hübner 1817: pi. 65, fig. 437. 
Recurvaria cinerea Haworth, 1828: 547. 
Lita spodiella Treitschke 1833: 78. 

Material examined. Norway: 1 6 , Vay, Kristiansand, Segne, 7.-9. vii. 1 979, leg. Pedersen; 2 6 , 
Kjendalsbras, 17.vii.1983, leg. Thomsen; 1 9, On, Vinstra, 4-5.vii.1984, leg. Karsholt; 3c?, ditto, but 
11. vi. 1985, leg. Karsholt & Michelsen (all ZMUC). Denmark: IS, NEZ, Grib Skov, Lods Bakker, 
8.viii.l984, leg Hendriksen (gen. slide HH 873) (HEND); 1 6, SZ, Frederikslund, 5.vi.l937, leg. Nielsen 
(gen. slide PKN 600c?); 19, NEZ, Alindelille, 2.VÜ.1963, leg. Nielsen (gen. slide PKN 6009); 16, 
NEZ, Hundested, 9.VÜ.1949, leg. Lundqvist (gen. slide JL 777); 1 9, LFM, Hannenov, 16.viii.1969, leg. 
Lundqvist (gen. slide JL 778); 19, LFM, Hovblege, 6.ix.l987, leg. Hendriksen (gen. slide HH 2218); 
la, 19, ditto, but 30.vii.1961 & 16.viii.1969, leg. Traugott-Olsen (gen. slide ET014669, 14176); 
134 S , 15 9 further, undissected specimens from Denmark (all ZMUC). Sweden: 26, Sm, Gârdby, 1- 
3.VÜ.1965, leg. Johansson; Ög, Ödeshög, 17.vii.1972, leg. Karsholt (ZMUC); la, 01, Seberneby, 
19.vii.1975, leg. Karsholt; 16, Gtl, Hamra, Holmhäller, 21.-24.vii.1985, leg. Karsholt (all ZMUC). 
Finland: 1 o* , N, Vantaa, 18.-25.vi.1968, leg. Laasonen; 1 6 , Ka, Virolathi, 10.-16.vii.1973, leg. Laasonen; 
16, ditto, but L-16.vii.1974; IS, N, Tirmo, 19.-20.vii.1980, leg. Fibiger (all ZMUC). Russia: 7S, SW 
Altai, Katun valley, 10 km W Katanda, 1200 m, 22.-27.vi. 1983, leg. Mikkola, Hippa & Jalava (ZMUH); 
IS, Primorskii Kraj, Shkotovo distr., Anisimovka, 27.vii.1994, leg. Savenkov (gen. slide HH 3385) 
(ZMUC); 1 S, Transbaikalia, Chita, 27.vii.1997, leg. Bidzilya, I. & O. Kostjuk (ZMUH). Estonia: Taheva, 
21.vi.2000, leg. Viidalep (ZMUC). Poland: IS, Puszcza Bialowieza, Park narod, 23.viii.1965, leg. 
Adamczewski; \S, Suwalki, Okragle, 12. vi. 1988, leg. Karsholt; \S, Podlaskie, Bialowieza, 29. v. - 
l.vi.2000, leg. Karsholt (all ZMUC). Slovakia: 1 9, Viniansky hrad, 25.V.2000, leg. Karsholt. Germany: 
IS, 19, Württemberg, Markgröningen, Rotenacker, 25.vii.1979, leg. Süssner (gen. slide GEL 881 6, 
GEL 1048 9); 1 9 , Württemberg, Schwäbische Alb, Seeburg, 650 m, 13.vi.1977, leg. Süssner; IS, ditto, 
but 20.vi.1974; IS, Württemberg, Marbach - Neckar, 19.vi. & 7.viii.l954, leg. Süssner; 19, ditto, but 
25.vi.1955; 19, ditto, but 30.vi.1956; \S, Württemberg, Schwarzwald, Zwickgabel, 4.VÜ.1965, leg. 
Süssner; IS, Württemberg, Bissingen - Enz, 1. vi. 1961, leg. Süssner; 1 9, Württemberg, Oberstenfeld, 
Forstkopf, 7.VÜ.1972, leg. Süssner; IS, Bayern, Langwied, 490 m, late viii.1977, leg. Zürnbauer; \S, 
Bayern, Wangen, 600 m, late vi. 1973, leg. Zürnbauer; 2S, Bayern, Neurieder Forst, 520 m, late vi. 1962, 
leg. Zürnbauer; \S , Bayern, Inning, 550 m, early vi. 1966, leg. Zürnbauer; 1 9, Bayern, Eching, mid- 
vii.1949, leg. Pfister; \S, Bayern, Schliersee, 8.vi.l943, leg. Geltinger (all TLMF). Great Britain: IS, 
Norfolk, Briston by Melton Constable, 10.vii.1973, Rothamsted Exp. Station (ZMUC). France: 26, 
Hautes Alpes, Les Vigneaux, 1200 m, 25.vii.1990, leg. Huemer & Tarmann; 1 S, Prelles, 1200 m, early 
viii.1974, leg. Zürnbauer (all TLMF); 26, Isère, Séchilienne, 1000 m, 29.-30.vi. 1990, leg. Schepler; 
1 S, Alp. Cottiennes, Col de Vars, 2100 m, 16.viii.1995, leg. Schepler (gen. slide HH 3382); \6, Ecrins, 



Nota lepid. 25 (2/3): 109-151 115 

Allefroide, 1800 m, 18.viii.1995, leg. Schepler (all ZMUC). Andorra: 2d, Arnisal, 1500 m, l.viii.1997, 
leg. Baungaard (ZMUC). Spain: IS, Huesca, Penalba, 250 m, 17.x. 1984, leg. Nielsen; 3d, Gerona, 
Bruguera by Ripoll, 1700 m, 12.vii.1988, leg. Fibiger (gen. slide GU 01/1072); 19, Gerona, Ribes, 
above Bruguera, 1650 m, 14.viii.2001, leg. Skou; 26, Lerida, 15 km W La Seu d'Urgell, Pt. Del Canto, 
1650 m, 6.VÜ.1993, leg. Fibiger; 16, Lerida, Roni near Sort, 1000 m, 7.VÜ.1993, leg. Skou (all ZMUC); 
IS, IS", San Ildefonso, Escalera (gen. slide 16.534c?) (NHMW). Italy: \6, Südtirol, Naturns, 660 m, 
mid-ix.1965, leg. Zürnbauer (TLMF); 1 Ç, Südtirol, Montiggl, Kl. Priol, 600 m, 26.vi.1993, leg. Huemer 
(TLMF); IS, Verona, Garda, Mt. Bre, 16.-30.V.1982, leg. Olsen; IS, Verona, Monte Baldo, Ferrara, 
1 1 00 m, 27.-29. vi. 1981, leg. Skou & Skule; 2 9 , Verona, Monte Baldo, above Prada, 1 200 m, 22. vii. 1 989, 
leg. Karsholt; IS, Prov. Izernia, Pizzone, dint. Valle Fiorita, 1450 m, 14.-21. vii. 1990, leg. Baldizzone, 
Barbero & Bassi (gen. slide HH 3381) (all ZMUC); 3 9, Piemonte, Cueno, Parco Natur. Reg. Alpi, 
Marittime, S. Giac. di Entracque, sent. Rifugio Soria, Gias Isterpis, 1381 m, 19.vii.1996, leg. Baldizzone; 
26 , ditto, but S. Giaccomo di Entracque, sopra Lago della Rovina (Rocca Barbis), 1550-2000 m, 20- 
26.vii.1997; IS, ditto, but Entracque, Trinta, 1100 m, 28.vii.1997; 1 9, ditto, but S. Anna di Valdieri, 
dint. Lago Sottano d. Sella, 1900 m, 16.vii.1998; IS, ditto, but Valdieri, 900 m, ll.vi.1999; Id, ditto, 
but Terme di Valdieri, Valle della Valletta, 1450-1650 m, 19.vii.1999; 19, ditto, but dint, di Entracque, 
Mte Ray, 1000-1400 m, 18.vii.2000 (BLDZ, ZMUC). Switzerland: \6, Appenzell, Seealptal, 1000 m, 
28.vi.1958, leg. Malicky (gen. slide 894 Malicky); 1 6 , Graubünden, Landquart, 12.vi. 1918, leg. Thomann 
(all TLMF). Austria: Id, Nordtirol, Nauders, Seleskopf, 1600 m, 24. vii. 1955, leg. Süssner (gen. slide 
GEL 78); 26, Nordtirol, Gurgltal, N Dollinger, 800 m, 30.vii.1991, leg. Cerny; IS, Nordtirol, Pinegg, 
1000 m, late vi. 1971, leg. Zürnbauer; \6, Nordtirol, Innsbruck, 24. vii. 1958, leg. Hernegger; \6, ditto, 
but 1. vii. 1965; Id, ditto, but 7.VÜ.1970; 1 9, ditto, but 28.V.1970; 1 9 , Nordtirol, Seegrube, 27.vii.1961, 
leg. Hernegger; Id, Nordtirol, Arzler Aim, 1200 m, 10.vi.1971, leg. Hernegger; 19, Nordtirol, Zirl, 
30.viii. 1970, leg. Hernegger; 19, Nordtirol, Valsertal, 24.vii.1969, leg. Hernegger; 2d, Osttirol, 
Venedigergruppe, Dorfertal, 1520 m, 8.VÜ.1993, leg. Huemer; 2d, Osttirol, Virgen, Nilbach, 1800 m, 
16.viii.1993, leg. Rakosy; 2d, Osttirol, Virgen, Obermauern, 1400 m, 14.viii.1993, leg. Rakosy; ld, 
Osttirol, Venedigergruppe, Maurertal, 1550 m, 22.vi.1993, leg. Huemer; 2d, Osttirol, Prägraten, St. 
Andrä N, 1420 m, 23.vi.1993, leg. Huemer & Tarmann; 1 6, Osttirol, Schobergruppe, Stanis Alm, 2000 
m, 1 0.viii. 1 990, leg. Tarmann; 1 d , ditto, but 8.viii. 1 988; 1 d , 2 9 , Osttirol, Kartitsch, 1 600 m, 1 5.vii. 1 964, 
leg. Süssner (gen. slide GEL 878 6, GEL 879 9); ld, Oberösterreich, O. Weißenbach, 7.vii.l923, leg. 
Knitschke; 1 6, Niederösterreich, Schneeberg, 23.vi.1910; 1 d, Niederösterreich, Melk, 14.vii. 1909, leg. 
Zerny; 2d, Burgenland, Winden, 10.vi.1970, leg. Zürnbauer (all TLMF); 2d, Burgenland, Illmitz / See, 
1. ix. 1973, leg. Glaser; 19, Osttirol, Lienz, 700 m, 7.VÜ.1981, leg. Schnack; 19, Osttirol, Tessenberg, 
1400 m, 12.-15.vii.1981, leg. Schnack; 1 9, Osttirol, Glocknergruppe, below Kais, 1100 m, 28.vii.1991, 
leg. Karsholt & Rakosy (genitalia in tube); 1 d , ditto, but Burg bei Kais, 28.-3 1 .vii. 1 99 1 , leg. Karsholt & 
Rakosy; 1 9, ditto, but Mauriger Trog, 2100 m, 30.vii.1991, leg. Karsholt, Rakosy & Tarmann; 2d, 19, 
ditto, but Loweraze, 1600-1860 m, 30.-31. vii. 1991, leg. Karsholt, Rakosy & Tarmann (ail ZMUC). 
Hungary: 1 6, Visegrad, 8.VÜ.1997, leg. Larsen (ZMUC). Slovenia: 2d, Nanos, 29.ix.1983, leg. Deutsch 
(gen. slide GEL 52) (TLMF). Croatia: 1 d , Slavonia, Fruska Gora, 28.vi.-12.vii. 1 935, leg. Daniel (ZSM). 
Yugoslavia (Montenegro): 1 d, Durmitor, Komarnica, 1400 m, 24.vii.1985, leg. Jaksic (TLMF). Roma- 
nia: ld, B. Ouia, Sibu, 3.viii.l984, leg. Rakosy (ZMUC); 2d, Lacu Rosu, Suhardu Mic, 1450 m, 
8.viii.l992, leg. Rakosy (TLMF); ld, Herculana, 8.vi.l993, leg. Rakosy (ZMUC). Bulgaria: ld, 
Stanimaka, 1. -10. vii. 1933, leg. Pfeiffer (ZSM). Greece: 49, Lakonia, Mt. Taygetos, 1000 m, 28- 
29.vi.1982, leg. Skule & Langemark; 2d, 19, Lakonia, Mt. Taygetos, above Trapezandi, 1500 m, 
5.VÜ.1984, leg. Skule (gen. slide GU 01/1069d); 2d, Taygetos mts., 950-1800 m, 15.-19.V.1990, leg. 
Karsholt; 2d, Fiorina, 5 km NW Pisoderion, 2000 m, 21. vii. 1990, leg. Fibiger; ld, 19, Fthiotida, 
Parnassos mts., below skicenter, 21. vii. 1998, 1650 m, leg. Skule & Nilsson; 3d, 19, Makedhonia/ 
Thessalia, Olympos, 700-2100 m, 21.-26.V.1990, leg. Karsholt (gen. slide GU 02/1118 9); ld, 19, 
Kastoria, 6 km E Eptachori, 1400 m, 13.vii.1998, leg. Skule & Nilsson; 2d, 19, Fiorina, 1 km NW 
Pisoderi, 1600, 14. vii. 1998, leg. Skule & Nilsson (all ZMUC). Turkey: ld, Ankara, 20 km NW 
Kizilcahaman, 1200 m, 1. vii. 1987, leg. Fibiger; 2 9, Ankara, 10 km NW Kizilcahaman, 1 150-1250 m, 
6.-7. vii. 1 989, leg. Fibiger & Esser; 5 d , Gümüshane, Kop Pas, 2300 m, 1 9.vii. 1 989, leu. Fibiger & Esser 
(gen. slide HH 3548); 3d, 21 km S Kayseri, Erciyes Dagi, 2200 m, 29.vii.1989, leg. Fibiger & Esser 
(gen. slide HH 3547); 1 d, ditto, but 25 km S Kayseri, 2800 m (all ZMUC). Armenia: 2d, 1 9, Geghard, 
40 km E Eriwan, 1700 m, 24.-27.vii. 1976, leg. Kasy & Vartian (NHMW). 

Male (Fig. 1 ). Wingspan 15-19 mm. Labial palpus long, slender; segment 2 brown; 
segment 3 yellow brown, both segments lighter on inner surface. Antenna dark brown, 
slightly lighter ringed. Forewing clay brown, sometimes with olive tint, faintly mixed 
with yellow; veins at end of cell and in apical part occasionally darker; weak dark spot 
rarely present at end of cell; fringes uniformly light brown. Hindwing brown grey, 
with light brown fringes. 



-I -»■ Huemer & Karsholt: The genus Acompsia 

Female (Fig. 2). Wingspan 13-17 mm. Similar to male but smaller on average 
and with forewing slightly narrower; colour of forewing often darker clay brown. 

Male genitalia (Figs. 25, 42). Uncus rounded distally; cucullus with particu- 
larly long dilated part; sacculus lobe almost completely covered with microtrichia, 
sub-triangular, comparatively small, with long and straight distoventral (outer) mar- 
gin; aedeagus with short, weakly dentate sclerite. 

Female genitalia (Figs. 59-60). Apopyhses posteriores about 1 .5 times length 
of papillae anales; apophyses anteriores about length of segment VIII; sternite VIII 
with distinct, short medial sclerotizations; ductus bursae long; corpus bursae with large 
patch of microtrichia. 

Distribution. Widely distributed in most parts of Europe (Karsholt & Riedl 
1996: 121), and Turkey through Siberia to the Far East of Russia. Also recorded from 
Kazakhstan (Ponomarenko 1997b: 10). 

Biology. The larva was described by Sorhagen (1902: 56-57) - based on the 
description and a water-colour made by C. W. L. Grabow, the father in law of O. 
Staudinger (Sorhagen 1901 : 241): rather slim, especially towards end, greenish grey; 
head brown, prothoracic shield and legs black; abdominal legs concolorous with 
body; back with four dark warts on each segment, laterally beneath anterior pair 
another one; larva wrinkled beneath faint, light lateral line, with two rather long 
bristles above each other, upper (anterior) shorter. It lives until June between moss at 
the base of trees growing in forests, feeding on the moss; it is very shy, quickly 
disappearing into the moss. According to Lhomme (1948: 655) Chrétien bred A. 
cinerella from eggs on Veronica chamaedrys L. (Scrophulariaceae). Chrétien (1900: 
202) himself informs that Millière found larvae of A. cinerella in September on 
Epilobium montanum L. (Onagraceae). It is unclear if the larva of A. cinerella is 
polyphagous or if some of the host records above refer to other species. The adults 
fly from late May to mid-October, normal from June to August. The adult occurs in 
various, mainly open habitats. It is readily attracted to light. Vertical distribution: 
from sea level to about 2300 m. 

Remarks. A cinerella is rather constant in colour and the absence of wing mark- 
ings throughout its distribution range. Specimens from SE Europe often have more 
yellow scales in the forewing. The largest specimens are normally found in southern 
European populations. The presence of a weak, dark spot at the end of the forewing 
cell is apparently not geographically correlated, even though it is often present in speci- 
mens from Turkey. 

Phalaena cinerella was based on an unspecified number of specimens, probably 
from Sweden, and figured by Clerck. A lectotype was designated by Robinson & Nielsen 
(1983:206). 

Phalaena murinella was described from an unspecified number of specimens col- 
lected in lower Carniolia (Slovenia) (Scopoli 1763). The identity of this species is 
doubtful but the description does not contradict the hitherto accepted interpretation, of 
which there has been consensus since it was published by Werneburg (1864: 279). 

Tinea ardeliella was described from an unspecified number of specimens probably 
from central Europe and figured by Hübner without accompanying text. Hübner (1796: 



Nota lepid. 25 (2/3): 109-151 H7 

59, pi. 25, fig. 173) had already described and figured cinerella Clerck (as cinerella 
Linnaeus), but because of later doubt another specimen was later figured under the 
name ardeliella (Treitschke 1833: 78, 81). 

Lita spodiella was described as uncommon ('nicht häufig') from Austria and Sachsen 
(Treitschke 1833). It was synonymized with A. cinerella by Zeller (1839: 198). De- 
spite of all efforts by Dr. L. Gozmâny no labels nor type specimens could be found in 
the Hungarian Natural History Museum (Treitschke collection). 

Recurvaria cinerea Haworth is an unjustified emendation of Phalaena cinerella 
Clerck. 

Acompsia {Acompsia) pyrenaella sp. n. 

Material examined. Holotype â 'Gallia Pyren. Val. d'Ossoue 1500 m 17.7.61 K.Burmann' 'GEL 1063 
<? P. Huemer' (TLMF). Paratypes: France: Id, C Pyrenees, Gavarnie, Col de Bucharo, 2200 m, 6- 
7.VÜ.1986, leg. Grünewald (GRÜN); \â, Pic du Midi de Bigorre, 2400 m, 3.viii.l981, leg. Sattler, Tuck 
& Robinson (gen. slide BM 26.577); 1 9, ditto, but 2650 m, 4.viii.l981 (gen. slide 26.578); \S, Mt. 
Canigou, 2200 m, 30.vii.1981, leg. Sattler, Tuck & Robinson (all BMNH). Andorra: 56, by Pto. de 
Envalira, 2300 m, 1. viii. 1988, leg. Fibiger (gen. slide HH 3540, 3541); ld,Arnisal, 1500 m, l.viii.1997, 
leg. Baungaard (gen. slide HH 3575) (all ZMUC). Spain: Id, Lerida, Puerta la Bonaigua, 2000 m, 
21.vii.1972, leg. Dicksen (BMNH); lid, ditto, but 2050 m, 31.vii.1988, leg. Fibiger (gen. slide GU 01/ 
1036) (ZMUC, TLMF); Id, E Pyrenees, Col de Puymerons, 1900 m, 4.-5.viii.l980, leg. Grünewald 
(GRÜN). 

Male (Fig. 3). 18-21 mm. Labial palpus long, slender; segment 2 dark brown on 
outer surface, other surfaces and apical part lighter; segment 3 greyish brown, mottled 
with yellow. Antenna brown, indistinctly lighter ringed. Forewing brown, with groups 
of black scales, especially between veins; basal half of costal area slightly lighter than 
rest of the forewing; three small, black spots: one (sometimes) elongate in fold, one 
above it and one at end of cell; termen emarginated below apex, with small, black 
spots at end of veins; cilia only slightly lighter than forewing. Hindwing light grey, 
with light yellow grey cilia. 

Female (Fig. 4). 1 5 mm. Reasonably brachypterous, with forewings only about 
half as broad as in male. Forewing dark grey-brown, mottled with light grey (especially 
along costa), yellow and black scales; two black spots at 1/3 and 2/3; termen oblique, 
without or with small black spots at end of veins. Hindwing grey, with grey cilia. 

Male genitalia (Figs. 26, 43). Uncus comparatively small, slightly dilated 
distally; cucullus with short dilated part; sacculus lobe sub-oval, moderately small, 
distinctly curved distally, distoventral (outer) margin strongly excavated; apices of 
vinculum arms broad; aedeagus with small undentate dorsal sclerite. 

Female genitalia (Figs. 61-62). Apopyhses posteriores about two times 
length of papillae anales; apophyses anteriores about length of segment VIII; sternitc 
VIII with indistinct medial sclerotizations; ductus bursae comparatively long, narrow, 
with distinct sclerite anteriorly; corpus bursae very large, with small patch of 
microtrichia. 

Distribution. Endemic to the Pyrenees. 

Biology. Host-plant and early stages unknown. Specimens have been caught 
from early July to early August, mostly at light. Vertical distribution: altitudes between 
1500 and 2650 m. 



1 A * Huemer & Karsholt: The genus Acompsia 

Remarks. The male of A. pyrenaella sp. n. is very similar to that of A. antirrhinella, 
but the latter has more distinct black dots in the middle of the forewing and along the 
termen. The female shows a clear tendency to brachyptery and is also distinctly smaller 
than the male. Also the genitalia of both taxa are very close, mainly differing in the 
distinctly broadened distal part of the vinculum arms and the distinct sclerite in the 
anterior part of the ductus bursae in A. pyrenaella sp. n. However, it should be pointed 
out that only one female could be examined. 

This species was repeatedly mistaken for A. tripunctella in various collections. 

Etymology. Named after the type region. 



Acompsia {Acompsia) antirrhinella (Millière, 1866: 274, 280, pi. 80, figs 6-8) 

(Gelechia) 

Material examined. France: 16, Cannes, leg. Millière (gen. slide BM 13.925) (BMNH); 1$, 
Hautes Alpes, Eygliers, Guillestre, 1000 m, 27.vi.1985, leg. Stadel Nielsen; 16, ditto, but 27.vi.1985 
(gen. slide GU 02/1120); 16, Vaucluse, Mont Ventoux, 6 km nw of Sault, 1100 m, ll.viii.1996, leg. 
Skou; 16, Alp. Mar., Esteng by Col de la Cayolle, 1850 m, 9.VÜ.1988, leg. Fibiger (gen. slide HH 3539); 
16, Pyr. Orient., La Preste, Prats de Mollo, 1420 m, ll.vii.1988, leg. Fibiger (gen. slide GU 02/1080) 
(all ZMUC); IS, Super-Lioran, Rousseau des Tripas, 26.vii.1994, leg. Gibeaux (gen. slide GEL 866) 
(TLMF). Andorra: 1 ?, Port de Cabüs, 2300-2500 m,27.vii. 1981, leg. Sattler, Tuck & Robinson (BMNH). 
Spain: 1 9, Pyrenees, Caralps, L-3.vii.1960, leg. Vartian (gen. slide NM 16.638) (NHMW); 1 S, Teruel, 
Albarracin, 22.-30.vi. 1924, leg. Zerny (gen. slide NM 16.537) (NHMW); 36, ditto, but 1200 m, 25.- 
26.vi.1992, leg. Skou & Skule (gen. slide HH 3542); 26, ditto, but 16.vii.1992, leg. Fibiger (gen. slide 
HH 3545); 16, Gerona, Bruguerra by Ripoll, 1700 m, 12.vii.1988, leg. Fibiger (gen. slide HH 3387); 
16, Gerona, Montseny by Coll de Rabell, 1700 m, 13.vii.1988, leg. Fibiger (gen. slide HH 3543); 1 6, 
Lerida, 15 km W La Seu d'Urgell, Pt. del Canto, 1650 m, 6.VÜ.1992, leg. Fibiger; 1 6, Huesca, 3 km W 
Laco Urdiceto, 2150 m, 20.vii.1992, leg. Fibiger; 16, Huesca, 12 km N Bielsa, by Tunnel, 1900 m, 
22.vii.1992, leg. Fibiger (gen. slide HH 3544) (all ZMUC). 

Male (Fig. 5). Wingspan 17-23 mm. Labial palpus long, slender; segment 2 dark 
brown on outer surface, other surfaces and apical part lighter; segment 3 greyish brown, 
mottled with yellow. Antenna brown, indistinctly lighter ringed. Forewing plain brown 
to greyish brown, more or less mottled with black brown scales, especially between 
veins; three distinct, black spots: one in cell, one above it, slightly closer to base, and 
one at end of cell; termen emarginated below apex, with a row of distinct, black spots 
at the end of veins; cilia slightly lighter than forewing. Hindwing grey, with light yel- 
low-grey fringes. 

Female (Fig. 6). Wingspan 17-20 mm. Similar to male but with more contrast- 
ing forewings than males because of many brown and black scales; also the basal half 
of the costal area in the forewing is lighter. 

Male genitalia (Figs. 27, 44). Uncus rounded apically; cucullus with strongly 
dilated part; sacculus lobe sub-oval, small, with weakly excavated distoventral (outer) 
margin; apices of vinculum arms small; aedeagus with small dorsal sclerite, not dentate. 

Female genitalia (Figs. 63-64). Papillae anales large; apopyhses posteriores 
about 1.5 times length of papillae anales; apophyses anteriores longer than short seg- 
ment VIII; sternite VIII without prolonged medial sclerotizations; ductus bursae com- 
paratively long, narrow, without distinct sclerites anteriorly; corpus bursae very large, 
with small patch of microtrichia. 



Nota lepid. 25 (2/3): 109-151 H9 

Distribution. Only known from northern part of Spain, Andorra and southern 
part of France. 

Biology. The larva is long, tube-like, a little flattened underneath, dark green to 
almost black in the final instar; head red, bordered with black at the top; collar whitish; 
the prothoracic plate coloured as the head, is also bordered with black; thoracic legs 
brown and shining; abdomen without lines, but with distinct black warts; abdominal 
legs unicolorous. It feeds from March to the end of May under a whitish, silken spin- 
ning, which has the ends attached to one or more leaves of As arina procumbens Miller 
{^Antirrhinum asarina L.) (Scrophulariaceae), growing in the crevices of old walls or 
between rocks. Pupation takes place at the basis of the plant, between dried leaves, or 
sometimes on the plant, in a folded leaf (Millière, 1867: 382-383). The adult flies from 
late June into August. Vertical distribution: from sea level to about 2300 m. 

Millière (1867: 384) was of the opinion that A antirrhinella hibernates in the adult 
state (based on some worn specimens collected in March). We believe that some mis- 
take may have happened, and his record needs confirmation. 

Remarks. A. antirrhinella is most closely related to A. pyrenaella sp. n.; for 
differences see under that species. 

Gelechia antirrhinella was described twice by Millière (1866, 1867). We have only 
seen the latter of these descriptions, but according to Sattler & Tremewan (1973: 226) 
they are identical. 



Acompsia (Acompsia) maculosella (Stainton, 1851: 22) {Gelechia) 

Material examined. Lectotype â (here designated) 'Mann 1 849' 'Maculosella 'Stainton Coll., 
Brit. Mus. 1893-134' 'Ex Stainton coll., (J. Mann, Vienna), Suppl. Cat. Br. Tin. Pter. App.:22, 1851'. 
Germany: Id, Hirschbachtal, 920 m, M.vii.1965, leg. Zürnbauer; 1 9, Berchtesgadener Alpen, Trischübel, 
1800-2100 m, A.viii.1950, leg. Pfister (gen. slide) (all TLMF); 19, Karwendel, 1900 m, mid-vii.1976, 
leg. Zürnbauer (gen. slide 4104 Tokâr). Switzerland: 1 â , Appenzell, Ebenalpe, 1600 m, 24.vii.1990, leg. 
Oswald (TLMF). Austria: 1 S , Steiermark, Reichenstein, 4.vii. 1919 (gen. slide GEL 491); 1 d, Radstätter 
Tauern, Seekarspitze, 2300 m, 3.-1 0.viii. 1 940, leg. Zerny (gen. slide GEL 38 1 ) (all TLMF); 1 6 , Kärnten; 
1 S , Kärnten, Grossglockner, 2000 m, 9.vii. 1981, leg. Schnack; 1 6 , Nordtirol, Rossfall, 1 200 m, 5.vi. 1 96 1 , 
leg. Hernoppel (all ZMUC); ld, Osttirol, Matrei, Lukaser Kreuz, 1200 m, 1 S.vii. 1962, leg. Süssner 
(gen. slide GEL 488); 2 6 , Osttirol, Lasörlinggruppe, Schwarzachtal, In der Weisse, 2450 m, 1 4.viii. 1 989, 
leg. Tarmann; \ <5 , Osttirol, Venedigergruppe, Malhambach-Talgrund, 2350-2450 m, 3.viii. 1 993, leg. 
Rakosy & Tarmann; 1 6 , Osttirol, Venedigergruppe, Essen-Rostocker-Hütte, 2600-2650 m, 4.viii.l993, 
leg. Rakosy; \6, Osttirol, Venedigergruppe, Maurer Alpe, 2300-2500 m, 5.viii.l993, leg. Rakosy; 1 o\ 
Nordtirol, Elltnau, l.vii.1956, leg. Hernegger; 1 9, Nordtirol, Vennatal, 2000 m, 16.vii.1942, leg. Scholz 
(gen. slide GEL 1 046); 1 6 , Nordtirol, Rißtal, Hagelhütten, 1 050 m, 3. viii. 1 993, leg. Huemer; 2 â , Nordtirol, 
Weißenbach, Errachau, 920 m, 9.vi.l989, leg. Huemer; Id, ditto, but I7.vi.1989, leg. Kahlen; 1 d, St. 
Anton am Arlbcrg, Schöngraben, 1400 m, 1 1 .7.1959, leg. Süssner; 1 6 , Vorarlberg, Lech-Oberlech, 1700 
m, 28.vii.1954, leg. Süssner; 1 6, Vorarlberg, Mittelberg, 15.vii.1953, leg. Süssner (all TLMF). Slovenia: 
\â, Kamn, Veliki Zvoh south slope, 1700 m, 20.vii.1993, leg. Habeler (gen. slide GEL 189) (TLMF). 

Male (Fig. 7). Wingspan 16-21 mm. Labial palpus long, slender; segment 2 dark 
brown, with light apical ring, yellow on inner surface; segment 3 dark brown, mottled 
with light brown. Antenna dark brown, indistinctly lighter ringed. Forewing clay brown, 
mottled with lighter brown scales; three distinct black spots: one more or less elongate 
in fold, one (distinct) round above it, slightly closer to base, and one similar to the 
second one at end of cell; between the latter spot and costa a sub-triangular, black 



1 ?D 

LZ,W Huemer & Karsholt: The genus Acompsia 

patch; veins in apical part sometimes darker; termen slightly emarginated below apex; 
termen line with distinct black spots at end of veins; fringes light brown. Hindwing 
grey, with yellow grey fringes. 

Female. Wingspan 1 6 mm. Similar to male, but smaller on the average. Forewing 
with light yellow subcostal line in basal half; black spots reduced and indistinct; apical 
part more mottled with yellow scales; termen more distinctly emarginated below apex. 

Male genitalia (Figs. 28, 45). - Uncus dilated apically; cucullus with rather 
short dilated part; sacculus lobe sub-oval, comparatively small, weakly curved distally, 
with scarcely excavated distoventral (outer) margin; aedeagus without dentate sclerite. 

Female genitalia (Figs. 65-66). Papillae anales large; apopyhses posteriores 
about 1.5 times length of papillae anales; sternite VIII without prolonged medial 
sclerotizations; ductus bursae comparatively long; corpus bursae rather small, with 
small patch of microtrichia. 

Distribution. Possibly endemic to the central and eastern parts of the Alps: 
Austria, Slovenia, Switzerland; Italy (Karsholt & Riedl 1996: 121) and Germany 
(Gaedike & Heinicke 1999: 85). We have been unable to confirm the presence of A. 
maculosella in France, including the Pyrenees (see Eisner et al 1 999: 57). Rebel (1917: 
193) recorded a specimen from the Tannu Ola Mts. (Russia, Tuvinskaya Oblast). We 
have been unable to trace this material in NHMW 

Biology. Host-plant and early stages unknown. Flight period: July to August. 
The adult occurs in various montane habitats, particularly subalpine to alpine mead- 
ows and shrub-formations. It flies freely during the day or can be roused from the 
vegetation. Occasionally it is also attracted to artificial light. Vertical distribution: from 
about 900 to 2600 m. 

Remarks. A. maculosella is easily recognizable by the characteristic, dark sub- 
costal patch. In the past it was considered by some authors (see Gaede 1937: 387) as a 
synonym (form) of A. tripunctella. However, both species are not very closely related 
as proved by the genitalia. Gelechia maculosella was described from an unspecified 
number of specimens (Stainton 1851), which most probably were collected by Mann 
in the Austrian Alps. The above mentioned specimen is here designated as lectotype to 
fix the status of the species. 



Acompsia {Acompsia) dimorpha Petry, 1904: 4 

Material examined. Lectotype S (here designated) 'Pyrenaei centr., F 24/7 1 90 1 , Pic du Midi de 
Bigorre, Dr. A. Petry legit.' 'Sammlung A. Perry' 'Museum Erfurt' 'Lectotype S, Acompsia dimorpha 
Petry, teste K. Sattler 1977' 'SPECIMEN PHOTOGRAPHED' (MNG). France: 26, 1 5, paralectotypes, 
same data as holotype (MNG); \S, Htes. Pyrénées, Cèdre, bred 1904, leg. Rondou (MNG); 1 â, Pyrenees 
cent., Pic du Midi de Bigorre, 2400 m, 2.viii.l981, leg. Sattler, Tuck & Robinson; la, ditto, but 3.viii.l981 
(gen. slide BM 26.575); 1 â , ditto, but pupa on 3.viii. under rock, emerged 9.viii.l981; 1 ? , ditto, but pupa 
on 3.viii. under rock, emerged 12.viii.1981 (gen. slide BM 26.576) (all BMNH). Spain: 1 S, Pyrenees cent, 
Monte Perdido, vie. Ref. Goriz, 2350 m, l.viii.1990, leg. Sommerer (gen. slide GEL 875) (TLMF). 

Male (Fig. 9). Wingspan 16-20 mm. Labial palpus comparatively long, slender. 
Antenna dark brown. Forewing narrower than in A. tripunctella, greyish to black brown, 
mottled with light yellow or light greyish scales; four indistinct, but rather large spots: 
one near base, one (obscure) in fold, one above it, and one (more distinct) at end of 



Nota lepid. 25 (2/3): 109-151 121 

cell; termen slightly emarginated below apex, sometimes with a few dark scales at end 
of veins; cilia light greyish brown, with faint cilia line. Hindwing light grey, with light 
yellow grey fringes. 

Female (Fig. 10). Wingspan 11-13 mm. Brachypterous. Labial palpus black 
brown, mottled with yellow. Antenna dark brown. Forewing not longer than antenna, 
eliptical, black brown, mottled with many yellow and light brown scales; indistinct, 
black spots at 1/4 2/4 and 3/4 fringes sparse, light yellow grey. Hindwing narrow, 
without emarginated termen below apex, light grey, darker at apex; fringes as in 
forewing. Hindlegs strong. 

Male genitalia (Figs. 29, 46). Uncus brod, sub-rectangular; cucullus with com- 
paratively long dilated part; sacculus lobe sub-oval, comparatively small, with weakly 
and irregularly excavated distoventral (outer) margin; aedeagus without dorsal sclerite. 

Female genitalia (Figs. 67-68). Apopyhses posteriores about 2.5 times length 
of papillae anales; apophyses anteriores comparatively long; sternite VIII without pro- 
longed medial sclerotizations; ductus bursae comparatively long; corpus bursae rather 
small, with small patch of microtrichia. 

Distribution. Endemic to the French and Spanish Pyrenees. 

Biology. Host-plant and early stages unknown. The pupal stage has been found 
under stones. Adults were collected and bred from late July to early August. A. dimorpha 
is restricted to the alpine zone where it may occur together with A. pyrenaella sp. n. 
Vertical distribution: recorded from about 2300 to 2400 m. 

Remarks. A. dimorpha is easily characterized by the strongly brachypterous 
female which is (from our present knowledge) unique in the genus. Other species of 
Acompsia only show a slight to moderate tendency to brachyptery. 

A. dimorpha was described from 1 female and 3 male syntypes collected on the 24 th 
of July 1901 on Pic du Midi de Bigorre in the French Pyrenees at about 2300 m (Petry 
1 904). The above mentioned specimen is here designated as lectotype to fix the status 
of the species. 



Acompsia (Acompsia) subpunctella Svensson, 1966: 188, fig. 19, pi. II, fig. 3. 

Material examined. Sweden: 3 6 , 19, Nb, Överkalix, 20.-2 1 .vii. 1 970, leg. Svensson (gen. slide 
GU 98/818d, GU 02/1 1 13 9, HH 21 18c? genitalia of one 6 in glycerol on celluoid) (ZMUC, ZSM); 1 d, 
Nb, Pajala, 3. vii. 1976, leg. Johansson (gen. slide GU 98/820 6) (ZMUC); Id, Norbotten, Seskarö, 
7.VÜ.1983, leg. Svensson (gen. slide GEL 870) (TLMF); 5ö\ Nb, Hedenäset, 26.-27.vi. 1995. leg. 
Hendriksen (gen. slide HH 1462) (HEND). Poland: Id, Puszcsa Borecka, L0.vii.1993, leg. Buszko 
(BUSZ). Russia: 6<3 , SW Altai, 1 5 km S Katanda, Kuragan valley, 1 200 m, 23. 25. vii. 1 983, leu. Mikkola, 
Hippa & Jalava (gen. slide GU 02/1 1 30) (ZMUH); 1 6 , Transbaikalia. Chita reg., Kyra, 900 m, 1 4.vii. 1 997, 
leg. Bidzilya, I. & O. Kostjuk (gen. slide GU 02/1 145) (ZMUH). 

Male (Fig. 11). Wingspan 15-17 mm. Labial palpus comparatively long, brown, 
with light apical ring at segment 2; inner surface lighter. Antenna greyish brown, slightly 
lighter ringed. Forewing greyish brown, mottled with faint light yellow; three dark 
spots: one elongate in fold, one shorter above it, and one round and more distinct at 
end of cell; veins in apical part often darker, cilia slightly lighter than forewing, with 
faint cilia line. Hindwing greyish brown with slightly lighter cilia. 



1 99 

1Z,Z ' Huemer & Karsholt: The genus Ac ompsia 

Female. Wingspan 13-14 mm. Similar to male, but with more light greyish (espe- 
cially along costa) and yellow in the forewing, by which the dark spots become more 
conspicuous. 

Male genitalia (Figs. 30, 47). Uncus rounded apically; cucullus with compara- 
tively long dilated part; sacculus lobe sub-oval, small, with long and almost straight 
distoventral (outer) margin; aedeagus comparatively small, without dentate sclerite. 

Female genitalia (Figs. 69-70). Apopyhses posteriores about 1 .5 times length 
of papillae anales; apophyses anteriores short, about length of segment VIII; sternite 
VIII with prolonged, medial sclerotizations; corpus bursae comparatively large, with 
indistinct patch of microtrichia. 

Distribution. Locally distributed in Fennoscandia (Sweden, Finland), Esto- 
nia (Jürivete et al, 2000: 43), Latvia (Karsholt & Riedl 1996: 121), north-western 
Poland and Russia (Kola Peninsula (Kozlov & Jalava 1994: 73)), Altai, Transbaikalia). 

Biology. The larva is stated to live from September in shoots/stems of Veronica 
longifolia L. (Scrophulariaceae), often together with larvae of Aethes triangulana 
(Treitschke, 1835) (Tortricidae) (Kerppola et al. 1985: 87; Svensson 1993: 35). Accord- 
ing to these authors the larva hibernates in the stem, pupating in spring, but that is doubted 
by Kaitila (1996: 103 and pers. comm.), who points out that this is only true for Aethes 
triangulana, whereas the larva of Acompsia subpunctella apparently leaves the feeding 
place for pupation, probably even before the winter. The adult occurs from late June to 
July. Vertical distribution: from sea level in northern Europe to about 1200 m in Sibiria. 

Remarks. A subpunctella is quite similar to A. delmastroella in external appear- 
ance, mainly differing by the lighter colour of the forewing and by the male sacculus 
lobe. 

The specimens studied by us from the Altai Mts. are rather worn, and it is hence 
difficult to state if they differ from specimens from N. Europe, apart from being slightly 
larger. 

Acompsia subpunctella was described from 3 males collected in the Swedish prov- 
ince of Norbotten (Svensson 1966). The figures of the adult and its genitalia leave no 
doubt about the identity. 

Acompsia {Acompsia) delmastroella Huemer, 1998: 516, figs 1-3, 10-11. 

Material examined. Holotype S 'MARMORA CN. Colle d'Esischie; m 2300 slm 14.08.1996; 
G. B. Delmastro & M. M. Saluto leg.' 'GEL 869 S P.Huemer' 'Holotypus S Acompsia delmastroella 
Huemer, 1999' (TLMF). Italy: IS paratypes, Cuneo, S Anna, Valle Traversagn, 2100 m, 8.VÜ.1994, leg. 
Delmastro; IS, ditto, but 1950 m, 25.vii.1995 (gen. slide GEL 864); 8c5, 3 9 , ditto, but 21.vii.2001, leg. 
Huemer; IS, Cuneo, Colle dell'Agnello, 2640 m, 20.vii.2001, leg. Huemer (all TLMF), 3c? Cuneo, Val 
Varita, Colle dell'Agnello, 2800 m, 30.vii.2001, leg. Baldizzone; 3S, Cuneo, Val Maira, Accegilo, 2500 
m, 3.viii.2001, leg. Baldizzone (all BLDZ, ZMUC). 

Male (Fig. 12). Wingspan 15-16 mm. Labial palpus long, slender, dark brown, mot- 
tled with lighter scales, especially on inner surface. Antenna dark brown. Forewing 
olive-brown, slightly shining, mottled with lighter scales; three rather indistinct, black 
spots: two elongate, above each other at 1/3, and one (more distinct) roundish at end of 
cell; termen slightly emarginated below apex, without black spots; cilia light brown 
grey. Hindwing dark grey, with lighter brown grey cilia. 



Nota lepid. 25 (2/3): 109-151 123 

Female . Wingspan 13-14 mm. Slightly brachypterous, smaller and more narrow- 
winged, but in other respects similar to male. 

Male genitalia (Figs. 31, 48). Uncus small, rounded laterally and distally; cucullus 
with stout and strongly dilated part; sacculus lobe sub-oval, comparatively small, with 
distinctly excavated distoventral (outer) margin; aedeagus without dentate sclerite. 

Female genitalia (Figs. 7 1-72). Sternite VIII with distinctly prolonged, 
medial sclerotizations; corpus bursae comparatively large, with medium-sized patch 
of microtrichia. 

Distribution. Endemic to the southwestern Alps (Alpi Cozie, Alpes Maritimes, 
Alpes-de-Haute-Provence) (PH pers. obs.; Nel 2001: 102). 

Biology. Host-plant and early stages unknown. Flight period: July to mid- August. 
The adults have been observed in the flowers of Helianthemum nummularium (L.) Mill. 
(Cistaceae) (Nel 2001: 102; PH. pers. obs.) and they were swept from low vegetation in 
the afternoon. However, they were not attracted to light on the same day. Preferred habi- 
tats are alpine meadows. Vertical distribution: from about 1900 to 2800 m. 

Remarks. The small size, olive-brown forewing colour with weakly developed 
spots and the shape of the sacculus lobe are of particular specific interest for identifi- 
cation of A. delmastroella. 

Acompsia delmastroella was described from 1 5 males collected in the south-west- 
ern Alps (Huemer 1998: 516). Meanwhile additional material could be found, and Nel 
(2001: 103, fig. 5) figured the female genitalia for the first time. 



Acompsia {Acompsia) muellerrutzi Wehrli, 1925: 137 

Material examined. France (Corse): \â, Ajaccio, 30.vi.1905 leg. Leonhard; 26, Vizzavona, 
3.VÜ.1905, leg. Leonhard; id, Monte Renoso, 17.vii.1905, leg. Leonhard (all DEI); 1 6, Statione de Val 
d'Ese, 1650 m, 24.vi.1994, leg. Skule & Skou (gen. slide GU 01/1070) (ZMUC). 

Male (Fig. 8). Wingspan 15-16 mm. Labial palpus long, slender; segment 2 brown, 
with light yeliow apical ring, lighter on inner surface; segment 3 greyish brown, mot- 
tled with light brown. Antenna dark brown, indistinctly ligher ringed. Forewing dark 
brown, mottled with light grey and yellow scales. Four rather large, black spots: one 
(indistinct) near base, one elongate in fold, one above it slightly towards base, and one 
at end of cell; termen oblique, without black spots; cilia light yellow grey. Hindwing 
dark grey, with greyish fringes. 

Female. Unknown. 

Male genitalia (Figs. 32, 49). Uncus broadly sub-rectangular; cucullus with 
comparatively short dilated part; sacculus lobe sub-oval, comparatively small, with 
distinctly excavated distoventral (outer) margin; aedeagus comparatively small, with 
very long and strongly dentate, distally curved sclerite. 

Female genitalia. Unknown. 

Distribution. Endemic to Corsica; according to Sattler (in litt.) also known 
from a single specimen collected in Sardinia (coll. Hartig). A. muellerrutzi is the only 
species of Acompsia found in Corsica, which is one of the few areas in Europe where 
A. cinerella has not been recorded. 



1 94 

iZ ^ Huemer & Karsholt: The genus Acompsia 

Biology. Host-plant and early stages unknown. The few adults known to date have 
been collected from late June to early July. Vertical distribution: probably from sea 
level to about 2400 m. 

Remarks. This species is mainly characterized by its small size and the exception- 
ally dark brown forewings. The genitalia (female unknown) are interestingly almost 
indistinguishable from those of A. caucasella sp. n., a species with a totally different 
external appearance. 

Acompsia muellerrutzi was described from a single male collected on 5.-6.vii. 1924 
on Monte d'Oro (Corsica) (Wehrli 1925: 137). The holotype could not be found in the 
Wehrli collection in the Naturhistorisches Museum Basel. However, the detailed de- 
scription leaves no doubt about the identity. 



Acompsia {Acompsia) caucasella sp. n. 

Material examined. Holotype 6 'RUSSIA Caucasus Psysh river 22.07.1994 A.Zhakov leg.' 
'Acompsia sp. S A. Bidzilya det., 1996' 'GU 02/1149 Ô RHuemer' (ZMKU). Paratypes. Russia: la, 
Caucasus, Kabardino-Balkarija, Psysh river, 20.vii.1994, leg. Zhakov (gen. slide GU 02/1139) (ZMKU). 

Male (Fig. 19). Wingspan 19-22 mm. Labial palpus comparatively long, slender, 
yellow-brown, second segment mid-brown on outer surface and on lower surface in- 
wards. Antenna dark brown, with quite distinct light rings. Forewing light ochreous 
brown with some yellow, mottled with mid-brown scales at base and in middle of 
forewing; three to four distinct, black spots: one elongate in fold, one above and one 
below it closer to base, the latter sometimes reduced, and one spot at end of cell; 
distinct mid-brown to dark brown subterminal fascia, interrupted by lighter veins; termen 
with distinct black spots at end of veins; cilia yellow grey. Hindwing grey, with light 
yellow grey cilia. 

Female. Unknown. 

Male genitalia (Figs. 33, 50). Uncus broadly sub-rectangular; cucullus with 
comparatively short dilated part; sacculus lobe sub-oval, comparatively small, with 
distinctly excavated distoventral (outer) margin; aedeagus with very long and strongly 
dentate, distally curved sclerite. 

Female genitalia. Unknown. 

Distribution. Only known from the Caucasus mountains. 

Biology. Host-plant and early stages unknown. The few adults known to date 
have been collected in the last third of July. Vertical distribution: not stated on the 
original labels. 

Remarks. The male genitalia are very similar to those of A. muellerrutzi. How- 
ever, A. caucasella sp. n. cannot be mixed with any of the known Acompsia due to its 
characteristic ochreous brown colour and the markings of the forewing. 

Etymology. Named after the type region. 



Acompsia {Acompsia) minor ella (Rebel, 1899: 180) (Brachycrossata) 

Material examined. Lectotype S (here designated) 'LECTO-TYPE' 'Le Sarche Juli 97 Rebel' 
'minorella Rbl Type' 'LECTOTYPE Ô Brachycrossata minorella Rebel det. L. M. Pitkin, 1987' (NHMW). 



Nota lepid. 25 (2/3): 109-151 125 

Czech Republic: 19, paralectotype, TARA-LECTO-TYPE' 'Böhmen [Reichstadt] 1835' 'minorella 
Rbl Type' (NHMW). France: 26, Cannes, leg. Millière (BMNH). Italy: 16, Monte Baldo, Lumini, mid- 
v.1967, leg. Burmann (gen. slide 4102 Tokâr) (TLMF); 16, Trento, Riva, Rochetta, 13.V.1927, leg. 
Osthelder; 19, Trento, Riva, Bastione, 13.V.1927, leg. Osthelder (all ZSM); 36, Trento, Mattarello, 
22.vii.1945, leg. Klimesch (BMNH, ZMUH, ZSM); 1 ex, Rome, Colosseum, bred iv.1869 (abdomen 
missing); 19, Rome, Forum, 18.V.1917, leg. Walsingham; 56, Latinum, Frascati, 27.V.1917, leg. 
Walsingham (gen. slide BM 13923); 19, ditto, but 4.vi.l917 (all BMNH). Switzerland: 19, Tessin, 
Capolago, 5.viii., leg. Krüger (gen. slide 4103 Tokâr) (TLMF); 26, Tessin, Mendrisco, 19. & 27.V.1927 
(BMNH). Austria: 1 9 , paralectotype, 'Prater 1859' (gen. slide 16.538) (NHMW). Slovenia: Ljubljana, 
16, l.ix.1927, leg. Hafner (gen. slide GEL 887); 19, ditto, but 18.viii.1928 (gen. slide GEL 1045) (all 
TLMF); \6, ditto, but 15.viii.1927 (NHMW). 

Male (Fig. 13). Wingspan 15 mm. Labial palpus long, slender; segment 2 dark 
brown on outer surface, with light apical ring; other surfaces of segment 2 and seg- 
ment 3 light yellow, motleded with brown. Antenna light brown grey, indistinctly 
lighter ringed. Forewing greyish brown, overlaid with yellow grey or light brown 
scales; three distinct, black spots: one elongate in fold, one rounded above it, and 
one larger, oblique at end of cell; a faint transverse fascia at 4/5; termen oblique, 
with indistinct, black spots at end of veins; cilia yellow grey. Hindwing dark grey, 
with greyish cilia. 

Female. Wingspan 15 mm. Similar to male. 

Male genitalia (Figs. 34, 51). Uncus rounded apically; cucullus with par- 
ticularly broad and stout dilated part; sacculus lobe sub-oval, small, with weakly exca- 
vated distoventral (outer) margin; aedeagus with undentate sclerite. 

Female genitalia (Fig. 73). Apopyhses posteriores about 1 .5 times length of 
papillae anales; apophyses anteriores short, about length of very short segment VIII; 
sternite VIII with distinctly prolonged medial sclerotizations; ductus bursae compara- 
tively long; corpus bursae comparatively small, with distinct patch of microtrichia; 
entrance of ductus seminalis in posterior half. 

Distribution. Only known from scattered localities in Austria, the Czech Re- 
public, France, Italy, Slovenia and Switzerland. 

Biology. Host-plant and early stages unknown. There is no host-plant record on 
the single specimen listed above as bred. The adults have been observed in May and 
June (Eisner et al. 1999: 57) and again from July to September, most probably in two 
generations. Preferred habitats are warm forest steppes. Vertical distribution: insuffi- 
ciently known, but probably restricted to lowland localities. 

Remarks. The characteristic greyish brown colour of the forewing with a trans- 
verse fascia makes this species unmistakable. The above mentioned specimen is here 
designated as lectotype to fix the status of the species. 



Acompsia (Acompsia) tripunctella (|Denis & Schiffermüller|, 1775: 319) (Tinea) 

Material examined. Ncotype 6 (here designated) k Austr. inf. Fisehauerberge Brunn 11.5.57 
Hans Malicky' (TLMF). Germany: 26, Bayern, Hausham, 520 m, mid-viii. 1970, leg. Zürnbauer; 1 6, 
Bayern, Ob. First-Alm, 1400 m, late vii.1967, leg. Zürnbaucr; 1 6, Bayern, Rotwand, late vi. 195 1, leg. 
Pfister (all TLMF). France: 16, Alpes Maritimes, Cim de Sénéca, 2200 m, 1 S.vii. 1 99 1 , leg. Huemer & 
Tarmann; 3d, 29, Alpes Maritimes, Marguareis, Navela, 2100-2200 m, 1 8.-2 l.vii. 1990, leg. Huemer 
& Tarmann; \6, ditto, but 2 l.vii. 1990 (gen. slide GEL 169); 26, Alpes Maritimes, La Pra, 1600 m, 
2 1 .ix. 1 969, leg. Dujardin; 2 6 , Alpes Maritimes, Le Authion, 1 800-2000 m, 1 9.viii. 1 953, leg. Dujardin; 
\6, Alpes Maritimes, Jalorgues, 2000 m, 28.vii.1974, leg. Dujardin; 1 6, Alpes Maritimes, Bousieyas, 



l^V Huemer & Karsholt: The genus Acompsia 

1800 m, 18.vii.1971, leg. Dujardin; 46, Basses Alpes, SW Castel de Restfond, Roche Chevalière, 2480 
m, 25.vii.1990, leg. Huemer & Tarmann; 6 c?, ditto, but Ste. Caire Brun N, 2420 m, 25.-26.vii. 1990; 2 c?, 
Hautes Alpes, Galibier, 2400 m, late viii.1973, leg. Zürnbauer; le?, Hautes Savoie, Plan Praz, 2000 m, 
27.vii.1950, leg. Dujardin (ail TLMF); le?, Ecrins, Allefroide, 18.viii.1995, leg. Schepler (gen. slide GU 
02/1119) (ZMUC). Spain: 1 c? , Huesca, 4 km W Laco Urdiceto, lOkmNWBielsa, 2000 m, 10.vii.1992, 
leg. Fibiger (gen. slide HH 3546) (ZMUC). Poland: le?, Tatra Mts., Sarnia Skala, 1350 m, 3.VÜ.1987, 
leg. Buszko (BUSZ). Slovakia: le?, centr., Javoric, 17.vi.1951, leg. Patocka; le?, Novoveska Huta, 
8.viii.l980,leg.Reiprich(gen. slide HH3383); le?, ditto, but 3. vi. 1981; le?,SpisskâNovâVes, 19.vii.1980, 
leg. Reiprich (all ZMUC). Italy: 2 e?, Piémont, Colle di Sestrières, 2100-2700 m, L-6.viii.1937, leg. 
Zerny; 2e?, Bergamo, Alpi Orobie, Val d'Arera, 2000 m, 14.-15.viii.1992, leg. Huemer; 19, Brescia, 
Adamello, Pso. Croce Domini, Corna Bianca, 2100 m, 15.viii.1993, leg. Huemer; 5 e?, Trento, Adamello, 
Rif. Mandron, 2500 m, mid viii.1985, leg. Pavlas; le?, Trento, Monte Baldo, Bocca di Navene, 1500 m, 
29.vi.1985, leg. Burmann; 1 9, ditto, but 14.vii.1987, leg. Burmann & Huemer; le?, Trento, Tresnico, 
400 m, early vi. 1973, leg. Zürnbauer; le?, Trento, Sella group, Piz Ciavazes south, 2150 m, 7.viii.l991, 
leg. Huemer (gen. slide GEL 324); le?, Südtirol, Kurzras, 2100 m, early vii.1967, leg. Zürnbauer; le?, 
Südtirol, Trafoi, 1600 m, 24.vii.1955, leg. Malicky; le?, Südtirol, Schnalstal, 1000 m, late ix. 1970, leg. 
Zürnbauer; 1 e?, Südtirol, Sextener Dolomiten, Schluderbach, 1450 m, 2.vii. 1991, leg. Huemer (all TLMF); 
1 e? , Südtirol, Sextener Dolomiten, Cimabanche, 22.vii. 1990, leg. Klimesch (ZSM); 2 c? , Piemonte, Cueno, 
Parco Natur. Reg. Alpi, Marittime,Valle della Valetta, Piano del Casa d. Re, 1800 m, 24.vii.1997, leg. 
Baldizzone (BLDZ); 1 e?, ditto, but dint, di S. Giacomo, di Entracque, Rocca Barbis, 1750 m, 1 l.vii.1998, 
leg. Baldizzone (ZMUC); le?, ditto, but S. Giac. di Entracque, sent. Rifugio Soria, 1800-2100 m, 
18.vii.1998, leg. Baldizzone (BLDZ); 2 e? , Limon sul Garda, 26.-30.vii. 1986, leg. Baungaard; 3 e? , Monte 
Baldo, Rif. Novezza, 1600 m, 27.-29.vi.1981, leg. Skou & Skule; 6 c?, ditto, but 21. vii. 1983, leg. Skou & 
Skule; le?, ditto, but Ferrara, 1100 m, 27.-29.vii. 1981, leg. Skou & Skule; 26, Mt. Baldo, SW Naole, 
1250 m,22.vi. 1986, leg. Schepler; le?, 1 9, Monte Baldo, Naole, 1500-1600 m, 21. vii. 1989, leg. Karsholt; 
1$, ditto, but above Prada, 1200 m, 22.vii.1989, leg. Karsholt; 19, Valle d'Aosta, above Cogne, 
24.vii.1989, 1800-2000 m, leg. Karsholt; 16, Dolomiti, Pso Pordoi, 2240 m, 10.viii.1995, leg. Schepler 
(all ZMUC); 1 9 , Piemonte, Cueno, Val Maira, Chiappera, 2100 m, 10.viii.2001, leg. Baldizzone (BLDZ). 
Switzerland: le?, Graubünden, Umbrail, 2100 m, 3 1 .viii.1987, leg. Burmann, Huemer & Tarmann; 4e?, 
Graubünden, Spina, 1600 m, 5.vi.l960, leg. Malicky; 2 e? , Appenzell, Seealptal, 1000 m, 28.vi.1958, leg. 
Malicky (all TLMF); le?, Göschenen, 1 .vii. 1951, leg. ?; lc?, Verbier, La Tournelle, 25.vii.1968, leg. 
Traugott-Olsen; 2e?, Route du Gd. St. Bernard / VS, Cantine de Proz, 1900 m, 29.vii.1968, leg. Traugott- 
Olsen; 2c?, Engadin, 8 km SW St. Moritz, Sils-Maria, 1850 m, 13.vii.1989, leg. Karsholt (all ZMUC). 
Austria: lc?, Vorarlberg, Lech, Schafalpe, 1700 m, 21. vii. 1954, leg. Süssner; 19, Nordtirol, St. Anton/ 
Arlberg, Schöngraben, 1400 m, 16.vii.1959, leg. Süssner; 2 c?, Nordtirol, Rettenbachtal, 2600 m, 
14.ix.1987, leg. Burmann & Huemer; 1 e? , Nordtirol, Obergurgl, 1950 m, 22.viii.1987, leg. Huemer; le?, 
Nordtirol, Pillermoor, 18.vii.1988, leg. Burmann & Tarmann; le?, Nordtirol, Zams, Steinseehüttenweg, 
1000 m, 17.ix.1987, leg. Huemer; 19, ditto, but 13.viii.1988, leg. Burmann & Huemer; le?, Nordtirol, 
Weißenbach, Feldele, 910 m, 24.viii.1989, leg. Huemer; 1 c? , Forchach, Johannesbrücke, 901 m, 17.vi.1989, 
leg. Kahlen; le?, Rißtal, Weitgriesalm, 900 m, 29.vi.1993, leg. Huemer; le?, ditto, but 14.viii. 1993; 1 c?, 
ditto, but 8.vi. 1993, leg. Cerny; 1 9, Nordtirol, Ehrwald, 31. viii. 1968, leg. Hernegger; le?, 1 9, Nordtirol, 
Seegrube, 27.vii.1961, leg. Hernegger; le?, Nordtirol, Langer Sattel, 13.viii.1965, leg. Hernegger; \6, 
Nordtirol, Innsbruck, 6.VÜ.1957, leg. Hernegger; 1 e?, Nordtirol, Höttinger Graben, 1200 m, 26.vii.1966, 
leg. Hernegger; 1 e? , Nordtirol, Innsbruck, Kranebitten, 4.V.1968, leg. Burmann; 1 6, Nordtirol, Zirl, 600 
m, 1. ix. 1969, leg. Burmann; lc?, Nordtirol, Mosern, 1200 m, 18. viii. 1969, leg. Burmann; lc?, 
Nordtirol,Valsertal, 1400 m, 23.vi.1959, leg. Hernegger; lc?, Nordtirol, Vennatal, 1400 m, 14.vi.1938, 
leg. Scholz; 1 c?, Osttirol, Rieserfernergruppe, Patschertal, 2080 m, 15.viii.1989, leg. Tarmann; 1 6, 69, 
Osttirol, Venedigergruppe, Sajatmähder, 2200-2600 m, 30.vii.1993, leg. Ryrholm; 2c?, Osttirol, 
Venedigergruppe, Maurer Alpe, 2300-2500 m, 5.viii.l993, leg. Rakosy; 26, Osttirol, Schobergruppe, 
Stanis Alm, 2000 m, 23 .vii. 1989, leg. Tarmann; lc?, Osttirol, Granatspitzgruppe, S Sudetendeutsche 
Hütte, 2500-2650 m, 16.viii.1991, leg. Tarmann; le?, 1 9, Osttirol, Kartitsch, 1600 m, 17.vii.1964, leg. 
Süssner (gen. slide GEL 1047 9); lc?, 1 9, ditto, but 9. vii. 1964; le?, Kärnten, Dobratsch, 2000-2100 m, 
23.vii.1993, leg. Huemer & Wieser; 1 c?, Kärnten, Karawanken, Kossiak, 1700 m, 25.vi.1949, leg. Pinker; 
le?, Kärnten, Loibltal, vii. 1950, leg. Pinker (gen. slide GEL 54); le?, Steiermark, Lainbach, 1. viii. 1920, 
leg. Zerny; 1 6 , Niederösterreich, Dürrenstein, 1400 m, 4.ix.l962, leg. Malicky (all TLMF); 1 6, Umgebung 
Wien; 2 c?, Oberösterreich, Ternberg, 14.vi.1961, leg. Johansson; 1 e?, Kärnten, Arnoldstein, Gailtal, 600 
m, 24.vi.1981, leg. Skou & Skule; 1 e? , Osttirol, Glocknergruppe, above Kais, 1700-2200 m, 28.vii.1991, 
leg. Karsholt & Rakosy; lc?, Osttirol, Innervillgraten, 1800 m, 15.vii.1981, leg. Schnack; 2c?, Osttirol, 
Lavant, path to Lav. Alm, 1200 m, 2.viii.l991, leg. Deutsch, Huemer & Karsholt (all ZMUC); le?, 
Steiermark, Reichenstein, 5.viii.l900 (ZSM). Slovenia: le?, Triglav, Vrata, 1100 m, 29.vii.1984, leg. 
Schnack (ZMUC); le?, Solcava Logarska dolina, 900 m, 25.-26.vi. 1988, leg. Lichtenberger (TLMF). 
Croatia: le?, Velebit, Zavizan, 1600 m, 15.viii.1978, leg. Baldizzone (ZMUC); le?, ditto, but 1400 m, 
12.viii.1982 (BLDZ); 2c?, Karlovac, 250 m, late viii.1979, leg. Zürnbauer (gen. slide GEL 880) (TLMF). 
Yugoslavia (Montenegro): 3 c?, Durmitor, Komarnica, Klijestina, 1400 m, 24.vii.1985, leg. Jaksic (gen. 



Nota lepid. 25 (2/3): 109-151 127 

slide GEL 325) (TLMF). Romania: \â, Retyezat, Ujhelyi, 23.vii.1910 (ZMUC). Ukraine: \â E. 
Carpathian, Vorokhta, 21. vi. 1964, leg. Falkovitsh (gen. slide GU 02/1143) (ZMKU). 

Male (Figs. 14—15). Wingspan 19-23 mm. Labial palpus long, slender, greyish brown, 
mottled with light brown on inner surface. Antenna brown, indistinctly lighter ringed. 
Forewing clay-brown to greyish brown, mottled with light greyish (especially along costa), 
yellow brown and some black scales; three distinct, black spots: one elongate in fold, one 
above it closer to base, and one rounded or oblique elongate at end of cell, rarely a small 
black dash below of the latter; termen slightly emarginated below apex, frequently with a 
row of black dots at end of veins; cilia light yellow grey. Hindwing grey; cilia as in forewing. 

Female (Fig. 16). Wingspan 16-18 mm. Slightly brachypterous, with narrower 
wings than in male. Forewing darker brown, with more distinct light area at basal half 
of costal area; black spots less distinct, especially the two basal ones. 

Male genitalia (Figs. 35, 52). Uncus slightly dilated towards apex; cucullus with com- 
paratively long dilated part; sacculus lobe sub-oval, very large and broadly rounded, 
distoventral (outer) margin deeply excavated; aedeagus with very long, dentate sclerite. 

Female genitalia (Figs. 74-75). Apopyhses posteriores about two times 
length of papillae anales; apophyses about length of segment VIII; sternite VIII with 
weakly prolonged, broad medial sclerotizations; ductus bursae long; corpus bursae 
with medium-sized patch of microtrichia. 

Distribution. Due to the confusion with externally similar species the distri- 
bution is insufficiently known. Reliable or confirmed records are known mainly from 
montane areas: Alps, Apennines, Carpathians and the Balkans. We examined only one 
specimen from Spain, and most records from the Pyrenees and from Central Spain are 
due to misidentifications of A. antirrhinella ox A. pyrenaella sp. n. Records from Euro- 
pean Russia, Transbaikalia and the Caucasus (Ponomarenko 1997b: 10) require con- 
firmation and are at least partially based on further misidentifications. The record from 
Albania (Karsholt & Riedl 1996: 121 ) refers to A. ponomarenko ae sp.n., and one from 
Finland (Eisner et al. 1999: 57) to A. subpunctella. 

Biology. The early stages were described by Chrétien (1899), who reared A. 
tripunctella from eggs: Among different plants offered the small larvae chose Plan- 
tago alpina L. (Plantaginaceae) for food. They emerged about 15 days after oviposi- 
tion. The full-grown larva measures 12-13 mm; it is black brown slightly tinged with 
greenish, without longitudinal line; incisions between 1 st , 2 nd and 3 rd segments later- 
ally whitish grey; warts big and intensively black; head and thoracic shield shining 
black; thoracic legs long and black; abdominal legs black with brown crown. 

The larva makes no spinning - apart from a silken tube covered with leaf litter for 
hibernating. It pupates in June on the ground in a loose cocoon. Chrétien also found 
full-grown larvae under stones in September in 2400 m altitude, and he therefore con- 
cluded that A. tripunctella in higher altitudes may need two years for its development 
(Chrétien 1899: 203-204). 

Flight period: June to September. The adult occurs in various habitats such as clear- 
ings and edges of forests, steppe slopes and various meadows up to the alpine zone. It 
is readily attracted to light but can also be found during the day. Vertical distribution: 
from about 500 to 2500 m. 



1 ^* Huemer & Karsholt: The genus Acompsia 

Literature records giving Antirrhinum majus L. (Scrophulariaceae) as host-plant for A. 
tripunctella (e.g. Ponomarenko 1997b: 10) most probably refer to A. antirrhinella, and 
that may also be true for the association with Linaria cymbalaria (L.) Mill. 
(Scrophulariaceae) originating from Chrétien (Lhomme 1930: 120). Lhomme (loc. 
cit.) also mentions Globularia as a hostplant for A. tripunctella, however, without 
further reference. 

Remarks. A. tripunctella shows some variation, which at least partly seems to be geo- 
graphically correlated. Male specimens from the central Alps (Austria and Switzerland) 
have greyish brown forewings, frequently mottled with some number of black scales, whereas 
males from the Monte Baldo area in northern Italy but also from other localities on calcar- 
eous soil have lighter greyish brown forewings. Males from Slovakia and other parts of 
eastern Europe are more plain brown, with few black scales, and frequently without dark 
spots along termen. Populations from the southeastern Alps of Austria (Carinthia) and 
Slovenia to Croatia and Yugoslavia (Montenegro) have shorter, more rounded forewings 
than typical A. tripunctella, with largely reduced black markings and usually only one well 
developed spot at the end of cell. Furthermore the hindwings are darker. However, we 
could find no genitalia differences between these populations and hence they are regarded 
a conspecific with A. tripunctella. This species is very similar to some other Acompsia but 
can be readily distinguished by the very large sacculus lobe. 

The original description of Tinea tripunctella ('Flachsbräunlichter Seh. mit 3 
schwarzen Punkten') is poor and leaves some doubt about the identity. Unfortunately 
in 1848 the collection of Denis & Schiffermüller was destroyed by fire (Horn & Kahle 
1935-1937: 243). However, Charpentier (1821: 119), who studied the collection of 
Schiffermüller prior to its destruction, stated that the specimen(s) of Tinea tripunctella 
belonged to the same species as figured under that name by Hübner (1796, pi. 32, fig. 
217), and that figure does not contradict the current interpretation ofthat name. To fix 
the identity of T. tripunctella we designate the mentioned specimen as the neotype. 



Acompsia (Acompsia) ponomarenkoae sp. n. 

Material examined. Holotype 6 'Greece, Ipiros, Katara pass, 1 500-1 700 m, 24.-27.V. 1 994, leg. 
O. Karsholt' (ZMUC). Paratypes. Albania: 1 6, Korab, 23.-31.vii.1918; 26, GjalicaLjums, 17.-26.vi.1918 
(gen. slide 16.639) (all NHMW). Greece: allotype $, caught in copula with holotype and mounted on 
same polyporus (ZMUC); paratypes 96, 8$, same data as holotype (gen. slide GU 01/1079$; HH 
3384) (ZMUC, TLMF); 1 6, ditto, but 1600 m, 1 1 .viii. 1985, leg. Fibiger; 1 6, ditto, but 1800 m, 27.vii.1990, 
leg. Fibiger (gen. slide GU 01/1068$); 16, Evrytania, Timphrystos, 1900 m, l.vii.1985, leg. Schepler 
(gen. slide HH 3386) (all ZMUC); 1 6, Epirus, Katara Pass, 1650 m, 26. vi. 1991, leg. Somerma & Väisänen; 
16, Epirus, Zagoria, Skamneli Timfi, 1400 m, 24.vii.1991 leg. Somerma & Väisänen; \6, ditto, but, 
Goura, 2200 m, 24.vii.1991, leg. Somerma & Väisänen (all ZMUH). 

Male (Fig. 17). Wingspan 20-24 mm. Labial palpus long, slender, dark brown, mot- 
tled with yellow brown, especially on inner surface. Antenna dark brown, indistinctly 
lighter ringed. Forewing rather plain light brown, with scattered black brown scales; 
three small, black spots: one (sometimes very weak) in fold, one above it a little to- 
wards base, and one (more distinct) at end of cell; termen emarginated below apex, 
with rather distinct, small black spots at ends of veins; cilia light brown. Hindwing 
grey, with yellow grey fringes. 



Nota lepid. 25 (2/3): 109-151 129 

Female (Fig. 18). Wingspan 16-17 mm. Reasonably brachypterous. Labial palpus 
of same colour as in male, but shorter. Antenna dark brown. Forewing about half as 
broad as in male, dark brown, overlaid with lighter brown scales; a lighter subcostal 
streak from base; two indistinct, black spots at 1/3 and 2/3; termen oblique, sometimes 
with a few black scales; fringes light brown. Hindwing about two thirds as broad as in 
male, grey, with lighter, brown grey cilia. 

Male genitalia (Figs. 36, 53). Uncus rounded distally; cucullus with 
modereately weakly dilated part; sacculus lobe medium-sized, sub-oval, delimited from 
posterior part, with irregularly emarginated distoventral (outer) margin; aedeagus 
distodorsally distinctly pointed, with very long and strongly dentate sclerite. 

Female genitalia (Figs. 76-77). Apopyhses posteriores about three times 
length of papillae anales; sternite VIII with extremely long medial sclerotizations, 
extending beyond apices of apophyses anteriores; ductus bursae short; corpus bursae 
large, with very large patch of microtrichia. 

Distribution. Only known from Albania and Greece. Further records of A. 
tripunctella from the Balkan Peninsula have to be checked and may refer to this species. 

Biology. Host-plant and early stages unknown. The few adults known to date 
have been collected during the day and at light from late May to late July, at altitudes 
between 1400 and 2200 m. 

Remarks.^, ponomarenkoae sp. n. is closely related to A. schepleri sp. n. from 
which it differs by lacking the dark veins, and from A. fibigeri sp. n. which has smaller 
sacculus lobes. From the also very similar A bidzilyai sp. n. it differs by the light brown 
rather than light greyish brown colour of the forewing without dark scales near the base. 
Furthermore, the forewings are narrower and costally less convex. The male genitalia 
are again very similar though the sacculus lobe is smaller in A. ponomarenkoae sp. n. 

Etymology. Named after Dr. Margarita Ponomarenko (Vladivostok) who dis- 
covered its distinctness independently of us. 



Acompsia (Acompsia) schepleri sp. n. 

Material examined . Holotype 6 'Turkey, Prov. Erzincan Kizildag Gecidi, 2100 m. 19.viii.1993. 
Leg. Fritz Schepler' 'Gen. praep. nr. 4848 6 O. Karsholt' (ZMUC). Paratypes. Turkey: 13d, same data as 
holotype (gen. slide GU 01/1067) (TLMF, ZMUC). 

Male (Fig. 20). Wingspan 22-24 mm. Labial palpus comparatively long, slender; 
segment 2 dark brown mottled with whitish on upper and inner surface and with 
white apical ring, segment 3 lighter. Antenna brown, indistinctly lighter ringed. 
Forewing with rounded apex, light brown, with stripes of black scales between veins; 
one slightly oblique, black spot at end of cell; termen without emargination below 
apex, lined with black scales, especially at end of veins; cilia brown grey, lighter 
beyond cilia line. Hindwing brown grey; cilia yellow at base, light grey beyond grey 
cilia line. 

Female. Unknown. 

Male genitalia (Figs. 37, 54). Uncus broadly sub-rectangular; cucullus with 
particularly broad dilated part; sacculus lobe medium-sized, sub-oval, distal part marked- 



1 3v Huemer & Karsholt: The genus Acompsia 

off, caudal part with very long and straight distoventral (outer) margin; aedeagus with 
very long and strongly dentate sclerite. 

Female genitalia. Unknown. 

Distribution. Only known from one mountain locality in central Turkey. 

Biology. Host-plant and early stages unknown. The adults have been collected 
in mid- August at light at an altitude of about 2100 m. 

Remarks . Similar to A. ßbigeri sp. n. in genital characters (female unknown). 
However, due to its large size and the forewings with black stripes between the veins 
and the rounded apex A. schepleri sp. n. is easily separated from other species of 
Acompsia. It may resemble some species of Chionodes Hübner, but can be easily dis- 
tinguished by the thin 2 segment of the labial palpus without ventral brush, the pre- 
genital segment of the males and genitalia characters of both sexes. 

Etymology. Named after the Danish lepidopterist Fritz Schepler who collected 
the type series. 

Acompsia (Acompsia) fibigeri sp. n. 

Material examined. Holotype S 'Turkey, Gümüshane, Kop pass, 2400 m, 13.-14. ix.1993, leg. 
M. Fibiger' (ZMUC). Paratypes. Turkey: 56, same data as holotype (gen. slide GU 02/1112) (TLMF, 
ZMUC). 

Male (Fig. 21). Wingspan 22-23 mm. Labial palpus comparatively long, slender, 
greyish brown on outer and lower surface, yellow on inner and upper surface; apex of 
segment 2 light. Antenna dark brown, indistinctly lighter ringed. Forewing brown, 
mottled with yellow brown and some darker scales; one weak, oblique, black spot at 
end of cell; termen weakly emarginated below apex, without black spots at end of 
veins; cilia yellow grey. Hindwing grey, with light yellow grey cilia. 

Female. Unknown. 

Male genitalia (Figs. 38, 55). Uncus broad, sub-rectangular; cucullus with 
broadly dilated part; sacculus lobe comparatively small, rounded, caudal part with 
very long and slightly emarginated distoventral (outer) margin; aedeagus with very 
long and strongly dentate sclerite. 

Female genitalia. Unknown. 

Distribution. Only known from a mountain area in eastern Turkey. 

Biology. Host-plant and early stages unknown. The adults have been collected 
in mid-September at light at an altitude of about 2400 m. 

Remarks . Very similar to A. schepleri sp. n. in genital characters (female un- 
known) but differing by the absence of black stripes in the forewing and furthermore 
by the small and rounded sacculus lobe. 

Etymology. Named after the Danish lepidopterist Michael Fibiger who col- 
lected the type series of this new species and other important material used for this 
paper. 

Acompsia (Acompsia) bidzilyai sp. n. 

Material examined. Holotype S 'Zabajkale Sochodinskij zapovednik r. Agucakan 1000 m light 
19.07.1997 A. Bidzilja, I. Kostjuk, O. Kostjuk [in Cyrillic]' 'GU 02/1144 S P.Huemer' (ZMKU). Paratype. 



Nota lepid. 25 (2/3): 109-151 131 

Russia: Id, E Transbaikalia, Chita reg., 75 km N Mogoci, Tupik, 8.VÜ.1993, leg. Kostjuk, Kostjuk, 
Golovushkin & Salata (gen. slide GU 02/1142) (ZMKU). 

Male (Fig. 22). Wingspan 19-20 mm. Labial palpus comparatively long, slender, 
light greyish brown, somewhat lighter on inner surface. Antenna mid-brown. Forewing 
light greyish brown; small subbasal patch of dark scales; three distinct, rather large, 
black spots: one elongate in fold, one above it closer to base, and one rounded at end of 
cell; costa convex towards termen, termen straight, with a row of black dots at end of 
veins; cilia concolorous with forewing. Hindwing grey; cilia as in forewing. 

Female. Unknown. 

Male genitalia (Figs. 39, 56). Uncus rounded distally; cucullus with 
modereately weakly dilated part; sacculus lobe medium-sized, sub-oval, without strong 
separation from posterior part, with irregularly emarginated distoventral (outer) mar- 
gin; aedeagus distodorsally distinctly pointed, with long and strongly dentate sclerite. 

Female genitalia. Unknown. 

Distribution. Only known from Transbaikalia (Russia). From this region the 
new species was doubtfully recorded as A. tripunctella (Budashkin & Kostjuk 1994: 
20). 

Biology. Host-plant and early stages unknown. The few adults known to date 
have been collected in July. 

Remarks.! bidzilyai sp. n. is very similar to other species of the group exter- 
nally but differs by a small subbasal patch of dark scales. Furthermore the wings are 
more rounded distally and the ground colour is plain light greyish brown. 

Etymology. Named after Dr. Oleksiy Bidzilya (Kiev), who already suspected 
an undescribed species. 



Subgenus Telephila 

Acompsia (Telephila) schmidtiellus (Hey den, 1848: 954) (Ypsolophus) 

Ypsolophus durdhamellus Stainton 1849: 12. 
Hypsolopha quadrinella Herrich-Schäffer 1854: 154. 

Material examined. Denmark: 1 9 , LFM, Maribo, la. 2. vi. 1918, Origanum, leg. Sonderup (gen. 
slide HH 1978); 3d, LFM, Hovblege Bakker, 2.viii.l961, leg. Traugott-Olsen (gen. slide ETO 442); 7d, 
59, SZ, Fladsâ, la. 24.v.-18.vi.l973, Origanum vulgare, leg. Karsholt (gen. slides OK 2139c?, 21409, 
2141 d); 19, ditto, but la. 10.vi.1979, leg. Hendriksen (gen. slide HH 2016); 3 c5 , LFM, Mons Klint, 
26.vii.1997, leg. Karsholt; 2d, 3 9, ditto, but la. 12.vi.1999, Origanum vulgare, leg. Karsholt; 36 addi- 
tional, undissected specimens from Denmark (all ZMUC). Germany: 1 9, Württemberg. Markgröningcn. 
20.vii.1956 e.1., Mentha, leg. Süssner (gen. slide GEL 1059); 1 9, Württemberg. Marbach Neckar, 
Otterbachtal, 2.viii. 1 956 e.l., Origanum vulgare, leg. Süssner; ld, Württemberg. Marbach Neckar. 
26.vi.1953 e.l., Origanum vulgare, leg. Süssner; 1 d, ditto, but 28. vi. 1953 e.l. (gen. slide GEL 1058); 1 d, 
Württemberg, 2 km SSW Laufen - Neckar, 170 m, 15.viii.1978, leg. Süssner (all Tl. MF). Andorra: ld, 
Arnisal, 1500 m, l.viii.1997, leg. Baungaard (ZMUC). Spain: 1 d, Andalucia, Sierra Nevada, Cam. D. 
Valeta, 2050 m, 3.viii.l986, leg. Traugott-Olsen (ZMUC); Id, Lerida, Arams. Trcmp Valley. 700 m, 
8.VÜ.1993, leg Skou (ZMUC). Italy: Id, Picmontc, C'uneo. Parco Natur. Reg. Alpi Manttime. Valdieri, 
900 m, 17.vii. 1999, leg. Baldizzone; Id ditto, but 29. vii. 2001 (all BID/). 

Male (Fig. 23). Wingspan 14-16 mm. Segment 2 of labial palpus with large ventral 
scale-brush, black brown at outer and lower surface, yellow at inner and upper surface; 
segment 3 long and thin, yellow, mottled with black-brown at lower surface. Antenna 



1-3^ Huemer & Karsholt: The genus Acompsia 

slightly serrated, with cilia, light brown, indistinctly lighter ringed. Forewing light 
orange-brown, mottled with some black scales; two or three black spots as follows: 
one distinct in cell, one indistinct (sometimes missing) above it, and one rather indis- 
tinct (rarely missing) at end of cell; a small patch of black scales at tornus; an indistinct 
light fascia from outside tornus to costa; termen emarginated below apex, with a fine, 
black line; cilia concolourous with forewing; hindwing grey, with yellow cilia. 

Female. Wingspan 15-17 mm. Similar to male, but slightly larger, with thinner, 
unserrated antenna and more plain orange-brown forewing. 

Male genitalia (Figs. 40, 57). Uncus sub-rectangular; cucullus with particu- 
larly long dilated part; sacculus lobe covered with microtrichia in distal part, weakly 
convex and comparatively small, with weakly concave distoventral (outer) margin; 
sclerites of vinculum even throughout; aedeagus with long, dentate sclerite, vesica 
without sclerotized, spiralled distal part. 

Female genitalia (Figs. 78-79). Papillae anales large; apopyhses posteriores 
about 1.5 times length of papillae anales; apophyses anteriores about length of segment 
VIII; sternite VIII with distinctly prolonged medial sclerotizations; ductus bursae com- 
paratively long and evenly broadened towards corpus bursae, with distinct sclerite 
anteriorly; corpus bursae comparatively small, globular, with small patch of microtrichia. 

Distribution. Found locally in central, eastern and southern Europe (Karsholt 
& Riedl 1996: 121), from Denmark in the north to southern Spain and Portugal. To the 
east it is found in Ukrainia (Eisner et al 1999: 57). A record from Estonia (Piskunov 
1990: 1004) falls outside the known distribution area and is not accepted for the Esto- 
nian checklist (Jiirivete 2000). 

Biology. The larva and pupa were recently described and figured in detail 
(Huertas-Dionisio 2002). The larva is slim, yellow white, with a , small hart- formed, 
shinning dark brown head and lighter brown prothoracic shield; segments three and 
four purplish brown, interrupted at the segmental divisions with yellow white; central 
dorsal stripe deep brown purple, on each side boardered by a broad stripe of the same 
hue; abdominal segments with rows of purplish tubercular dots and darker spots with 
short hairs; forelegs black brown; prolegs cream. 

The larva feeds until June on Origanum vulgare L. (Lamiaceae), folding a leaf and 
spinning it together, only leaving a small entrance in each end, through which it rap- 
idly disappears if disturbed. It is active preferably during the night. Lhomme (1948: 
660) also recorded Mentha arvensis L., M. silvestris L., M rotundifolia L. and 
Calamintha nepeta (L.) Savi (Lamiaceae) as host plants, and it was bred from 
Clinopodium vulgare L. (Lamiaceae) in Portugal (Corley et al 2000: 269). Pupation 
takes place either in a folded leaf or between dry leaves on the ground. Flight period: 
late June to late August. The adult is attracted to light (Heyden 1848: 955; Baker 1888: 
136; OK pers. obs.). Vertical distribution: from sea level to about 2000 m. 

Remarks. Ypsolophus schmidtiellus Heyden was described from an unspecified 
number of larvae and adults found by U. Schmidt near Sachsenhäuser Warte (Frank- 
furt/Main) and Königstein/Taunus (Germany). The description of this species leaves 
no doubt about its identity. 

Ypsolophus durdhamellus Stainton was described from an unspecified number of 



Nota lepid. 25 (2/3): 109-151 133 

specimens from Durdham Downs near Bristol, and from Devonshire (England). It was 
already listed as a synonym of quadrinella by Herrich-Schäffer (1855: 37 (Index)). 
Hypsolopha quadrinella Herrich-Schäffer was described from one specimen found by 
Fischer von Röslerstamm at Rodaun (SW of Vienna, Austria), and first figured in a 
plate non-binominal (Herrich-Schäffer 1853: pi. 81, fig. 616). It was listed as a syno- 
nym of durdhamellus by Heinemann (1870: 339). 

Acompsia (Telephila) syriella sp. n. 

Material examined. Holotype S ' 1 7.-1 8. V. 1 96 1 , Syria, 25 km W v. Damascus, Kasy & Vartian' 
(NHMW). Paratypes: 26, same label data as holotype (gen. slide HH 3389, NM 16.642 6). 

Male (Fig. 24). Wingspan 14 mm. Segment 2 of labial palpus with large scale brush, 
light brown, mottled with black on outer and lower surface, whitish yellow on upper 
and inner surface; segment 3 comparatively long, thin. Antenna serrated, with cilia, 
yellow brown, indistinctly ringed with black. Forewing straw yellow, mottled with 
black scales; three black spots: one in fold, one above it slightly towards base, and one 
slightly oblique at end of cell; more or less distinct black patches near base, between 
black spots, at tornus and as a subapical band; termen slightly emarginated below 
apex, with distinct black line; cilia yellow brown, lightest at base. Hindwing grey, with 
grey, light yellow-based cilia. 

Female. Unknown. 

Male genitalia (Figs. 41, 58). Uncus sub-rectangular; cucullus with long, 
comparatively weakly dilated distal part; sacculus lobe short, covered with few 
microtrichia in distal part, weakly convex and comparatively small, almost straight 
distoventral (outer) margin; sclerites of vinculum even throughout, very long, dis- 
tinctly overtoping sacculus lobes; aedeagus with small doral sclerite at base, without 
dentate distal sclerite, vesica without sclerotized, spiralled distal part. 

Female genitalia. Unknown. 

Distribution. Only known from a single locality in Syria. 

Biology. Host-plant and early stages unknown. The adults have been collected 
in mid-May. 

Remarks J. syriella sp. n. resembles A. schmidtiellus, but is smaller, with the 
black spots and patches in the forewing more distinct; segment 3 of the labial palpus is 
shorter. The male genitalia of the new species differ from the latter particularly by the 
longer arms of the vinculum, the smaller valvae and the lack of a dentate sclerite of the 
aedeagus. 

Etymology. Named after the type region. 



Acknowledgements 

We are most grateful to Dr. Klaus Sattler (London) for his invaluable help in many respects, mainly 
including various informations about material, literature etc., and lor carefully checking the manuscript. 
Moreover we want to thank the following colleagues: Dr. Giorgio Baldi/./one ( Asti), Dr. Ronald Bellstedt 
and A. Schreyer (Gotha), Dr. Oleksiy Bid/ilya (Kiev), Prof. Jaroslaw Buszko (Toruri), Dr. Karel C'crny 
(Innsbruck), Dr. Reinhard Gaedike (Eberswaldc), Dr. Lâszlo Go/many (Budapest), Kcld Gregersen (Soro), 
Dr. Theo Grünewald (Landshut), Henning Hendriksen (Fârevejle), Dr. Lauri Kaila and Jaakko Kuliberg 
(Helsinki), Jari Kaitila (Vantaa), Dr. Martin Lödl and Mag. Susanne Randolf (Vienna), Dr. Wolfgang 



1 -^ Huemer & Karsholt: The genus Acompsia 

Nässig (Frankfurt), Dr. Matthis Nuss (Dresden), Dr. Margarita Ponomarenko (Vladivostok), Willy De 
Prins (Antwerpen), Dr. Andreas Segerer (Munich) and Kevin Tuck (London) for the loan of material, 
important information and/or other kinds of assistance. 

References 

Amsel, H. G. 1935. Weitere Mitteilungen über palästinensische Lepidopteren. - Veröff.dt.Kolon.u.Übersee- 
Mus.Bremen 1: 223-277. 

Baker, G. T. 1888. Description of the larva of Ypsohphus schmidiellus [sic], Heyd. (Nothris durdhanellus, 
Stn.). - Entomologist' s mon.Mag. 25: 136. 

Becker, O. 1984. Gelechiidae. Pp. 44-53, 59-60. In: Heppner, J. B. (ed.): Micropterigoidea - Immoidea. 
-Atlas of Neotropical Lepidoptera. Checklist 1. - W. Junk, The Hague, Boston, Lancaster, xxvii+112 
pp. 

Budashkin, Yu. I. & Kostjuk, I. Yu. 1994. On the fauna of Mircolepidoptera of Transbaikalia. - Memoirs 
of the Dahursky Nature Reserve 2: 5-30. 

Charpentier, T. von 1821. Die Zinsler, Wickler, Schaben und Geistchen des systematischen Verzeichnis- 
ses der Schmetterlinge der Wiener Gegend vergleichen mit den in der Schiffermillerschen Samm- 
lung in Wien befindlichen und von J. Hübner in seinem grossen Kupferwerke abgebildeten Arten 
dieser Gattungen. Mit Anmerkungen von J. L. Th. Fr. Zincken gennant Sommer. - Schulbuchhand- 
lung, Braunschweig, xvi +178 pp. 

Chrétien, P. 1899. Les premiers états de Br achy cross ata tripunctella S. V (Lep.). - Bull.Soc.ent.Fr. 
1899: 202-204. 

Clerck, C. 1759. Icônes Insectorum rariorum cum nominibus eorum trivialibus locisque e C. Linnaei 
Systema Naturae allegatis. - Stockholm. 55 + 7 pis. Sectio prima: 4 pp. Dedication, 4 pp. Vorrede 1- 
16 pis. 

Corley, M. F. V, Gardiner, A. J., Cleere, N. & Wallis, P. D. 2000. Further additions to the Lepidoptera of 
Algarve, Portugal (Insecta: Lepidoptera). - SHILAP Revta. lepid. 28: 245-319. 

[Denis, M. & Schiffermüller, L] 1775. Ankündung eines systematischen Werkes von den Schmetterlin- 
gen der Wienergegend. - A. Bernardi, Wien. 323 pp., 3 pis. 

Duponchel, P.-A.-J. ([1838-1840]): Nocturnes, S.-In: Godait, J. B.: Histoire naturelle des Lépidoptères 
ou Papillons de France 11. - Méquinon-Marvis, Libraire-éditeur, Paris. 720 pp., pis 287-314. 

Edwards, E. D: 1996. Gelechiidae. Pp. 107-114, 347-348. In: E. S. Nielsen, Edwards, E. D. & Rangsi, 
T. V. (eds): Checklist of the Lepidoptera of Australia. - Monographs on Australian Lepidoptera 4. - 
CSIRO Publishing, Collingwood, Australia, xiv+529 pp. 

Eisner, G, Huemer, P. & Tokâr, Z. 1999. Die Palpenmotten (Lepidoptera, Gelechiidae) Mitteleuropas. 
Bestimmung - Verbreitung - Flugstandort - Lebensweise der Raupen. - F. Slamka, Bratislava. 208 
pp. 

Gaede, M. 1937. Familia: Gelechiidae. - In: Bryk, F. (ed.): Lepidopterorum Catalogus. Pars 79. - W. 
Junk, Berlin & 's-Gravenhage. 630 pp. 

Gaedike, R. & Heinicke, W (eds) 1999. Entomofauna Germanica 3. Verzeichnis der Schmetterlinge 
Deutschlands. - Ent.Nachr.Ber., Suppl. 5: 1-216. 

Haworth, A. H. 1828. Lepidoptera Britannica 4. J. Murray, London. Pp. 512-609. 

Herrich- S chaffer, G. A. W. 1847-1855. Systematische Bearbeitung der Schmetterlinge von Europa. 5. - 
G. J. Manz, Regensburg. 394+52 (index) pp., 124+7+1 pis. 

Heinemann, H. v. 1870.. Die Schmetterlinge Deutschlands und der Schweiz. 2 Abteilung Klein- 
schmetterlinge. 2. Die Motten und Federmotten. Heft 1. - C. G Schwetschke & Sohn, Braunschweig. 
388 pp. 

Heyden, C. H. G von 1848. Nachtrag über den oben erwähnten Ypsolophus schmidtiellus (v. Heyden). 
Pp. 954-955. In G Koch: Die Raupen und Schmetterlinge des südwestlichen Deutschlands, ins- 
besonderer der Umgebung von Frankfurt, Nassau und der westlichen Abdachung des Taunus-Gebir- 
ges. - Isis, Leipzig 1848: 891-955. 

Hodges, R. W 1983. Gelechiidae. Pp. 19-25. In: Hodges, R. W. etal. (eds): Check list of the Lepidoptera 
of America North of Mexico, xxiv + 284 pp. E. W. Classey Ltd. and The Wedge Entomological 
Research Foundation, Cambridge. HodgeS, R. W. 1986. Gelechioidea. Gelechiidae (Part). 



Nota lepid. 25 (2/3): 109-151 135 

Dichomeridinae. In: Dominick, R. B. et al: The Moths of America North of Mexico 7(1): 1-195, i- 

xiii. The Wedge Entomological Research Foundation, Washington. 
Horn, W. & Kahle, I. 1935-1937. Über entomologische Sammlungen, Entomologen & Entomo- 

Museologie. - Ent.Beih. Berl.-Dahlem 2-4: 1-536, pis 1-38. 
Hübner, J. 1796-1836. Sammlung europäischer Schmetterlinge 8 - J. Hübner, Augsburg. 78 pp. (1796), 

71 pis (1796-1836). 
Hübner, J. 1816-1825. Verzeichniss bekannter Schmetterlinge. - J. Hübner, Augsburg. 431 pp 
Huemer, P. 1998. A new endemic species of Acompsia from the Alps (Lepidoptera, Gelechiidae). - 

Linzerbiol. Beitr. 30: 515-521. 
Huertas-Dionisio, M. 2002. Estados inmaturos de Lepidoptera (XVI). Telephila schmidtiellus (Heyden, 

1848) en Huelva, Espana (Lepidoptera: Gelechiidae, Dichomerinae). - SHILAP Revta. lepid. 30: 

9-14. 
Janse, A. J. T. 1958-1963. Gelechiadae. - The Moths of South Africa 6. - Transvaal Museum, Pretoria. 

284 pp., 138 pis. 
Jürivete, U., Kaitila, J., Kesküla, T., Nupponen, K., Viidalep, J. & Öunap, E. 2000. Eésti liblikad katalog. 

Estonian Lepidoptera catalogue. - Eesti Lepidopterologide Selts, Tallinn. 151 pp. 
Kaitila, J. -P. 1996. Suomen jäytäjäkoiden (Gelechiidae) elintavat. - Baptria 21: 81-105. 
Karsholt, O. & Riedl, T. 1996. Gelechiidae (except Gnorimoschemini). In: Karsholt O. & Razowski J. 

(eds): The Lepidoptera of Europe. A distributional checklist. -Apollo Books, Stenstrup. Pp. 103- 

113, 118-122,310-312. 
Kerpola, S., Kontuniemi, I. & Löfgren, L. 1985. Mikrotiedonannot 1984. - Baptria 10: 75-95. 
Kozlov, M. V. & Jalava, J. 1994. Lepidoptera of the Kola Peninsula, northwestern Russia. - Ent.fenn. 5: 

65-85. 
Lhomme, L. 1930. Quelques chasses a Str-Etienne-Vallée-Francaise (Lozère) [with descriptions of new 

taxa by P. Chrétien]. - Amat. Papillons 5: 84-93, 103-107, 119-126, 135-141. 
Lhomme, L. 1948-1949. Catalogue des Lépidoptères de France et de Belgique 2 (part 2, fasc. 5). - Le 

Carriol, Douelle (Lot). Pp. 649-808. 
Lucas, D. 1955. Nouveaux Lépidoptères Nord-Africains. - Bull. Soc. ent.Fr. 35: 254-257. 
Meyrick, E. 1925. Lepidoptera Heterocera. Fam. Gelechiadae. - Genera Insect. 184. - Louis Desmet- 

Verteneuil, Bruxelles. 290 pp., 5 pis. 
Meyrick, E. 1927. Exotic Microlepidoptera 2 (20). - E. Meyrick, Marlborough. Pp. 609-640. 
Millière, P. 1864-1868. Iconographie et description de chenilles et Lépidoptères inédits. 2. - F. Savy, 

Paris. 506 pp., 50 pis. 
Millière, P. 1867. Iconographie et description de chenilles et Lépidoptères inédits. -Annls. Soc. linn. Lyon 

(N.S.) 14: 355-388, pis 77-80. 
Nel, J. 2001. Espèces nouvelles ou rarement signalées de microlépidoptères des Alpes méridionales 

françaises (Lepidoptera, Alucitidae, Gelechiidae, Elachistidae, Ochsenheimeriidae). - Bull. Soc. ent 

Fr. 106: 101-104. 
Petry, A. 1904. Zwei neue Gelechiiden aus den Central-Pyrenäen. - Dt.ent. Z.Iris 17: 1-6. 
Piskunov, V. I., 1990. Gelechiidae. In Medvedev, GS. (ed.): Keys to the insects of the European part of 

the USSR. IV. Lepidoptera 2. - E. J. Brill, Leiden, New York, Kobenhavn, Köln. [English translation.]. 

Pp. 889-1024. 
Pitkin, L. M. 1984. Gelechiid moths of the genus Mirifwarma. - Bull.Br.Mus.nat.Hist. (Ent.) 48: 1 70. 
Ponomarenko, M. G 1992. Functional and morphological analysis of male genitalia of gelechiid moths 

of Dichomeridinae sensu novo (Lepidoptera, Gelechiidae). - Ent.Obozr. 71: 160-178. 
Pomomarenko, M. G. 1997a. Phylogeny and taxonomy of the subfamily Dichomeridinae (Lepidoptera: 

Gelechiidae). - Zoosyst. ross. 6: 305-314. 
Ponomarenko, M. G 1997b. Catalogue of the subfamily Dichomeridinae (Lepidoptera, Gelechiidae) of 

the Asia. - Far East. Entomol. 50: 1-67. 
Rebel, H. 1899. Zweiter Beitrag zur Lepidopteren-Fauna Südtirols. Verh. zool. -bot. Ges. Wien 49: 

158-185. 
Rebel, H. 1917. Über eine Mikrolepidopterenausbeute aus dem östlichen Tannuola-Gebiet. Dt.entZ.Iris 

30: 186-195. 



136 



Huemer & Karsholt: The genus Acompsia 



Robinson, G. S. & Nielsen, E. S. 1983. The Microlepidoptera described by Linnaeus and Clerck. - 

SystEnt. 8: 191-242. 
Sattler, K. 1973. A catalogue of the family-group and genus-group names of the Gelechiidae, Holcopogonidae, 

Lecithoceridae and Symmocidae (Lepidoptera). - Bull.Br.Mus.nat.Hist. (Ent.) 28: 153-282. 
Sattler, K. & Tremewan, W. G. 1973. The entomological publications of Pierre Millière (1811-1887). - 

Bull.Br.Mus.nat.Hist. (Hist.) 4: 223-280, pis 1-3. 
Scopoli, J. A. 1763. Entomologia Carniolica exhibitus insecta Carnioliae indigine et distributa in ordines, 

genera, species varietates methodo Linnaeana. - J. T. Trattner, Vienna. 421 pp., 37 pis. 
Sorhagen, L. 1901-1902. Grabowiana. Ein Nachtrag zu den "Kleinschmetterlingen der Mark Branden- 
burg". - Allg.Z.Ent. 6: 241-245, 276-279, 311-314, 327-332, 343-347; 7: 19-25, 51-57, 77-81, 

97-100. 
Stainton, H. T. 1849. Catalogue of the British Tineidae & Pterophoridae. - John van Voorst, London. 32 

pp. 
Stainton, H. T. 1851. A supplementary catalogue of the British Tineidae & Pterophoridae. - John van 

Voorst, London. 28 pp. 
Svensson, I. 1966. New and confused species of Microlepidoptera. - Opusc.ent. 31: 183-202. 
Svensson, I. 1993. Fjärilkalender. Lepidoptera-calendar. - I. Svensson, Österslöv, Kristianstad. 124 pp. 
Treitschke, F. 1833. Die Schmetterlinge von Europa (Fortsetzung des Ochsenheimer 'sehen Werkes) 9(2). 

- G. Fleischer, Leipzig. 294 pp. 
Wehrli, E. 1925. Ueber die von mir im Juni - Juli 1924 in Corsica erbeuteten Mikrolepidopteren mit 

Beschreibung zweier neuer Arten. - Dt.ent.Z.Iris 39: 133-137. 
Werneburg, A. 1864. Beiträge zur Schmetterlingskunde. - H. Neumann, Erfurt. 1: vii + 595 pp., 2: iv + 

350 pp 
Zeller, P. C. 1839. Versuch einer naturgemäßen Eintheilung der Schaben. - Isis, Leipzig 1839: 167-220. 



Nota lepid. 25 (2/3): 109-151 



137 




Figs. 1-8. Acompsia spp., adults: 1 - A. cinerella, 6 . Austria, wingspan 19 mm; 2 ditto, i . Germany, 

wingspan wingspan 16 mm; 3 - A. pyrenaella sp. n., d, France, wingspan 20 mm; 4 ditto, V. France, 
wingspan 15 mm; S - A. antirrhinella, 6, France, wingspan 20 mm; 6 ditto, ?. Spain, wingspan 19 
mm; 1 - A. maculosella, 6\ Austria, wingspan 19 mm; 8 I. muellerrutzi, 6, France (Corse), wingspan 
15 mm. 



138 



Huemer & Karsholt: The genus Acompsia 




Figs. 9-16. Acompsia spp., adults: 9 -A. dimorpha, â, France, wingspan 17 mm; 10 - ditto, 9, France, 
wingspan 11 mm; 11 -A. subpunctella, 6, Sweden, wingspan 15 mm; 12 -A. delmastroella, <?, Italy, 
wingspan 16 mm; 13 -A. minorella, S, Italy; 14 -A. tripunctella, â, Austria, wingspan 23 mm; 15 - 
ditto, 6, Austria, wingspan 18 mm; 16 - ditto, 9, Austria, wingspan 16 mm. 



Nota lepid. 25 (2/3): 109-151 



139 




Figs. 17-24. Acompsia spp., adults: 17 - A. ponomarenkoae sp. n., '. Greece, wingspan 23 mm; 18 
ditto, 9 , Greece, wingspan 16 mm; 19-/}. cauca.sc//asp.n., c?, Russia (Caucasus), wingspan 22 mm; 20 
-A schepleri sp. n., d, Turkey, wingspan 24 mm; 21 - A.fibigeri sp. n.. ' . Turkey, wingspan 22 mm; 22 
-A. bidzilyai sp. n., <3, Russia (Transbaikalia), wingspan 19 mm; 23 - A. schmidtiellus, 7 . Germany, 
wingspan 16 mm; 24 - A. syriella sp. n.. 6, Syria, wingspan 14 mm. 



140 



Huemer & Karsholt: The genus Acompsia 




Figs. 25-30. Acompsia spp., male genitalia (without aedeagus): 25 -A. cinerella, Germany, slide GEL 
881; 26 -A. pyrenaella sp. n., Spain, slide 01/1036; 27 -A. antirrhinella, France, slide GEL 866; 2S-A. 
maculosella, Austria, slide GEL 488; 29 -A. dimorpha, France, slide BMNH 26.575; 30 —A. subpunctella, 
Sweden, slide GEL 870. 



Nota lepid. 25 (2/3): 109-151 



141 




Figs. 31-36. Acompsia spp., male genitalia (without aedeagus): 31 - A. delmastroella, Italy, slide GEL 
864; 32 - A. muellerrutzi, France (Corse), slide 01/1070; 33 - A. caucascUa sp. n., Russia (Caucasus), 
slide 02/1 149; 34 - A. minorella, Slovenia, slide GEL 887; 35 - A. tripunctella, Croatia, GEL 880; 36 - 
A. ponomarenkoae sp. n., Greece, slide 01/1068. 



142 



Huemer & Karsholt: The genus Acompsia 




Figs. 37-41. Acompsia spp., male genitalia (without aedeagus): 37 -A schepleri sp. n., Turkey, slide 01/ 
1067; 38 - A. fibigeri sp. n., Turkey, slide 02/1112; 39 - A. bidzilyai sp. n., Russia (Transbaikalia), 
slide02/1144; 40 -A. schmidtiellus, Germany, slide GEL 1058; 41 -A. syriella sp. n., Syria, NM 16.642. 



Nota lepid. 25 (2/3): 109-151 



143 



42 




43 





X 



44 




45 




^ 






46 





47 



Figs. 42-47. Acompsia spp., male genitalia (aedeagus): 42 A. cinerella, ( lermany, slide GEL SX] ; 43 
A. pyrenaella sp. n., Spain, slide 01/1 036; 44 - A. antirrhinella, France, slide GEL 866; 45 A. maculosella, 
Austria, slide GEL 488; 46 - A. dimorpha, France, slide BMNH 26.575; 47 A. subpunctella, Sweden. 
slide GEL 870. 



144 



Huemer & Karsholt: The genus Acompsia 




Figs. 48-53. Acompsia spp., male genitalia (aedeagus): 48 -A. delmastroella, Italy, slide GEL 864; 49 - 
A. muellerrutzi, France (Corse), slide 01/1070; 50 - A. caucasella sp. n., Russia (Caucasus), slide 02/ 
1149; 51 - A. minorella, Slovenia, slide GEL 887; 52 - A. tripunctella, Croatia, GEL 880; 53 - A. 
ponomarenkoae sp. n., Greece, slide 01/1068. 



Nota lepid. 25 (2/3): 109-151 



145 




Figs. 54-58. Acompsia spp., male genitalia (aedeagus): 54 - A. schepleri sp. Q., Turkey, slide 01/1067; 
55 - A. fibigeri sp. n., Turkey, slide 02/1 1 12; 56 - A. bidzilvai sp. n., Russia (Transbaikalia), slide()2/ 
1144; SI -A. schmidtiellus, Germany, slide GEL 1058; 58 -A. syriella sp. n., Syria, slide NM 16.642. 



146 



Huemer & Karsholt: The genus Acompsia 




Figs. 59-62. Acompsia spp., female genitalia, 59, 61 (segment VIII), 60, 62 (corpus bursae): 59 - A. 
cinerella, Germany, slide GEL 1048; 60 - ditto; 61 - A. pyrenaella sp. n., slide BMNH 26.578; 62 - 
ditto. 



Nota lepid. 25 (2/3): 109-151 



147 




Figs. 63-66. Acompsia spp., female genitalia, 63, 65 (segment VIII). 64, 66 (corpus bursae): 63 - A. 
antirrhinella, slide NM 16.638; 64 - ditto; 65 - A. maculosella, Austria, slide GEL 1046; 66 - ditto. 



148 



Huemer & Karsholt: The genus Acompsia 




Figs. 67-70. Acompsia spp., female genitalia, 67, 69 (segment VIII), 68, 70 (corpus bursae): 67 - A. 
dimorpha, slide BMNH 26.576; 68 - ditto; 69 -A. subpunctella, Sweden, slide 02/1113; 70 - ditto. 



Nota lepid. 25 (2/3): 109-151 



149 




Figs. 71-73. Acompsia spp., female genitalia, 71 (segment VIII), 72 (corpus bursae): 71 A. delmastroella, 
Italy, slide GEL 1044; 72 - ditto; 73 - A. minorella, Slovenia, slide GEL 1045. 



150 



Huemer & Karsholt: The genus Acompsia 



ai, ^% 





76 




°75 




Figs. 74-77. Acompsia spp., female genitalia, 74, 76 (segment VIII), 75, 77 (corpus bursae): 74 - A. 
tripunctella, Austria, slide GEL 1047; 75 - ditto; 76 -A. ponomarenkoae sp. n., Greece, slide 01/1079; 
77 - ditto. 



Nota lepid. 25 (2/3): 109-151 



151 




Figs. 78-79. Acompsia schmidtiellus, female genitalia, 78, (segment VIII). 79 (corpus bursae). Ger- 
many, slide GEL 1059. 



152 



book review 



Book Review 



Razowski, J. 2001. Die Tortriciden (Lepidoptera, Tortricidae) Mitteleuropas. - F. Slam- 
ka, Bratislava. 319 pp. (incl. 151 b/w plates, 24 colour plates). - ISBN: 80-967540-7-6. 
Price: €61,00. 

This book contains a very brief introduction in German, a checklist of species, brief descrip- 
tions in German including the flight times and known food plants, habitat and distribution. 
Then follow line drawings of male and female genitalia of most species and 24 coloured plates 
depicting the adults. 

The checklist of species does not agree with the European checklist by Karsholt & Razowski 
(1996), but instead with Razowski's catalogue from 1989. The few changes in names from the 
European list are unfortunate: nomina dubia are introduced as senior synonyms for Epinotia 
immundana (No. 355) and Cydia splendana (No. 500) which are well established names and 
this is against the spirit of the ICZN (1999). Endothenia ericetana (No. 228) is incorrectly 
cited as a junior synonym, it was published by Humphreys & Westwood in 1 845 as well as in 
the revised edition of 1 854. The terminations of specific names in some cases have been changed, 
supposedly to make them agree in gender with the genus. The majority of these are -ella or - 
ana endings which are best regarded as nouns in apposition and so should not change. The 
genus name Argyroploce comes from the Greek words ocpyupoç - silver and 7tAokt| - a wind- 
ing, twining, entangling etc. and it is feminine. This eloquently illustrates the problem of this 
practice. The genus Coccyx is used instead of Blastesthia even though Coccyx has been shown 
to be a synonym of Cydia (Brown 1979). 

The species treated are stated to be those occurring in Germany, Poland, the Czech Repub- 
lic, Slovakia, Austria and Hungary, although Ditula angustiorana (Haworth, 1811), 
Epichoristodes ac'erbella (Walker, 1 864) and Lobesia littoralis (Humphreys & Westwood, 1 845) 
have been already recorded from Germany (Gaedike & Heinicke 1999), but are omitted. 

The status of some taxa are in question, some species may be split or others synonymised, 
this is not so important in an identification guide, but it would stimulate study if these cases 
were mentioned. For example 378 Epinotia rhododendrana should now be listed as a synonym 
of 359 E. nemorivaga (see Huemer 2002). 

The genitalia drawings appear accurate and well reproduced at a sensible size. The colour 
plates are photographs and all the moths are figured at the same size, although the wingspan is 
given in the species description. When illustrations are of a fixed size it would be helpful if a 
bar showing the actual size was included on the plates. The same number is maintained for 
each species throughout making it easy to relate the description to the illustrations of genitalia 
and specimens, and the locality from which each specimen depicted comes is given. 

This book should be useful to European microlepidopterists, the plates are well produced 
and readily recognisable and the great majority of specimens illustrated are in good condition. 

Unfortunately there are rather a lot of mistakes, and in order to avoid these being repeated 
a list of them is included below. These were pointed out by a number of SEL members in the 
microlepidoptera workshop at the XIII SEL Congress, supplemented by comments by Knud 
Larsen and others. Thanks are extended to the many who contributed. In some cases there was 
disagreement as to whether the specimen illustrated was correctly identified, for example Ancylis 
paludana (no. 319a), but a photograph and a locality is not always sufficient for a definite 
determination. It is a pity that these errors detract from the usefulness of the book, but it is still 
good value considering the number of coloured illustrations. 



Nota lepid. 25 (2/3): 109-151 



153 



Tab. 1 List of errors in Razowski (2001). Where a figure is doubtful, but not definitely wrong a question 
mark is inserted to denote confirmation needed". 



Page 


Razowski name 


Corrected name 


Comments 


88 


474 Cydia succedana 




1 


88 


475 Cydia ulicetana 




1 


108 


28 Acleris ferrugana 


28 A notana 


2 


108 


29 Acleris no tana 


29 A. ferrugana 


2 


136 


255 Pseudohermenias abietana 


255 Piniphila bifasciana 




136 


256 Piniphila bifasciana 


256 Pseudohermenias abietana 




• 177 


580 Dichrorampha thomanni 


580 Z). harpeana 


3 


183 


28 Acleris ferrugana 


28 A notana 


2 


183 


29 Acleris notana 


29 A ferrugana 


2 


252 


580 Dichrorampha thomanni 


580 Z). harpeana 


3 


297 


2 1 7 Bactra lancealana 


217 5. lacteana 


4 


258 


28 Acleris ferrugana 


2% A. notana 




258 


29 Acleris notana 


29 A. ferrugana 




258 


30 Acleris quercinana 


30 A ferrugana ? 




262 


65 Gynidimorpha luridana 


65 G. luridana ? 




262 


67 Gynidimorpha minimana 


67 G. manniana 




262 


68 Gynidimorpha permixtana 


68 G. permixtana ? 


5 


262 


69 Gynidimorpha alismana 


69 G. minimana 




270 


\l\&-f. sauberiana 


\1\2lA r chips podana 




270 


171b A. p f sauberiana female 


171b A.p f sauberiana male 




274 


2 1 2 Isotrias rectifasciana male 


2121. rectifasciana female 




278 


257 Apotomis semifasciana 


257 A iw/ttfa 




278 


258 Apotomis infida 


258 A semifasciana 


6 


278 


259 Apotomis lineana 


259 .4. semifasciana 




278 


264 Apotomis sororculana 


264 A turbidana 


7 


278 


278 Celypha rosaceana 


278 C. ra/ana ? 




284 


344 Epinotia sordidana 


344 ? 


8 


288 


405 Eucosma balatonana 


405 £. ohumbratana 


9 


292 


436 Eucosma cnicicolana 


436 £. obscur an a 




292 


439 Epiblema costipunctana 


439 £. cnicicolana 




292 


422 Epiblema confusana 


422 £. costipunctana 




294 


474 Cydia succedana 


474 C intexta 


10 


294 


475 Cydia ulicetana 


475 Cyc/zcr s/>. 


11 


296 


5 1 2 Grapholita difficilana 


5 1 2 G. internana 




296 


5 1 3 Grapholita internana 


513 G difficilana 




296 


5 1 3a Grapholita intcrnana 


5 1 3a G. nigrostriana 




296 


5 1 6, 5 1 6a Grapholita hmulana 


516, 5 1 6a G. orohana 




298 


522 Grapholita nigrostriana 


522 G. internana 




298 


526 Grapholita molesta 


526 G. herrichiana 




298 


537 Pammene insulana 


537 P. ignorât a 




298 


538 Pammene suspectana 


538 P. albuginana 




300 


558 Pammene albuginana 


558 P. suspectana 




300 


559 Strophedra nitidana 


559 £ M/e/roua 




300 


560 Strophedra weirana 


560 .V. nitidana 




302 


580 Dichrorampha thomanni 


580 D harpeana 




302 


589 Dichrorampha flavidorsana 


589 D. alpinana ? 




302 


590, 590a Dichrorampha alpinana 


590. 590a D. flavidorsana 





Comments 

1 Further research needed, adults 
illustrated as C succedana have 
genitalia matching those shown 
for C. ulicetana. 

2 error also in Microlepidoptera 
Palaearctica, cf. Speidel & Aar\ ik 
(2002) 

3 D. thomanni is nol figured 

4 identical to fig. 214, 5. lancealana 

is not figured 

5 some suspect this may be (/'. 
minimana 

6 258a is correct 

7 A. sororculana is not figured 
S Not an Epinotia sp. 

9 /.'. balatonana is nol figured 

10 474a and 477 are correct 

1 1 see notes for p. 88 above 



154 Book 



References 

Brown, R. L. 1979. The Valid Generic and Tribal Names for the Codling Moth, Cydia pomonella. - Ann.ent.Soc.Am. 

72: 565-567. 
Gaedike, R. & W. Heinicke 1999. Verzeichnis der Schmetterlinge Deutschlands. - Ent.Nachr.Ber., Suppl. 5 

(Entomofauna Germanica 3): 1-216. 
Huemer, P. 2002. Die Identität von Steganoptycha rhododendrana Herrich- S chaffer, [1851] (Lep., Tortricidae) 

Ent.Nachr.Ber., Suppl. 5 (Entomolfauna Germanica 3): 1-216. 
Humphreys, H. N. & J. O. Westwood 1845. British moths and their transformations. - Wm. S. Orr & Co., London. 
ICZN (International Commision on Zoological Nomenclature) 1999. International Code of Zoological Nomenclature. 

4th edition. - The International Trust for Zoological Nomenclature, London, xxx+306 pp. 
Karsholt, O. & J. Razowski. 1996. The Lepidoptera of Europe. A distributional checklist. -Apollo Books, Stenstrup. 

380 pp., 1 CD-ROM 
Razowski J. 1989. The Genera of Tortricidae (Lepidoptera). Part II: Palaearctic Olethreutinae. -Acta zool.Cracov. 

32: 107-328. 
Speidel, W. & Aarvik, L. 2002. Synonyms of European Tortricidae and Noctuidae, with special reference to the 

publications of Hübner, Geyer and Frölich. -Nota lepid. 25: 17-21. 

David Agassiz 



Nota lepid. 25 (2/3): 155-160 155 

Four species of Brachodidae new to the fauna of Europe 
(Sesioidea) 

Axel Kallies* & Karel Spatenka** 

* Axel Kallies, Zionskirchstr. 48, D-10119 Berlin, Germany, e-mail: kallies@fmp-berlin.de 
** Karel Spatenka, Vyletni 362, CZ-14200 Praha 4, Czech Republic, e-mail: agritrad@czn.cz 



Abstract. In the present work, four species of the genus Brachodes Guenée, 1 845 (Brachodidae) are re- 
corded from Europe for the first time. B. tristis (Staudinger, 1879) is reported from the Balkan peninsula 
(Greece, Bulgaria, Macedonia), B. powelli (Oberthür, 1922) from Italy, B. marietta (Oberthür, 1922) from 
Spain and Portugal, and B. beryti (Stainton, 1 867) from Greece. Furthermore, B. powelli stat. rev. is resur- 
rected from synonymy with B. appendiculata (Esper, 1783). All species are figured and characterised. 

Zusammenfassung. In der vorliegenden Arbeit werden von vier Arten der Gattung Brachodes Guenée, 
1845 (Brachodidae) erstmals Nachweise für die Fauna Europas genannt. Brachodes tristis (Staudinger, 
1879) wird vom Balkan (Griechenland, Bulgarien, Macédonien), B. powelli (Oberthür, 1922) aus Italien, 
B. nanetta (Oberthür, 1922) aus Spanien und Portugal sowie B. beryti (Stainton, 1867) aus Griechenland 
gemeldet. B. powelli stat. rev. wird aus der Synonymie mit B. appendiculata (Esper, 1783) genommen. 
Die genannten Arten werden abgebildet und charakterisiert. 

Key words. Lepidoptera, Sesioidea, Brachodes, taxonomy, Europe. 



Introduction 

The European Brachodidae fauna is relatively poor in species and consists only of 
'grass borers' of the genus Brachodes Guenée, 1845. Eleven species were listed when 
it was last summarised by Heppner (1996). 

Lately, research on the Palearctic Brachodidae has intensified and it was shown 
that Brachodes candefactus (Lederer, 1858) (=Atychia diacona Lederer, 1858) and 
Brachodes fallax (Staudinger, 1900) are not present in Europe as was erroneously 
stated in the European checklist (cf. Heppner 1996; Kallies 1998, 2001). However, 
Brachodes flavescens (Turati, 1919), a distinct species described from Italy is missing 
from this list. Data on this species have been summarised by Bertaccini & Fiumi (2002). 

In the course of revisional work on Palearctic Brachodidae, four species were dis- 
covered which had not previously been recorded for the European fauna. Records of 
these species are listed below, and diagnostic characters are given to separate them 
from similar congeners. Figures of genitalia are omitted here since they are not suit- 
able for the determination of these species. 

The name of one of the species recorded here from Europe for the first time, 
Brachodes powelli (Oberthür, 1922) sp. rev., is resurrected from synonymy with 
Brachodes appendiculata (Esper, 1783). With these additions and systematic changes, 
the checklist of European Brachodidae now attains a total of 14 species. 



Abbreviations 

CAK - Collection of Axel Kallies, Berlin, Germany; CKS - Collection of Karel Spatenka, Prague, 
Czech Republic; MGAB - Museul de Istorie Naturala 'Grigore Antipa". Bucharest, Romania; MNHP 
Museum National d'Histoire Naturelle, Paris, France; NHML - The Natural History Museum, London, 

© Nota lepidopterologica. 15.1 1.2002. ISSN 0342-7536 



1 -^ Rallies & Spatenka: Brachodidae new to Europe 

Great Britain; NHMW - Naturhistorisches Museum Wien, Austria; MNHB - Museum fur Naturkunde, 
Berlin, Germany; NNHM - Nationaal Natuurhistorisch Museum, Leiden; ZMUC - Zoological Mu- 
seum, University of Copenhagen; ZSM - Zoologische Staatssammlung München, Germany. 



Systematics and Faunistics 

Brachodes tristis (Staudinger, 1879) (figs 1, 2) 

Material. Holotype (by monotypy) S with labels: handwritten (Haberhauer?) 'Taurus | Haberhr.', 
handwritten (Staudinger) 'tristis Stgr.', printed 'Orig.' (on pink paper) (MNHB). GREECE: 36, 
Litochoron, 3-400 m, 14.-22.VI. 1957, leg. Klimesch; 66, 3 9, Kamena, Vurla (Lamia), 6.-12.VI.1957, 
leg. Klimesch (Fig. 1); 1 6, 4 9 , Peloponnesos, Zachlorou, Kalavrita, 26.VL- 3.VII.1963, leg. Klimesch; 
26, same data, but 13.-30.VI.1958; 16, same data, but 27.V.1963, leg. Klimesch (all ZSM); 16, Ml 
Olympus (ZSM); 19, Str. Akrata-Diakopton-Kalavrita, 750 m, 14.VII.1995, leg. Lingenhöle (Fig. 2, 
CAK); 1 9 , Peloponnesos, 15 km E Tripolis, 14.V1990, 650 m, leg. Karsholt (ZMUC); 1 6 , Peloponnesos, 
Chelmos (ZSM); 16, 2 9, Leptokaria, 26.-27.VI. 1996, leg. Lastûvka; 26, 19, same data, but 23.- 
24.VI.1997 (CKS); Id, same data, but 24.VI.1998; 2 9, Peloponnesos, Vrontamas, 30.V1999, leg. 
Lastûvka; IS, Peloponnesos, Kâlavryta, 4.VI.1999, leg. Lastûvka; IS, Agios Haralambos, 27.V.1999, 
leg. Lastûvka; IS, Diakopto, 15.VI.1991, leg. Feik (all CKS); MACEDONIA: \S, Stari Dojran, 2.- 
10.VI.1955, leg. Klimesch (ZSM); BULGARIA: \S, 17.VIII.1978, Sajtan dere, leg. Krusek (CAK); 
1 9, Pirin Mts., Region Sandanski, Liljanovo, 800 m, 26.V-21.VI.1981, leg. Eichler (CAK). 

Material from outside E u r o p e . 1 S , LEBANON, leg. Nicholl (NHML). 

This species was described from the Toros Mts in southern Turkey and is now reported 
from Europe (Greece, Macedonia, and Bulgaria) and the Lebanon for the first time. 

B. tristis is related to Brachodes appendiculata. Males can be distinguished by the 
shape of the antennal processes (short and broad in B. tristis', long and narrow in B. 
appendiculata) and the dark fringe of the wings, especially the hindwings (white in B. 
appendiculata). Additionally, fresh specimens can be recognised by the dense orange- 
yellow scaling of the forewing which covers the narrow medial streak almost com- 
pletely (scaling in B. appendiculata pale yellow to olive-yellow, medial streak whitish 
yellow and clearly visible). Female B. tristis can be separated by the dark and shining 
black wings (brownish black, often lighter at the base of the hindwing in B. 
appendiculata) and the entirely black scaling of head and legs (mixed with individual 
white scales in B. appendiculata). 



Brachodes powelli (Oberthür, 1922) sp. rev. (fig. 3) 

Material. ITALY: \S, Rom (ZSM); IS, 19, Aspromonte, Calabria, Serro Juncaria, 1700 m, 
20.VI.1971, coll. Hartig (NHML); 1 S , Aspromonte, 1600-1800 m; 1 S, 1 9 , Aspromonte, Cerasia, 1700 
m, 3. VII. 1920, leg. Stauder (NHMW); 2 S , Piemonte, Val di Susa (TO) Salbertrand, 1800-2000 m, 
13.VI.1998, leg. Bassi (coll. Fiumi); SPAIN: 1 9, Almeria, 8. IV 1994, leg. Lange & Hoppe (CAK). 

Material from outside Europe. MOROCCO: 1 S , Haut Atlas, ca. 60 km ENE Taroudant, 
Tizi-n-Test, southern side, ca. 1800 m, 6.VI.1996, leg. Kallies (Fig. 3, CAK); IS, Taza, 15.-21.V.1930, 
Ebner (NHMW); IS, 1 9 , Moyen Atlas, Aguelmane Si Ali (2070) 1-14.VII. 1939, leg. Rungs (MNHP); 
2 S, Moyen Atlas, Tizi Tarhzeft, 2200 m, 5.VII.1984, leg. et coll. De Prins; 1 S , Moyen Atlas, Col du Zad, 
2200 m, 2.VII.1984, leg. et coll. De Prins; IS, 1 ?, Tarurabta, 1.VI.1945, leg. Rungs (MNHP); ALGE- 
RIA: 1 S, Masser, Mines, Lalla-Marnia, June 19.1914, leg. Faroult (NHMW); 2d, 1 9 , Lambeze (MGAB); 
TUNISIA: IS, 19, El Kef area, 14.V1988, Zool. Mus. Copenhagen Exp. (ZMUC); lc?, 19, Tunis, 
April, coll. Wagner (NHMW); \S, Kasserine 5.1999, leg & coll. Bläsius; \S, Makter, 1000m,6.VI.2000, 
leg. Bläsius (CAK). 

B. powelli was described from Djebel-Timhadit, Morocco, but placed into synonymy 
with B. appendiculata later (Heppner 1981). However, male B. powelli can be distin- 



Nota lepid. 2 5 (2/3): 155-160 157 

guished from the latter by the shape of the male antenna (processes short and broad in 
B. powelli, long and narrow in B. appendiculata) and the usually dark colour of the 
hindwing fringe (white in B. appendiculata). Female B. powelli differ by the shining 
black colour of the wings (brownish black in B. appendiculata). 

B. powelli was reported only from Morocco, although it is as widespread in Algeria 
and Tunisia. Here this species is recorded from Italy, where it was confused with B. 
appendiculata up to now. Beside the data given here, further information on the distri- 
bution in Italy were published by Bertaccini & Fiumi (2002). A female Brachodes 
specimen from Spain which was examined in the course of this study was found to 
very likely to belong to B. powelli, too. So far, it has not been possible to locate any 
specimens of B. appendiculata from Europe west of Italy. From this, it can be assumed 
that records of B. appendiculata from Spain (Heppner 1996), indeed relate to B. powelli. 
Further, the identity of a male specimen from Libya (Bengasi, Cyrenaica, 30. III. 1922, 
leg. Hartert) which is preserved in the NHML needs confirmation. 

Remark. The holotype of B. powelli could not be traced. However, the figure of 
the type specimen given in the original description is very characteristic (Oberthür 
1922). Moreover, all specimens of the B. appendiculata - species group {sensu Kallies 
2001) which were examined from Morocco were found to belong to only a single 
species, i.e. Brachodes powelli (Oberthür, 1922). 

Brachodes nanetta (Oberthür, 1922) (fig. 4) 

Material. SPAIN: 2 S , Sierra Nevada, Camino de la Veleta, 1 600 m, 1 972 1 .VII. 1 985, leg. Baldizzone 
& Traugott-Olsen (ZMUC); 1 9 , Cantabria, Potes, 4.5 km W San Pelaya, 400 m, 24.V1I.1986, leg. Rich- 
ter & van Nieukerken [netted at dusk, Quercus ilex shrub & cult, area] (NNHM; CAK); 1 cT, Monte dos 
Alhos, Col. Passos Carvalho, 26.VII.1978 (NHML); IS, Zaragoza, VII. 1920 (Fig. 4, CAK); PORTU- 
GAL: Id, 1 9, Monchique, 400-900 m, 23.-30.VII.1938, leg. Zerny (NHMW); 1 o\ Coimbra (CAK); 
Id, 19, Algarve, Aljezur, 8.-22.VII.2001, leg. Brandstetter (coll. Brandstetter, CAK); 2d, Algarve, 
Fortes Rib. de Odeleite, 23.V.2001, leg. et coll. Corley. 

Material from outside Europe. MOROCCO: 1 6*, 1 9, Dj. Laxchab, 1500 m, 10.-15. VII. 
1941, leg. Marten (NHMW). 

B. nanetta was described and reported only from the Atlas Mts, Morocco. It is here 
recorded from Europe (Spain and Portugal) for the first time. B. nanetta is similar to B. 
nana, which, however, does not occur in the western Mediterranean region. Males can 
be distinguished most easily by the proboscis which is well developed in B. nanetta 
but absent in B. nana and by the colour of the hindwing (with distinct light areas near 
the base of the hindwing in B. nanetta; absent or undefined in B. nana). Females differ 
in the colour of the wings (blackish brown, with white markings at costa and anal 
margin in distal half in B. nanetta; without markings in B. nana). Records of/?, nana 
from Spain and Portugal (Heppner 1996) relate to B. nanetta. 

Remark. The holotype of B. nanetta could not be traced. However, the figure of the 
type specimen given in the original description is quite characteristic (Oberthür 1922). 
Moreover, all specimens of the genus Brachodes - except for B. powelli which were 
examined from the Atlas Mts of Morocco were found to belong to only one species, 
i.e. Brachodes nanetta (Oberthür, 1922). 



1 ^ Rallies & Spatenka: Brachodidae new to Europe 

Brachodes beryti (Stainton, 1867) (figs 5, 6) 

Material. GREECE: 46, 1 £ , Peloponnesos, Zachlorou, Kalavrita, 13.-30.VI.1958, leg. Klimesch (Fig. 
5, ZSM); 1 6, Ipiros, Igumenitsa, m, ultimo VII. 1994, leg. Selling (ZMUC); 1 6 , Peloponnesos, Taygetos, 
Tseria, 18.VII.1992, leg. Dobrovsky (CKS); 1 2, Peloponnesos, Tenaro, 17.VI.1997, leg. Lastùvka (CKS). 

Material from outside Europe. LEBANON: lc?, Beskinta, 16. VIII. 1928, leg. Ebner 
(NHMW); 6 , ? , Beirut, 1 869, coll. Lederer (MNHB); 1 6 , Ghazir (CAK); TURKEY: 1 6 , Aintab (MGAB), 
16, Hadjin, 1888, leg. Korb; IS, Taurus, 1888, leg. Korb (both MNHB); 1$, Antalya, Gülük Dagi 
Termessos, 800 m, 5. VII. 1996, leg. Lingenhöle (Fig. 6, CAK); 16, Hatay Prov., Belen, 26. VI. 1993, 
leg. Bakowski (CAK). 

This species was described from the environment of Beirut, Lebanon. Here it is re- 
ported from Europe (Greece) and Turkey for the first time. 

B. beryti is similar and closely related to B. nana (Treitschke, 1834) which was 
described from Sicily but is apparently more common in Greece and other parts of the 
southern Balkan peninsula.. Male B. beryti can be distinguished by the greyish brown 
colour of the wings (yellow-brownish in B. nana), by the distinct light areas near the 
base of the hindwing (absent or undefined in B. nana), and more importantly by the 
antenna (tapered, relatively smooth, somewhat flattened in B. beryti; equally broad for 
almost the entire length, rough, not flattened in B. nana). Females can be separated 
easily by the colour of the wings (blackish brown, with white markings at costa and 
anal margin in distal half in B. beryti; brown, without markings in B. nana). 



Conclusions 

The additions to the fauna of the European Brachodidae presented in this article ap- 
pear well consistent. Both, B. tristis and B. beryti are species with levantino- 
mediterranean distribution, a range type which often extends into the southern Balkan 
peninsula, whereas B. powelli and B. nanetta show a south-west-mediterranean distri- 
bution which frequently includes the Iberian peninsula and/or southern Italy. With 
respect to the Brachodidae fauna, the western part of Europe now can be regarded as 
relatively well-explored. In eastern Europe, however, the occurrence of additional and 
even undescribed species is conceivable, especially in the xerothermic grasslands of 
southern Russia and on the Balkan peninsula. 

Recent research on the Palearctic Brachodidae has yielded several taxonomic 
changes, descriptions of new species and a more detailed knowledge of the species 
distribution (Kallies 1998, 2001; Zagulajev 1999) although, even concerning the Eu- 
ropean fauna, several taxonomic problems remain unsolved. Likewise, knowledge of 
the life cycle of Brachodes moths is still incomplete and the early stages have not been 
described in detail. Sampling of Brachodidae is hampered by the rapid flight of the 
heliophile adults and the endophagous cryptic life of the larvae. As demonstrated for 
clearwing moths (Sesiidae) the use of artificial sexual attractants could prove to be 
helpful in field research on Brachodidae and would likely result in the discovery of 
additional species in Europe. This approach is hindered, however, by the lack of iden- 
tified Brachodidae pheromone compounds. To increase the knowledge on the Euro- 
pean and Palearctic Brachodidae, basic research on the bionomics and pheromone 
reaction of Brachodidae is urgently needed. 



Nota lepid. 25 (2/3): 155-160 



159 




Figs. 1-6. Brachodes species. 1 - B. tristis 6, Greece, alar exp. 23 mm (ZSM). 2 B. tristis 9, Greece, 
alar exp. 18 mm (CAK). 3 - B. powelli 6 , Morocco, alar exp. 21 mm (CAK). 4 B. nanetta o\ Spain. 
alar exp. 19 mm (CAK). 5 - B. beryti o\ Greece, alar exp. 19 mm (ZSM). 6 - B. beryti 9, Turkey, alar 
exp. 23 mm (CAK). 



Acknowledgements 

Our cordial thanks are due to A. Hausmann and U. Buchsbaum (both ZSM), (). Karsholt (ZMUC), M 
Lödl (NHMW), W. Mey (MNHB), J. Minet (MNI1P), E. van Nieukerken (NNHM) as well as ( .. s 
Robinson and K. Tuck (both NHML) for the loan of material under their care, and in addition to M. Nuss 
(Staatliches Museum für Tierkunde, Dresden, Germany) for arranging the loan from the MNIIP. respec- 
tively. Furthermore, we are grateful to G. Baldiz/.one (Asti. Italy), M. F. V. Corley (Faringdon. Great 
Britain), G. Fiumi (Forli, Italy), and W. de Prins (Antwerp, Belgium) for allowing us to study material in 
their collections, and to M. Bakowski (Poznan, Poland), R. Bläsius (Eppelheim, Germany), Th. Dobrovsky 



160 



Kallies & Spatenka: Brachodidae new to Europe 



(Praha, Czech Republic), H. Fischer (Rottach-Weissach, Germany), Th. Lange (Wittenberge, Germany), 
Z. Lastuvka (Brno, Czech Republic), and A. Lingenhöle (Biberach, Germany) for supplying material for 
this study. Finally, we thank M. F. V. Corley (Oxfordshire, Great Britain) for linguistic help. 



References 

Bertaccini, E. & Fiumi, G. 2002. Bombici e Sfingi d'ltalia. Volume 4: Lepidoptera: Sesioidea, - Stud. 

Nat. Rom. 181 pp. 
Heppner, J. B. 1981. Brachodidae. pp. 8-15.-7«: Heppner, J. B., & W. D. Duckworth, Classification of 

the superfamily Sesioidea (Lepidoptera: Ditrysia). - Smiths. Contrib.Zool. 314: 1-144. 
Heppner, J. B. 1996. Brachodidae. p. 125. -In: Karsholt, O. & Razowski J. (eds.), The Lepidoptera of 

Europe. A distributional checklist. -Apollo Books, Stenstrup. 380 pp. 
Kallies, A. 1998. Erster Beitrag zur Kenntnis der palaearktischen Brachodidae Agenjo, 1966: Revision 

von Brachodes fallax mit Beschreibungen neuer zentralasiatischer Arten (Lepidoptera: Sesioidea). - 

Notalepid. 21(3): 170-193. , 
Kallies, A. 2001. Revision of the Brachodes pumila (Ochsenheimer, 1808) species-group (Lepidoptera: 

Sesioidea). - Nota lepid. 24(1/2): 7-19. 
Oberthür, Ch. 1922. Les Lépidoptères du Maroc. - Études de Lépidoptérologie Comparée 19 (1): 13- 

405, pi. 74-124, 530-548. 
Zagulajev, A. K. 1999. New and little known moths (Lepidoptera: Thyrididae, Brachodidae) of the fauna 

of Russia and neighbouring territories. XL - Ent.Obozr. 78: 896-909. [in Russian] 



Nota lepid. 25 (2/3): 161-175 161 

Taxonomic patterns in the egg to body size allometry of butter- 
flies and skippers (Papilionoidea & Hesperiidae) 

Enrique Garcia-Barros 

Departmento de Biologia (Zool.), Universidad Autönoma de Madrid, E-28049 Madrid, Spain 
e-mail: garcia.barros@uam.es 



Summary. Former studies have shown that there is an interspecific allometric relationship between egg 
size and adult body size in butterflies and skippers. This is here re-assessed at the family and subfamily 
levels in order to determine to what extent the overall trend is uniform through different taxonomic 
lineages. The results suggest that different subtaxa are characterised by different allometric slopes. Al- 
though statistical analysis across species means is known to be potentially misleading to assess evolu- 
tionary relations, it is shown that the comparison of apparent patterns (based on species means) with 
inferred evolutionary trends (based on independent contrasts) may help to understand the evolution of 
egg size in butterflies. Further, intuitive reconsideration of statistically non-significant results may prove 
informative. As an example, argumentation in favour of a positive association between large egg size 
and the use of monocotyledon plants as larval food is presented. Taxa where atypical allometric trends 
are found include the Riodininae and Theclini (Lycaenidae), the Graphiini (Papilionidae), and the 
Heliconiinae (Nymphalidae). 

Key words. Allometry, butterflies, Hesperioidea, egg size, body size, life-history, Papilionoidea, 
wing-length 



Introduction 

Egg size has a relevant position in life-history theory because of its potential links with 
most other life history traits (Fox & Czesak 2000). In butterflies, these links are be- 
lieved to include female fecundity, host plant structure, the time required by the larvae 
to reach their final size, as well as the endurance ability of the egg itself, or of the first 
instar larvae (Reavey 1992; Garcia-Barros 2000a). Comparative research on the 
interspecific relations between the egg and adult body sizes among the Papilionoidea 
and Hesperioidea has demonstrated a robust positive relationship between these two 
traits (Garcia-Barros & Munguira 1997; Garcia-Barros 2000a). The trend represents a 
negative allometry, i.e. the eggs of species with largest adults tend to be larger than 
those laid by small butterflies, but they become proportionally smaller as adult size 
increases. In other words, the slope (b) of the equation log EGG SIZE= a + b(log 
ADULT SIZE) is lower than 1 .00 (in fact, within the range of 0.4-0.5 when both values 
are estimated in millimetres). However, it is not known to what extent this general 
trend applies to every single subordinated butterfly taxon. Alternatively, the trend might 
be arising from a combination of several distinct patterns characteristic to different 
phyletic lineages (e.g., Garland & Janis, 1 992). This study seeks, first, to check whether 
the egg to body size allometry holds within the main subtaxa of the papilionoid + 
hesperioid clade, in order to identify possible exceptions. And second, to determine if 
particularly small or large eggs (relative to the adult insect size) are restricted to par- 
ticular taxa, as well as to discuss some possible reasons of the patterns discovered. 

The size of each of the species within a clade was inherited - at least in part - from 
a shared ancestor. Hence, mean sizes of individual species are not statistically inde- 

© Nota lepidopterologica. 15.1 1.2002. ISSN 0342-7536 



J-Q^ Garcîa-Barros: Egg to body size allometry o f butterflies 

pendent, one necessary pre -requisite of standard regression procedures (for butter- 
flies: Garcia-Barros 2000c). The method of independent contrasts is one of the com- 
parative procedures proposed to solve this problem (Felsenstein 1985; Starck 1998), 
and will be used in this study. However, the raw species means are not devoid of 
interest, for two reasons: First, because they can be used to describe present patters 
which, when statistically significant, have a predictive value (paradoxically, one rea- 
son why this may work is phylogenetic inertia, the same reason why evolutionary 
relations cannot be directly inferred from the data). And second, that comparisons of 
the two approaches are by themselves informative whenever it is kept in mind that 
observable patterns among raw species data do not necessarily represent evolutionary 
trends, and that the opposite is true for regressions done on independent contrasts. 



Methods 

The information used in this work is the same as described in Garcia-Barros (2000a, b, 
c). No attempt has been done to update either the size estimates nor the phylogenetic 
hypotheses underlying the comparative analysis, even if new evidence of both kinds 
has become available more recently (e.g. Penz 1999; Brower 2000; Kitching et al 
2000; Martin et al 2000; Harvey & Hall 2002). This facilitates a direct comparison 
with the results presented elsewhere (Garcia-Barros 2000a). The author assumes that, 
as further work on butterfly life-histories and phylogenetic reconstruction progresses, 
the results dealt with here might be substantially modified. 

The data consisted of two linear estimates from each out of 1183 species: egg size 
(egg volume 173 in mm), and adult size (the length of adult fore-wing in mm). Both were 
transformed to decimal logarithms before any statistical treatment. Full details can be 
found in Garcia-Barros (2000b). Two parallel sets of analyses were carried out, using 
two versions of the same data: the species data points (the log-transformed egg and 
adult size estimates), and the taxonomically independent contrasts calculated for those 
two traits. The independent contrasts are weighted differences between the values of a 
variable in the taxa derived from the same node in the cladogram or taxonomic ar- 
rangement (Harvey & Pagel 1991; Garland et al. 1992; Starck 1998). These were ob- 
tained using the program CAIC (Purvis & Rambaut 1995), as specified in Garcia- 
Barros (2000a). The contrasts can be analysed in the same way as the original data, 
except that regressions have to be forced through the origin. This means that there is 
no intercept, and hence the allometric equation becomes EGG SIZE contrast^ b(ADULT 
SIZE contrast) (e.g. Garland et al 1992). 

The analyses were performed using the computer package STATISTICA (StatSoft 
2000), and included: (1) A brief description of the variation of egg size in the main 
taxonomic groups (family, subfamily), and their associated adult sizes. (2) Determin- 
ing the allometric relations of egg to body sizes by regression. Only taxa at or above 
the tribe level, where nine or more contrasts could be calculated, were included in this 
and subsequent steps. Least Squares Regression (LSR) was used throughout the study, 
but Reduced Major Axis (RMA) slopes were calculated for comparison. In brief, these 
two regression models differ in the way used to minimize the distances between the 



Nota lepid. 25 (2/3): 161-175 163 

data points and the regression line. LSR uses the shortest distance measured from the 
axis that represents the independent variable, while RJVIA regression minimizes the 
distances relative to both (X, Y) axes (details and further references can be found in 
Harvey and Pagel, 1991, and in the discussion). (3) Comparing the slopes of the re- 
gression lines fitted to the families and subfamilies, by means of pairwise analyses of 
the covariance (ANCOVA) of egg size by taxonomic levels with adult size as the 
covariate. The effect of two factors crossed (family or subfamily, and adult size) was 
tested (e.g. Garland et al. 1992). Taxa where egg and body size were not correlated 
were discarded for this purpose. (4) Finally, the mean relative egg sizes were com- 
pared to the common trend, in order to identify families or subfamilies where unex- 
pectedly high or low relative egg size values were found. The effect of one categorical 
variable containing codes for the families and subfamilies was tested by ANCOVA, 
with adult size as the covariate. The residuals of the regressions of egg size on adult 
wing size were used for graphic purposes. 



Results 

The frequency distributions of the egg and adult sizes of each of the five families are 
shown in Figure 1 . Mean adult wing length increased following the order: Lycaenidae, 
Hesperiidae, Pieridae, Nymphalidae, and Papilionidae. Mean egg size increased ac- 
cordingly from Lycaenidae to Papilionidae, with the exception that Hesperiidae and 
Pieridae appeared in reverse order. The taxonomic arrangement could significantly 
explain the variance of the original egg size data (controlling for adult size) both at the 
family level (ANCOVA: F 4 1088 =84.73, PO.0001), and at the subfamily level 
(ANCOVA: F 14 1078 =62.71, PO.0001), and so a degree of 'taxonomic conservatism 1 
in relative egg size is evident in the original data. 

Not surprisingly, the smallest (in absolute terms) eggs are those laid by the tiniest 
lycaenids, in particular some representatives of the tribe Polyommatini (Lycaeninae) 
such as Brephidium, Zizina or Hemiargus (e.g. Dethier 1940; Clark & Dickson 1971) 
with estimated egg volumes of 0.015 to 0.03 mm 3 . Conversely, the largest eggs are 
those of the troidine papilionids (up to 20 mm 3 or more). The egg of Ornithoptera 
tithonus de Haan measures 4.1 mm in diameter (Parsons 1995), and its volume is 
1,700 times larger that of the smallest lycaenid eggs. Other representative examples of 
large butterflies laying large eggs include the nymphalid subfamilies Charaxinae or 
Morphinae (e.g. Hoffmann 1938;Casagrande& Mielke 1985; Igarashi & Fukuda 1997; 
Urich & Emmel 1991). Species that lay unexpectedly large eggs relative to their wing 
size include some members of the nymphalid genera Dophla, Dynastor and Agrias, as 
well as several Hesperiidae-Trapezitinae (e.g. Atkins 1978). Opposite to these, some 
Pieridae (Phoebis, Tatochila, Antheos) and Nymphalidae (Hypolimnas, Pandoriand) 
lay remarkably smaller eggs than expected (van Son 1 979; Shapiro 1 987; Garcia-Barros 
2000d). 

The regression statistics are given in Table 1 . Regressions based on contrasts were 
generally more conservative. Irrespective of the kind of data used, no correlation was 
found for the Graphiini (Papilionidae), the Theclini (Lycaenidae), the Heliconiinae 



164 



Garcia-Barros: Egg to body size allometry of butterflies 




25 










50 j 
25 -- 







x= 0.72 ±0.22 

Hesperiidae 



1 1 l l I I I 1 
x= 1.06 + 0.39 






x= 16.18 ±4.02 



Papilionidae 

I I l I l r-h-r-H 






X= 0.54 ±0.16 



Pieridae 

I I I I l I I I I 




x= 0.48 ±0.14 

Lycaenidae 

H l I I I M I I I 



M I I I I I I I I I I I I I I I 
X= 47.00 ±17.01 



+ 50 
25 





1 



x= 0.84 ±0.32 

Nymphalidae 

r-h-H 

2 3 6 20 36 52 68 84 100 



Egg size (mm) 



Wing length (mm) 



Fig. 1. Frequency distributions of egg size (left column) and wing length (right column) of the species 
included in the data set, arranged by families. Note that the Y axis scales differ among the histograms. 
The arithmetic average ± 1 standard deviation are included in each histogram. 



(Nymphalidae), nor the two heliconiine tribes Acraeini and Heliconiini. Some correla- 
tions that were supported by the analysis of species means vanished when the contrasts 
were used: Hesperiidae-Trapezitinae, Lycaenidae-Eumaeini, and the family Lycaenidae 
as a whole. Other relationships (e.g. in Papilionini swallowtails and within the Danainae 
nymphalids) appeared to be more robust when based on contrasts than when estimated 
from the original data. The Riodininae (Lycaenidae) were remarkable for representing 
the single taxon to display a significant, negative correlation across contrasts, but none 
with raw species data. A few representative plot graphs are presented in the Figs 2-3. 



Nota lepid. 25 (2/3): 161-175 



165 



Table 1. The allometric relationship between egg size and adult body size in butterfly families, subfamilies 
and tribes, derived from species data and independent contrasts. Only taxa where nine or more contrasts 
could be calculated are included. N= number of species or contrasts, r= Pearson's coefficient of correlation 
(**** -PO.0001, *** -P<0. 001, ** -PO.01, * -P<0. 05, ns -not significant, P>0.05). Least squares 
regression (LSR) and reduced major axis (RJV1A) slopes are given in all instances, but note these are not 
relevant when the correlation is not significant. Regressions of contrasts were forced through the origin, 
and thus the intercept is equal to 0.00. 





Species data 


Independent contrasts 


TAXON 


N 


r 


P 


a 


è(LSR) 


è(RMA) 


N 


r 


P 


è(LSR) 


ö(RMA) 


Butterflies 


1183 


0.71 


**** 


-1.04 


0.62 


0.87 


461 


0.41 


**** 


0.49 


1.22 


HESPER1IDAE . 


132 


0.50 


**** 


-0.91 


0.63 


1.25 


50 


0.55 


**** 


0.55 


1.00 


Hesperiinae 


63 


0.78 


**** 


-1.41 


1.06 


1.36 


30 


0.59 


*** 


0.74 


1.23 


Trapezitinae 


28 


0.40 


* 


-0.77 


0.58 


1.43 


9 


0.54 


ns 


0.49 


0.92 


Pyrginae 


38 


0.46 


** 


-0.64 


0.35 


0.76 


11 


0.59 


* 


0.21 


0.36 


PAPILIONIDAE 


94 


0.76 


**** 


-1.21 


0.73 


0.96 


47 


0.73 


**** 


0.71 


0.97 


Pamassiinae 


34 


0.50 


** 


-0.97 


0.59 


1.19 


11 


0.72 


** 


0.43 


0.59 


Papilioninae 


60 


0.81 


**** 


-1.66 


0.99 


1.21 


34 


0.73 


**** 


0.78 


1.06 


Graphiini 


14 


0.16 


ns 


-0.46 


0.24 


1.44 


9 


0.61 


ns 


0.63 


1.04 


Troidini 


22 


0.89 


**** 


-1.74 


1.05 


1.18 


11 


0.84 


*** 


1.20 


1.43 


Papilionini 


24 


0.44 


* 


-0.81 


0.48 


1.09 


13 


0.74 


** 


0.49 


0.67 


PIERIDAE 


84 


0.51 


**** 


-1.04 


0.54 


1.05 


31 


0.38 


* 


0.32 


0.85 


Pierinae 


59 


0.57 


**** 


-1.14 


0.61 


1.07 


15 


0.34 


** 


0.31 


0.92 


LYCAEN1DAE 


298 


0.50 


**** 


-1.13 


0.67 


1.34 


113 


0.15 


ns 


0.13 


0.85 


Riodininae 


32 


0.04 


ns 


-0.40 


0.05 


1.12 


15 


-0.51 


* 


-0.27 


0.54 


Lycaeninae 


248 


0.54 


**** 


-1.21 


0.73 


1.35 


85 


0.35 


* 


0.30 


0.86 


Theclini 


43 


0.28 


ns 


-0.56 


0.24 


0.87 


14 


0.07 


ns 


0.09 


1.18 


Eumaeini 


37 


0.53 


*** 


-0.99 


0.61 


1.15 


19 


0.21 


ns 


0.22 


1.06 


Polyommatini 


122 


0.42 


*** 


-0.89 


0.39 


0.93 


45 


0.31 


* 


0.26 


0.84 


NYMPHALIDAE 


575 


0.63 


**** 


-1.07 


0.65 


1.03 


276 


0.41 


**** 


0.59 


1.45 


Nymphalinae 


58 


0.61 


**** 


-0.95 


0.47 


0.77 


20 


0.70 


** 


0.64 


0.92 


Hcliconiinae 


105 


0.22 


ns 


-0.72 


0.34 


1.57 


55 


0.16 


ns 


0.36 


2.26 


Acraeini 


18 


0.37 


ns 


-0.71 


0.31 


0.83 


15 


0.34 


ns 


0.24 


0.72 


Heliconiini 


86 


0. 1 6 


ns 


-0.64 


0.29 


0.85 


39 


0.18 


ns 


0.54 


2 cp 


Ithomiinae 


65 


0.49 


**** 


-0.88 


0.48 


0.98 


41 


0.32 


* 


0.36 


1.11 


Danainae 


27 


0.51 


** 


-1.09 


0.64 


1.25 


20 


0.70 


*** 


0.99 


1.43 


Limenitinac 


40 


0.67 


**** 


-1.67 


1.04 


1.55 


18 


0.57 


* 


0.62 


1 .09 


Charaxinac 


62 


0.70 


**** 


-1.46 


0.96 


1.39 


25 


0.58 


** 


0.79 


1.34 


Satyrinae 


175 


0.44 


**** 


-0.88 


0.56 


1.25 


72 


0.40 


*** 


0.64 


1.58 


Elymniini 


35 


0.36 


* 


-0.94 


0.62 


1.73 


10 


0.43 


ns 


1.22 


2.85 


Satyrini 


138 


0.39 


**** 


-0.72 


0.44 


1.12 


58 


0.46 


*** 


0.41 


0.91 



Whenever a significant correlation was found, the LSR slopes had positive values 
between +0.21 and +1.20 (except for the Riodininae, Table 1 ), and RM A slopes were 
often close to or above 1 .00. The tests for heterogeneity of the slopes are summarised 
in Tables 2 and 3. Family and subfamily mean relative egg sizes, as well as mean 
relative egg size increases, are compared with the overall relation depicted in Figure 4. 
The differences between pairs of taxa are presented in Tables 4 and 5. 



166 



Garcîa-Barros: Egg to body size allometry of butterflies 



0.25- 



o.oo- 



-0.25 



0.25- 



0.00- 



-0.25 



-0.50 



0.25 



0.00 



-0.25 






Papilionidae 



Lycaenidae 



■•»•• . . " "• 



Hesperiinae 




0.15 
0.10 
0.05 
0.00 
-0.05 

0.15 
0.10 
0.05 
0.00 
-0.05 



1.0 1.2 1.4 1.e 

Species means 



1.8 



0.05 0.10 0.15 

Contrasts 



Fig. 2. Sample plots to illustrate the relationship between egg size (Y axis) and adult size (X axis) at 
different taxonomic levels: families Papilionidae and Lycaenidae, and subfamily Hesperiinae 
(Hesperiidae). -Left column, as estimated from the logarithmically transformed species data. Right col- 
umn, based on independent contrasts. The trend lines illustrated are those fitted by least squares regres- 
sion. A dotted line indicates non-significant correlation. Note that the scales of the left and right columns 
are not the same. See Table 1 for further details. 



Table 2. Paired comparisons to test the significance of differences between the slopes of the regressions 
of egg size on adult size of the five butterfly families. The values are the F statistic for the interaction 
between the factors 'family' and 'adult size' in an analysis of the variance of egg size by families using 
adult size as a covariate (1 d.f.). * -PO.05, nt - not tested (the differences between the Lycaenidae and 
other families, based on contrasts, were not tested since no correlation was found within the lycaenids). 
The comparisons based on the independent contrasts are given above the diagonal, and those based on 
species data points below the diagonal. Only two pairs of families were found to have significantly 
different slopes, based on independent contrasts. None of the differences based on species data were 
significant (P>0.24 in all instances). 





Hesperiidae 


Papilionidae 


Pieridae 


Lycaenidae 


Nymphalidae 


Hesperiidae 


- 


3.98* 


0.00 


nt 


0.02 


Papilionidae 


0.83 


- 


4.83* 


nt 


2.79 


Pieridae 


0.06 


1.35 


- 


nt 


0.05 


Lycaenidae 


0.00 


0.89 


0.10 


- 


nt 


Nymphalidae 


0.01 


1.19 


0.12 


0.00 


- 



Nota lepid. 25 (2/3): 161-175 



167 



0.25 






Pierînae 


0.00 


•*•' *'J^. ' 




- 


-0.25 


*• *~P^Ï * 


■ 






» ^~ • .* 




^^^^^ 




jS** • 


• ,. 




-0.5 




* ^ — * 








^ 


m 






■^ , " * ■ 


• 






. 








- 


Heliconiini 


0.25 








0.00 


%*^^ 


. 


- 




\-£W^ 


; 


...-- 


-0.25 


•jSt^&T^ 


. 


". 






. • ■»■ ■- 






^^ 




■ 


-0.50 




. 


■ 


0?5 


• 




Satyrini 




. •• . •. 




• 




• • • # ^^»- 






000 


..- v *\Ü^^ 


. 


■ 




•• \ijt*rï&yf^t 








•aïïF*^ r 




■ "— — * "- 


-0.25 


>>*SF> 


# "* ' 






. • • • 


-îrv- 


' 


-0.50 




. . * ■ 








• • 


. 






■ 





0.15 
0.10 
0.05 
0.00 
-0.05 

0.15 
0.10 
0.05 
0.00 
-0.05 



0.05 



Species means 



0.10 0.15 

Contrasts 



Fig. 3. Plots showing the relationship between egg size and adult size in the subfamily Pierinae (Pieridae), 
and the tribes Heliconiini (subfamily Heliconiinae, Nymphalidae) and Satyrini (subfamily Satyrinae, 
Nymphalidae). Details as in Figure 2. 



Fig. 4. Plots illustrating relative 
egg size (based on species means) 
and relative egg size increase 
(based on independent contrasts) in 
butterfly families, and selected 
subfamilies. The values were cal- 
culated as distances from the com- 
mon trend (residuals from the re- 
gression), based either on species 
data points or on independent con- 
trasts. The vertical bars indicate I 
l standard error. The common 
trend is represented by the dotted 
line, and values above or below 
().()() indicate either proportional l\ 
large or small egg size. The taxa 
referred to are I I lespcindae. 2 

Papilionidae, 3 Pieridae. 4 
Lycaenidae, 5 Nymphalidae, a 
I [esperiinae, b Trapezitinae, c = 
Pyrginae, d Parnassiinae, e = 
Papilioninae, f = Pierinae, g = Riodininae, h = Lycaeninae, i= Heliconiinae. j Nymphalmae, k 
Limenitinae, l = Charaxinae, m = Satyrinae, n = Danainac, and o = Ithomiinae. Taxa marked with a 
triangle have a mean that departs significantly from the common trend (P<0.05 or below). 



0.2 



1 



00 



-0 1 



0.2 



1 



0.0 



-0 1 



-0 2 



+ 1A 

+ 47 
+3V 


t t 


A5J • 
■ 3 }4V 


+» A + IA 
+a A A + c .mA 
+ d + 

e h | jV n+ 

+9V 


i +d ] h + 1 T k m ° 

c 

J9V 



0.02 
0.01 
0.00 
-001 

006 
004 

002 
000 
-002 
-0.04 
-0.06 



SPECIES MEANS 



INDEPENDENT CONTRASTS 



168 



Garcia-Barros: Egg to body size allometry of butterflies 



Table 3. Paired tests for the significance of the differences between the slopes of the subfamilies in 
Table 1. F values, 1 d.f., details as for Table 2 (* - PO.05, ** -PO.01, *** -PO.001). The upper right 
half of the matrix summarises the comparisons of slopes derived from independent contrasts, and the 
lower left half those between slopes derived from species data. No comparison was attempted for those 
subfamilies that did not show a significant relationship between egg size and adult size (nt - not tested). 



Taxon 


Hesp. 


Trap. 


Pyr. 


Par. 


Pap. 


Pier. 


Rio. 


Lye. 


Nym. 


Lim. 


Char. 


Sat. 


Dan. 


Itho. 


Hesperiinae 


— 


nt 


0.51 


0.01 


1.46 


0.04 


6.81* 


0.69 


0.18 


0.12 


0.01 


0.07 


0.18 


2.68 


Trapezitinae 


3.06* 


— 


nt 


nt 


nt 


nt 


nt 


nt 


nt 


nt 


nt 


nt 


nt 


nt 


Pyrginae 


18.79'" 


0.81 


- 


1.34 


4.06* 


0.38 


4.08 


0.06 


0.25 


0.86 


0.42 


0.15 


1.68 


0.31 


Parnassiinae 


4.52* 


0.00 


1.35 


- 


2.13 


0.01 


11.77" 


0.44 


0.13 


0.20 


0.00 


0.00 


0.40 


2.55 


Papilioninae 


0.05 


2.72 


18.65*** 


4.09* 


- 


2.88 


28.29*** 


9.69" 


4.46* 


0.41 


1.42 


1.45 


0.41 


14.81*" 


Pierinae 


5.32* 


0.11 


3.61 


0.14 


5.02* 


- 


7.74" 


0.45 


0.06 


0.33 


0.01 


0.01 


0.47 


2.61 


Riodininae 


nt 


nt 


nt 


nt 


nt 


nt 


- 


7.75" 


8.05" 


7.45* 


5.72* 


3.58 


11.68" 


1.90 


Lycaeninae 


4.86* 


0.19 


4.20* 


0.25 


4.92* 


0.06 


nt 


- 


0.13 


1.77 


0.39 


0.69 


1.85 


1.84 


Nymphalinae 


19.55*** 


0.44 


0.13 


0.77 


20.19"" 


3.17 


nt 


4.98* 


- 


0.63 


0.10 


0.07 


0.94 


2.02 


Limenitinae 


0.00 


1.56 


9.26" 


2.30 


0.01 


3.23 


nt 


3.06 


10.30" 


- 


0.16 


0.13 


0.01 


4.05* 


Charaxinae 


0.27 


1.96 


11.78" 


2.54 


0.13 


2.50 


nt 


2.03- 


11.58" 


0.12 


- 


0.00 


0.24 


1.96 


Satyrinae 


22.39*" 


0.07 


1.21 


0.25 


24.82*** 


2.33 


nt 


5.84* 


0.72 


13.36*" 


12.00** 


- 


0.14 


1.81 


Danainae 


2.98 


0.04 


1.46 


0.02 ' 


2.62 


0.04 


nt 


0.09 


0.85 


1.47 


1.62 


0.37 


- 


4.71' 


Ithomiinae 


14.25*" 


0.10 


0.64 


0.32- 


14.17*** 


1.62 


nt 


2.28 


0.22 


7.75" 


8.36" 


0.03 


0.45 


- 



Table 4. Summary of the between-family differences in relative egg size (controlling for adult size) 
based on a multiple range test. The upper right half of the matrix shows the relative egg size increases 
based on independent contrasts, and the lower left half refers to results based on the species averages 
(relative egg size). * - significant at the PO.05 level or below (the differences themselves are not shown 
for simplicity), ns - not significant. 





Hesperiidae 


Papilionidae 


Pieridae 


Lycaenidae 


Nymphalidae 


Hesperiidae 


- 


ns 


ns 


ns 


ns 


Papilionidae 


* 


- 


ns 


ns 


ns 


Pieridae 


* 


* 


- 


ns 


ns 


Lycaenidae 


* 


ns 


* 


- 


* 


Nymphalidae 


* 


ns 


* 


* 


- 



Table 5. Summary of the between-subfamily differences in relative egg size increase (upper right half), 
and relative egg size (lower left half). Only subfamilies where 9 or more independent contrasts could be 
calculated were compared. All other details as for Table 4. 



Taxon 


Hesp. 


Trap. 


Pyr. 


Par. 


Pap. 


Pier. 


Rio. 


Lye. 


Hel. 


Nym. 


Lim. 


Char. 


Sat. 


Dan. 


Itho. 


Hesperiinae 


_ 


ns 


ns 


ns 


ns' 


ns 


* 


* 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


Trapezitinae 


* 


_ 


ns 


ns 


ns 


ns 


* 


ns 


ns 


nt 


nt 


ns 


ns 


ns 


ns 


Pyrginae 


* 


* 


_ 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


Parnassiinae 


* 


* 


ns 


_ 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


Papilioninae 


* 


* 


* 


ns 


_ 


ns 


* 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


Pierinae 


» 


* 


* 


* 


* 


_ 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


ns 


Riodininae 


* 


* 


* 


* 


* 


* 


_ 


ns 


* 


* 


* 


* 


* 


* 


* 


Lvcaeninae 


* 


* 


* 


* 


ns 


* 


* 


_ 


ns 


ns 


ns 


ns 


* 


ns 


ns 


Heliconiinae 


* 


* 


* 


* 


* 


* 


* 


ns 


_ 


* 


ns 


ns 


ns 


ns 


ns 


Nvmphalinae 




* 


* 


* 


* 


* 


* 


ns 


* 


- 


ns 


ns 


ns 


ns 


ns 


Limenitinae 


» 


* 


* 


* , 


* 


ns 


* 


* 


* 


* 


- 


ns 


ns 


ns 


ns 


Charaxinae 


* 


* 


* 


* 


* 


* 


* 


* 


* 


* 


* 


- 


ns 


ns 


ns 


Satyrinae 


* 


* 


ns 


* 


* 


* 


* 


* 


* 


* 


* 


* 


- 


ns 


ns 


Danainae 


* 


* 


* 


* 


* 


* 


* 


ns 


ns 


ns 


* 


* 


* 


- 


ns 


Ithomiinae 


* 


* 


* 


* 


* 


* 


* 


ns 


ns 


ns 


* 


* 


* 


ns 


- 



Nota lepid. 25 (2/3): 161-175 169 

Discussion 

Taxonomic heterogeneity. The slopes of the lines fitted to the species means are mark- 
edly homogeneous at a high (family) taxonomic level, but differences arise at the sub- 
family level. The overall slope based on the independent contrasts (b= 0.49) appears to 
mask a number of non-coincident trends. These include taxa without evident allometry 
(e.g. Lycaenidae-Theclini, Nymphalidae-Heliconiinae), as well as phyletic lineages 
characterized by slopes that differ significantly from the overall allometry pattern (e.g. 
Pieridae, Papilionidae, Hesperiidae). For analogous reasons, the interpretation of sig- 
nificant differences between family-level slopes is not straightforward. For instance, 
the differences between the skipper and the swallowtail slopes are basically a conse- 
quence of those that exist between the subfamilies Papilioninae (Papilionidae) and 
Pyrginae (Hesperiidae), respectively. This suggests that detailed quantitative compari- 
sons will require a more narrowly defined taxonomic scenario. It is likely that the 
general pattern merely represents an average trend, not a real property of a number of 
the subtaxa analysed. 

Regression lines and models. Determining accurately the regression slopes is inter- 
esting for further evolutionary argumentation, since negative allometry (slope b <1.0) 
would lead to predict enhanced fecundity in large bodied butterfly species (Garcia- 
Barros 2000a). This is exactly the general pattern in butterflies that one would infer 
from the LSR slopes (range of significant b values: 0.35-1.06 for species data, 0.21- 
1 .27 for independent contrasts). In contrast the usually higher RMA slopes (most b 
values >1 .0, irrespective of the type of analysis) would mostly lead to reject the idea of 
a structural relation between body size and fecundity. LSR tends to underestimate the 
slope, and this effect is the stronger the lower the correlation coefficients are (details in 
Rayner 1 985 ; LaBarbera 1 989; Harvey & Pagel 1 99 1 ; Riska 1 99 1 ; Garland et al. 1 992). 
Which method should be preferred depends on the ratio of error variance between the 
two variables. Although there is some support for applying LSR to the present data set 
(McArdle 1987; Garcia-Barros & Munguira 1997), estimates of the measurement er- 
rors in the variables would facilitate the choice of a regression model. Such estimates 
could be calculated from independent estimates of the egg and adult sizes of each 
species. 

Wing length and body size. The results of this work assume that wing length is well 
correlated to overall body size (e.g. body weight: Miller, 1977, 1997), and that the 
relationship between both is roughly constant. This is probably the case in most in- 
stances. However, some degree of architectural heterogeneity may occur even among 
related species, for instance, resulting from selection for flight ability, mating strate- 
gies, or payability (Betts & Wootton 1988; Chai & Srygley 1990; Maiden & Chai 
1992; Wickman 1992; Corbet 2000; Hall & Willmott 2000). In order to improve the 
analyses, one would have to resort to more precise measures of body mass, which 
however are still unavailable for most of the species. 

Conflicting evidence and egg size as related to monocotyledon larval feeding. Con- 
flict between the trends based on the species values and those supported by the inde- 
pendent contrasts may be of interest for evolutionary speculation. For instance, the 



1 /U Garcîa-Barros: Egg to body size allometry of butterflies 

Hesperiidae-Pyrginae would be said to lay relatively large eggs based on the original 
data. However, the regression based on contrasts indicates that evolutionary shirts in 
the relative egg size of these skippers have most often been below the butterfly aver- 
age. This suggests a 'large egg-stage' as plesiomorphic in this group, followed by 
frequent parallel shifts to proportionately lower egg sizes. 

Patterns that vanish after controlling for taxonomic effects are likely to reveal sin- 
gle evolutionary novelties acquired by an ancestral taxon, and subsequently inherited 
by all descendant species. These are identified in the transformed data by one, or a few 
positive contrasts, so that the evolutionary event will have no statistical significance 
(Nylin & Wedell 1994). The volume of the eggs of species with grass-feeding larvae 
provides an example. The Poaceae have leaves with a parallel array of sclerenchyma 
fibres and contain high levels of silica, which make them difficult to chew (Bernays & 
Barbehenn 1987). Large egg size should improve the survival of the correspondingly 
larger newly hatched larvae when these have to feed on tough plant leaves (Wiklund & 
Karlsson 1984; Braby 1994). The longer distance between the mandible bases would 
allow for widest bites, and the widest mandibular muscles would permit a net increase 
in mandibular strength (cf. Nakasuji 1987). However, tests for a positive relationship 
between egg size and larval monocot feeding have not produced any convincing re- 
sults (Garcia-Barros 2000a). A more intuitive reconsideration of the hypothesis is pre- 
sented in Table 6. Two skipper subfamilies (Hesperiinae, Trapezitinae) have larvae 
that feed on monocotyledonous plants. The members of both groups lay proportionally 
larger eggs than the Pyrginae, which use dicot hosts. Further, the slope of the egg to 
body size relation is lower in the Pyrginae. The association between large egg size and 
larval monocot-feeding should hence be regarded as a possibility in the skippers, al- 
though this probably represents a single evolutionary event related to an ancestor of 
the entire Hesperiinae + Trapezitinae clade. The same might hold for the satyrine 
nymphalids, and perhaps other butterflies (Table 6). 

Are small eggs selected for? Small eggs might have been selected for under a number 
of circumstances, such as endophytic or cryptic larval habits (Reavey 1993), or in- 
creased female fecundity. Everything else being equal, egg size reduction should im- 
ply a longer larval development time, and hence a possible trade-off between fecun- 
dity and adult size. This could in turn be compensated for by larval feeding being 
specialised on nutrient-rich parts of the host (Mattson 1980; McNeill & Southwood 
1978; Slansky 1993). These circumstances make one recall the family Lycaenidae, for 
in fact these butterflies lay smaller eggs than expected for their adult body sizes (at 
least when the average is considered, Fig. 4). Further, egg size and body size are only 
loosely linked in the Polyommatini, and apparently unrelated in the Theclini (Table 1). 
Since lycaenid life-histories are often complex, a varied array of specializations may 
contribute to obscure allometric trends in these insects. 

Wiklund et al (1987) found no correlation between the egg weights and female 
body weights of North European pierids, and argued that such pattern could result 
from selection for increased fecundity through increased body size. The present study 
shows that egg size and body size are correlated in the Pieridae. However, the slope of 
the relationship measured on independent contrasts is comparatively low, as it is for 



Nota lepid. 25 (2/3): 161-175 



171 



Table 6. Evidence concerning the possible association between larval feeding on monocotyledonous 
plants and large egg size. The figures given in brackets are the egg sizes expressed as percentages of 
wing length, obtained from the species values that were hierarchically averaged following the taxonomic 
arrangement. An asterisk indicates that the estimate is based in only one or two species. The signs (+, 
-) denote the direction of hypothetical changes in relative egg size (left to right column within each 
row). Although the direction of the shift within the Morphinae depends on the phylogenetic hypothesis 
assumed, it would require no less than one change to larger egg size in combination to one shift to monocots. 
One of the correlated changes has to be deleted if the Brassolinae were shown to be the sister group of the 
Satyrinae or Morphinae. If the two hypothesised reversals to non-monocotyledon hosts are excluded, a 
majority of the events of monocot colonisation happen to be associated with increases in relative egg size. 



Family 


Nearest related taxon 
with dicot hosts 


shift 


Taxon feeding on 
monocots 


shift 


Possible reversals to 
non-monocots 


Hesperiidae 


Pyrginae(3.61) 
Coeliadinae (2.69) 


+ 


[Hesperiinae plus 
Trapezitinae (4.86)] 


+ 


Acleros (Hesperiinae) 
(4.49) 


Lycaenidae 


Riodinids (2.4) 
Mesosemia (2.0*) 


+ 


Napaea (2.8*) 








Other Eumaeini (2.6) 


+ 


Eooxylides (4.2*) 








Jamides bochus (1.8*) 


+ 


J. alecto (2.45*) 






Nymphalidae 


Other Limenitinae 
Euthaliiti (3.6) 


- 


Bebearia (2.3*) 








Other Nymphalids (2.3) 


+ 


Satyrinae (2.8) or 
Brassolinae (2.8) 


- 


Ragadiini (Satyrinae) 

(2.5*) 




Morpho? (2. 1) or other 

Morphinae? or 

other nymphalids? (2.3) 


+? 


Antirrhea (3 .4*) 
Amathusiini (2.6) 







the best represented subfamily, Pierinae. Again, the comparison between the apparent 
relationship and the one derived from the comparative study suggests that proportion- 
ally small eggs represent a basal trait within the Pieridae. This is difficult to judge with 
precision because of the high variance of the contrasts, but it may be stated with some 
confidence for the subfamily Pierinae at least (see Fig. 3). An interpretation is that the 
present pierid pattern represents the result of ancestral reduction in relative egg size, 
probably combined with structural negative allometry. The ultimate reason could well 
have to do with selection for high fecundity, although again other ecological specializations 
(such as larval feeding on highly nutritious substrates) cannot be ruled out. 

Can the evolution of egg and body size be negatively correlated? According to the 
data collected, the evolution of egg size in the Riodininae (Lycaenidae) has proceeded 
following an inverse trend relative to wing size. Negative allometry (slope between 
0.0 and 1.0) is commonplace in most animal groups (Reiss 1989), while a negative 
correlation between increases of egg size and adult body size is surprising. The proc- 
ess implies a generalised minimisation of egg size following evolutionary increases in 
adult size, and oversized eggs in species selected tor small body size. Re-assessing 
this relationship on the light of new evidence proves necessary. There is of course the 
possibility that the number and quality of the size estimates from riodinids was inad- 
equate, or that the taxonomic arrangement adopted (basically following DeVries 1 997) 
is particularly unrealistic. A number of recent descriptions of riodinine eggs (Downey 



1 7? 

1 ' ** Garcîa-Barros: Egg to body size allometry of butterflies 

& Allyn 1980; DeVries 1997) prove that an amount of material is being collected and 
stored in scientific collections. This, together with new life-history data from hitherto 
poorly known species, should soon facilitate a reassessment of the egg to body size 
allometry in the metalmarks. 

Absence of allometry. The Heliconiinae (sensu Harvey, 1991) show no sign of egg 
to body size allometry, and the same applies to the heliconiine tribes Acraeini and 
Heliconiini. To the extent that the data are reliable, it is likely that the diversification of 
size in these butterflies may have been subject to fast evolution in response to varied 
environmental variables. The adult biology of Heliconius is peculiar in several re- 
spects, such as the ability to gather amino acids from pollen and their potentially long 
adult life (e.g. Dunlap-Pianka et al. 1977; Dunlap-Pianka 1979; Brown 1981). Does 
pollen-feeding release egg size evolution to operate within broader limits than in other 
butterflies? In theory, an important contribution of adult-acquired resources to egg 
production could relax the egg size to egg number trade-off (Fox & Czesak, 2000). 
This, together with several other circumstances that may have a bearing on size and 
fecundity (mimicry, migration), render the Heliconiinae another relevant case to deter- 
mine how selection for certain life-history trait values might affect the combined evo- 
lution of egg and adult sizes. Similarly intriguing absences of egg/body size correla- 
tions in the hairstreaks (Lycaenidae, Theclini) and the Graphiini (Papilionidae) also 
deserve further attention. 



Conclusions 

Within the limits imposed by the data, it is clear that butterfly egg size is overall re- 
lated to adult body size by negative allometry, and that this is equally valid for most of 
the clades at the family, subfamily, and tribe levels. There are some relevant excep- 
tions, and these require further research. However, as far as the quantification of the 
allometric relation is concerned, things are not so clear. The results suggest that the 
general pattern (above the family level) may result from a combination of heterogene- 
ous allometric relations within the subordinated subtaxa. Determining the slopes with 
more accuracy is the pertinent next step in this research program. This will prove 
feasible only to the extent that more, and more accurate data, become available, and as 
far as the degree of phylogenetic resolution in this Lepidopteran group is substantially 
increased. Published butterfly life-histories represent a vast amount of data suitable 
for comparative work, and this has only superficially been explored so far. Desirable 
data such as egg weight are not easy to gather under field conditions, but reasonable 
estimates of egg volume can be obtained without much difficulty, e.g. from scale draw- 
ings of egg profiles, slides, or similar means. Hopefully, some of the patterns described 
here will soon be ready for re-consideration. 



Acknowledgements 

I am indebted to Sören Nylin and an anonymous referee, as well as to the editors of this journal, for 
constructive criticism that improved the first version of this paper. A number of persons contributed to 
my egg size data base by sending egg and adult samples, measurements and life history reports, or 



Nota lepid. 25 (2/3): 161-175 173 

facilitated access to printed materials as well as drawings and photographs of butterfly eggs. I should 
hence thank S. A. Abd El Aziz, P. R. Ackery, A. F. Atkins, K.-O. Bergman, D. Bernaud, F. A. Bink, S. W. 
Cheong, R. De Jong, J. Fernandez Haeger, S. J. Johnson, D. Jutzeler, J. Martin Cano, P. J. Merrett, M. L. 
Munguira, D. Sourakov, T. Racheli, F. C. Urich, and A. Vives Moreno. Dozens of keen lepidopterists 
recorded butterfly life histories over the last two centuries; their observations provided the most essen- 
tial materials for this study: While hypotheses come up and decay over the times, just the data will 
remain. 



References 

Atkins, A. F. 1978. The Hesperilla malindeva group from Northern Australia, including a new species 

(Lepidoptera: Hesperiidae). - J.Aust.ent.Soc. 17: 205-215. 
Bernays, E. A. & R. Barbehenn 1987. Nutritional ecology of grass foliage-chewing insects. Pp. 147— 

175. - In Slansky, F. & J. G. Rodriguez (eds.), Nutritional ecology of insects, mites, and spiders. - J. 

Wiley & Sons, New York. 
Betts, C. R. & R. J. Wootton 1988. Wing shape and flight behaviour in butterflies (Lepidoptera: 

Papilionoidea and Hesperioidea): a preliminary analysis. - J.exp.Biol. 138: 271-288. 
Braby, M. F. 1994. The significance of egg size variation in butterflies in relation to host plant quality. - 

Oikos71: 119-129. 
Brower, A. V. Z. 2000. Phylogenetic relationships among the Nymphalidae (Lepidoptera) inferred from 

partial sequences of the wingless gene. - Proc.R.Soc.Lond. (B) 267: 1201-1211. 
Brown, K. S. 1981. The biology of Heliconius and related genera. - Annu.Rev.Ent. 26: 427-456. 
Casagrande, M. M. & O. H. H. Mielke 1985. Estâgios imaturos de Agrias claudina claudianus Stau- 

dinger. - Revta bras.Ent. 29: 139-142. 
Chai, P. & R. B. Srygley 1990. Prédation and the flight, morphology, and temperature of Neotropical 

rain-forest butterflies. - Am.Nat. 135: 748-765. 
Clark, G. C. & C. LG C. Dickson 1971. Life histories of South African Lycaenid butterflies. - Purnell, 

Cape Town. 272 pp., 108 pis. 
Corbet, S. A. 2000. Butterfly nectaring flowers: butterfly morphology and flower form. - Ent.exp. 

appl. 96: 289-298. 
Dethier, V. E. 1940. Metamorphoses of Cuban Lepidoptera. - Psyche 47: 14-26. 
DeVries, P. J. 1997. The butterflies of Costa Rica and their natural history. Volume II: Riodininae. - 

Princeton Univ. Press, Princeton. 288 pp. 
Downey, J. C. & A.C. Allyn 1980. Eggs of Riodininae. - J.Lepid.Soc. 34: 133-145. 
Dunlap-Pianka, H. 1 979. Ovarian dynamics in Heliconius butterflies: correlations among daily oviposition 

rates, egg weights, and quantitative aspects of oogenesis. - J. Insect Physiol. 25: 741-749. 
Dunlap-Pianka, H., C. L. Boggs & L. E. Gilbert 1977. Ovarian dynamics in Heliconiine butterflies: 

programmed senescence versus eternal youth. - Science 197: 487-490. 
Felsenstein, J. 1985. Phylogenies and the comparative method. - Am. Nat. 125: 1-15. 
Fox, C. W. & M. E. Czesak 2000. Evolutionary ecology of progeny size in arthropods. Annu.Rev. 

Entomol. 45: 341-369. 
Garcia-Barros, E. 2000a. Body size, egg size, and their interspecific relationships with ecological and 

life history traits in butterflies (Lepidoptera: Papilionoidea, Hesperioidea). Biol. .1.1. inn. Soc. 70: 

251-284. 
Garcia-Barros, E. 2000b. Egg size in butterflies (Papilionoidea and Hesperiidae): a summary of data. 

J.Res.Lepid. 35: 90-136. 
Garcia-Barros, E. 2000c. Clima y tamano en mariposas diuraas (Lepidoptera: Papilionoidea). Boln. 

Asoc.esp.Ent. 24: 47-64. 
Garcia-Barros, E. 2000d. Notas sobre la biologia de los adultos de Pandoriana pandora (Denis & Schiffer- 
müller, 1775) en la Espana central (Lepidoptera, Nymphalidae). SI III AP Revta. lepid. 28: 97 102. 
Garcia-Barros, E. & M. L. Munguira 1997. Uncertain branch lengths, taxonomic sampling error, and the 

egg to body size allometry in temperate butterflies (Lepidoptera). Biol. J.Linn. Soc. 61: 201 221. 
Garland, T. Jr. & C. M. Janis 1992. Does metatarsal/fcmur ratio predict maximal running speed in cursorial 

mammals? - J.Zool., Lond. 41: 18-32. 



A ' ^ Garcia-Barros: Egg to body size allometry of butterflies 

Garland, T. Jr., P. H. Harvey & A. R. Ives. 1992. Procedures for the analysis of comparative data using 

phylogenetically independent contrasts. - Syst.Biol. 41: 18-32. 
Hall, J. P. W. & K. R. Willmott 2000. Patterns of feeding behaviour in adult male riodinid butterflies and 

their relationship to morphology and ecology. - Biol.J.Linn.Soc. 69: 1-23. 
Harvey, D. J. 1991. Higher classification of the Nymphalidae. Pp. 255-268. - In: Nijhout, H. F. The 

development and evolution of butterfly wing patterns. Smithsonian Institution Press, Washington. 
Harvey, D. J. & J. P. W. Hall 2002. Phylogenetic revision of the Charis cleonus complex (Lepidoptera: 

Riodinidae). - Syst. Ent. 27: 265-300. 
Harvey, P. H. & M. D. Pagel 1991. The comparative method in evolutionary biology. - Oxford Univ. 

Press, Oxford. 239 pp. 
Hoffmann, F. 1933. Beiträge zur Naturgeschichte brasilianischer Schmetterlinge. - Dt.ent.Z. 1932-1933: 

97-148. 
Igarashi, S. & H. Fukuda 1997. The life histories of Asian butterflies. Vol. 1. - Tokai Univ. Press, Tokyo. 

550 pp. 
Kitching, R. L., E. Scheermeyer, R. E. Jones & N. E. Pierce (eds.). 2000. Biology of Australian butter- 
flies. Monographs on Australian Lepidoptera, Vol. 6. - CSIRO Publishing, Collingwood. 395 pp. 
La Barbera, M. 1989. Analyzing body size as a factor in ecology and evolution. - Annu.Rev.Ecol.Syst. 

20: 97-117. 
Marden, J. H. & P. Chai 1991. Aerial prédation and butterfly design: how palatability, mimicry, and the 

need of evasive flight constrain mass allocation. -Am. Nat. 138: 15-36. 
Martin, J. F., A. Gilles & H. Descimon 2000. Molecular phylogeny and evolutionary patterns of the 

European satyrids (Lepidoptera: Satyridae) as revealed by mitochondrial gene sequences. -Mol.Phylg. 

Evol. 15: 70 -82. 
Mattson, W. J. 1980. Herbivory in relation to plant nitrogen content. - Annu.Rev.Ecol.Syst. 11: 

119-161. 
McArdle, B. H. 1987. The structural relationship: regression in biology. - Can.J.Zool. 66: 2329-2339. 
McNeill, S. & T. R. E. Southwood 1978. The role of nitrogen in the development of insect/plant 

relationships. Pp: 77-98. - In: Harborne, J. B. (ed.), Biochemical aspects of plant and animal 

coevolution. J. Wiley, New York. 
Miller, W. E. 1977. Wing measure as a size index in Lepidoptera: the family Olethreutidae. - 

Ann.ent.Soc.Am. 70: 253-256. 
Miller, W. E. 1997. Body weight as related to wing measure in hawkmoths (Sphingidae). - J.Lepid.Soc. 

51: 91-92. 
Nakasuji, F. 1987. Egg size of skippers (Lepidoptera: Hesperiidae) in relation to their host specificity 

and to leaf toughness of host plants. - Ecol. Res. 2: 175-183. 
Nylin, S. & N. Wedell 1994. Sexual size dimorphism and comparative methods. Pp: 253-280. -In: 

P. Eggleton & R. Vane- Wright (eds.), Phylogenetics and ecology. Academic Press, London. 
Parsons, M. J. 1995. The early stages and ecology of Ornithoptera tithonus. Pp: 401^01- In: J. M. 

Scriber, Y. Tsubaki & R. C. Lederhouse (eds.), Swallowtail butterflies: their ecology and evolutionary 

biology. Scientific Publishers, Gainesville. 
Penz, C. M. 1999. Higher level phylogeny for the passion- vine butterflies (Nymphalidae, Helicöniinae) 

based on early stage and adult morphology. - Zool.J.Linn.Soc. 127: 277-344. 
Purvis, A. & A. Rambaut 1995. Comparative analysis by independent contrasts (CAIC): an Apple 

Macintosh application for analysing comparative data. - Comp.Appl.Biosci. 11: 247-251. 
Rayner, J. M. V. 1985. Linear relations in biomechanics. The statistics of scaling functions. - J.Zool. (A) 

206: 415^39. 
Reavey, D. 1992. Egg size in Lepidoptera and its relation to larval feeding. - J.Zool., Lond. 227: 

277-297. 
Reavey, D. 1993. Why body size matters to catterpillars. Pp: 248-279. - In: N.E. Stamp & T.M. Casey 

(eds.), Caterpillars. Ecological and evolutionary constraints on foraging. Chapman & Hall, New 

York. 
Reiss, M. J. 1989. The allometry of growth and reproduction. - Cambridge Univ. Press, Cambridge. 182 pp. 
Riska, B. 1991. Regression models in evolutionary allometry. - Am.Nat. 138: 283-299. 



Nota lepid. 25 (2/3): 161-175 175 

Shapiro, A. M. 1987. r-K selection at various taxonomic levels in the Pierine butterflies of North and 

South America. Pp: 135-152. - In: R. Taylor & F. Karban (eds.), Evolution of insect life histories. 

Springer- Verlag, Berlin. 
Slansky, F. Jr. 1993. Nutritional ecology: The fundamental quest for nutrients. Pp: 29-91. - In: N.E. 

Stamp & T.M. Casey (eds.), Caterpillars. Ecological and evolutionary constraints on foraging. 

Chapman & Hall, New York. 
Starck, J. M. 1998. Non-independence of data in biological comparisons. A critical appraisal of current 

concepts, assumptions, and solutions. - Theor.Biosci. 117: 109-138. 
StatSoft 2000. STATISTICA for Windows (Computer program manual). StatSoft Inc., Tulsa, Oklahoma. 
Urich, F. C. & T. C. Emmel 1991. Life histories of Neotropical butterflies from Trinidad. 5. Dynastor 

darius darius (Lepidoptera: Nymphalidae: Brassolinae). - Trop. Lepid. 2: 145-149. 
van Son, G. 1979. The butterflies of Southern Africa. Part 4, Nymphalidae: Nymphalinae. (Edited by L. 

Vâri). - Transvaal Mus. Mem. 14: 1-130. 
Wickman, P. O. 1992. Sexual selection and butterfly design - A comparative study. - Evolution 46: 

1525-1536. 
Wiklund, C. & B. Karlsson 1984. Egg size variation in satyrid butterflies: adaptive vs. historical, 'Bau- 
plan', and mechanistic explanations. - Oikos 43: 391^400. 
Wiklund, C, B. Karlsson & J. Forsberg 1987. Adaptive versus constraint explanations for egg-to-body 

size relationships in two butterfly families. - Am.Nat. 130: 828-838. 



176 



Book review 



Book Review 

Ronkay, L., J. L. Yela & M. Hreblay (f ) 2001: Noctuidae Europaeae. Volume 5. Hadeninae 

II. 22.2 x 29.2 cm, 452 pp., hardback. Entomological Press, Soro. ISBN 87-89430-06-9. To be 
ordered from: Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Denmark. Price DKK 
1190 (excl. postage; 10% discount to subscribers to the whole series, Vol. 1-12). 

The present volume is the first of two devoted to the noctuid subfamily Hadeninae in the series and also 
includes substantial addenda to the Cuculliinae treated in the previously published volume 7. It begins 
with a preface (in English and French) by the Editor-in-chief, followed (henceforth only in English) by 
a preface and introduction. As usual in the series, a very useful taxonomic and nomenclatural summary 
follows, with these results: one lectotype designation, one newly described subgenus, one newly de- 
scribed species, four newly described subspecies, four existing names elevated to subspecies level, ten 
to species level, five to subgenus level and one to genus level, 34 new synonyms, and eight new combi- 
nations. The authors tried to arrange the species under already existing subgenera within each genus 
when applicable. I personally welcome such a decision, which will favour taxonomic stability. 
Next comes the systematic part. A novelty, triggered by the turmoil that has swept noctuid systematics 
during the last decade, is that the subfamilial system originally used for the whole series had to be 
changed. Now a more tribal rather than subfamilial arrangement has been implemented, since in contrast 
to many of the 'subfamilies' perpetuated in the literature, noctuid tribes are frequently better supported 
as monophyletic units. I firmly believe this step to be a significant one in the right direction. As here 
interpreted, the subfamily Hadeninae includes the classic Hadeninae (sensu Hampson), plus the tribes 
Xylenini, Episemini, Apameini, Eriopini, Glottulini, and the caradrinoid complex (e.g. Hoplodrina, 
Caradrina, Spodoptera, Elaphria, Athetis). The present volume deals with the Orthosiini (with 21 spe- 
cies in six genera), the Xylenini (with 131 species in 31 genera) and the Episemini (with 16 species in 
five genera). 

For the subfamily Hadeninae and for the five tribes dealt with in the book, the authors give very useful 
up-to-date phylogenetic and taxonomic comments, defending the classification adopted in their work, 
although mentioning different points of view raised by authors like Beck (1996, 1999), Poole (1995), 
Kitching & Rawlins (1998) and Yela & Kitching (1999). The reader will certainly be impressed by the 
amount of very up-to-date and verified data incorporated into the texts of the taxa studied. 
For each genus, there are four sections: Taxonomic notes, diagnosis, bionomics and distribution. The 
first section includes numerous and useful, formerly unpublished taxonomic statements. The most im- 
portant novelty is the inclusion of an extremely welcome checklist of the Palaearctic species of each 
genus known to occur in Europe. This places each genus into a proper perspective. Concerning the 
diagnosis section one happily notices that the description of the external characters as well as those of 
the genitalia (male and female) are, in general terms, more complete and detailed than those of the 
previous volumes. Another very welcome novelty is the inclusion, at the end of this section, of a brief 
description of the larval features thoroughly prepared by Matti Ahola. 

Finally, the European species are dealt with one by one, keeping the same four sections as for the genera. 
A distribution map is given for each species. References to male armature, showing separately the aedeagus 
with everted vesica, and female genitalia point to 584 (!) superb photographic plates for all 185 Euro- 
pean species (and some subspecies) of the tribes, of which a considerable part had never been illustrated 
before. Likewise, 21 colour plates by David Wilson figure, in life size, those species and subspecies. The 
book ends with a references list and a useful index. 

This book is a must for researchers working on noctuid moths. No doubt it will be indispensible far into 
the future. The effort devoted into it by the team of authors, editors and photographers is admirable. 
Only very minor mistakes have slipped through. I also missed the inclusion of colour photographs figur- 
ing the final larval stages. The inclusion of such photographs would have enhanced even more the value 
of the book, as was the case in the previous volume 6. I would urge the editors to consider such a 
possibility in the forthcoming issues of Noctuidae Europaeae. 

Victor Sarto i Monteys 



Nota lepid. 25 (2/3): 177-190 177 

The species of Maculinea van Eecke, 1915 in Bulgaria: 
distribution, state of knowledge and conservation status 
(Lycaenidae) 

Zdravko Kolev 

Department of Ecology and Systematics, Division of Population Biology, University of Helsinki, 
FIN-00014 Helsinki, Finland. E-mail: kolev(S)cc. helsinki.fi 



Summary. This paper presents the currently available information on the three species of Maculinea 
occurring in Bulgaria. Their distributions are shown on maps produced on the basis of literature records 
as well as unpublished data. Own observations on habitat preferences and aspects of the biology of these 
species, the first of their kind in the country, are presented. At least three populations of the species 
referred to in Bulgarian literature mostly as 'Maculinea alcorf occur on relatively dry habitat, a prefer- 
ence otherwise known from M. rebeli, and should be referred to by the latter name. Larval host plants are 
reported for M. rebeli (eggs and egg-laying of one population on Gentiana asclepiadea) and M. nausithous 
(Sanguisorba officinalis, by association of adult butterflies with that plant). The unusual host plant af- 
filiation of one M. rebeli population again emphasizes the need for a re-appraisal of the taxonomy of the 
alcon complex in south-eastern Europe. The conservation status of all species is assessed. Only M. 
nausithous is of immediate conservation concern; measures are proposed for research on, and conserva- 
tion of, its populations in the country. 

Zusammenfassung. Auf der Grundlage von Literaturdaten und neuen Feldbeobachtungen wird die 
bekannte Verbreitung der drei in Bulgarien heimischen Maculinea- Kritn in Karten dokumentiert. 
Ergänzend werden eigene Beobachtungen zur Habitatbindung und zu Aspekten der Lebensweise 
vorgestellt; dies sind die ersten derartigen Daten aus Bulgarien. Zumindest drei Populationen der in der 
Literatur als „Maculinea alcon" bezeichneten Art besiedeln ein trockenes Habitat, was andernorts nur 
von M. rebeli bekannt sind. Daraus wird geschlossen, daß diese bulgarischen Populationen dem Taxon 
M. rebeli zuzuordnen sind. Der taxonomische Status des alcon/rebeli-Komplexes bedarf nach diesen 
Erkenntnissen einer umfassenden Überarbeitung. Wirtspflanzen wurden für M. rebeli (Eiablage- 
beobachtungen auf Gentiana asclepiadea) und M. nausithous (enge Assoziation der Falter mit Sanguisorba 
officinalis) beobachtet. Der Status der drei Maculinea- Arten im Hinblick auf den Naturschutz wird 
aufgrund der verfügbaren Information beurteilt. Nur M. nausithous, die bisher nur von einem Reliktareal 
in unmittelbarer Umgebung der Hauptstadt Sofia bekannt ist, ist unmittelbar gefährdet. Maßnahmen zur 
weiteren Erforschung und zum Schutz der bulgarischen A/ürcw/wea-Populationen werden vorgeschlagen. 

Pe3K>Me. HacTOHuiaTa nyöJiHKaitH» oöoömaßa HajiHHHaTa HHabopiviauHfl 3a TpHTe BHjia ot po,n, 
Maculinea, cpeuiauiH ce b Btjirapna. Pa3npocTpaHeHneTO hm e KaprapaHO Ha ocHOBaTa KaKTO Ha 
jiHTepaTypHH, Taxa h Ha HenyöJiHKyBaHH AaHHH. ,H,OKa3Ba ce, ne bhat>t, H3BecTeH Aocera b ß-bjirapiiH 
KaTO «Maculinea alcon», BCbuiHOCT OTTOBapa no eKOJiorHHHHTe ch xapaKTepncTHKH Ha 6jiH3KHfl mi;i 
M. rebeli. npeACTaßeHH ca pe3yjiTaTHTe ot npoyHBaHHHTa Ha aBTopa, ni»pBHTe no po,na ch b crpaim in. 
B-bpxy hhkoh cTpaHH ot ÖHOJiorHHTa Ha Te3H BHAOBe. OboömaßaT ce xpaHHTejiHH pacTemiM 3a rebeli 
{Gentiana asclepiadea) h nausithous {Sanguisorba officinalis). B-bnpeKH mc h rpiiTC BH^a ca pcikii n 
jiOKajiHH, caMO nausithous e 3acTpaiueH. IipeA-naraT ce MepKH 3a no-HaTarbuiHOTO my inyMaiume ii 
ona3BaHeTO Ha 3a6ejie>KHTejiHHTe My pejiHKTHH nonyjiauHH, eAHHCTBeHHTe no pofla CH ua 
BajiKaHCKHH nojiyocTpoB. 

Key words: Lycaenidae, Maculinea, taxonomy, habitat, biology, IUCN Red List Categories, conser- 
vation, Bulgaria 



Introduction 

The genus Maculinea comprises some of the most fascinating and vulnerable butter- 
flies in Europe, a distinction that is due on both counts to their complex larval develop- 
ment which is unique among European butterflies. The larvae of \4aculinea possess 
sophisticated adaptations for a parasitic lifestyle in the final larval instar which they 

©Nota lepidopterologica, 15.11.2002. ISSN 0342-7536 



i ' O Kolev: Species of Maculinea in Bulgaria 

spend inside nests of ants of the genus Myrmica (see Elmes et al. 2001 and references 
therein). Larvae of each Maculinea species are narrowly specialised to develop with 
only one or very few Myrmica host species (Thomas et al. 1989). Once adopted into 
the ant nest, the larvae of the more primitive species prey on ant brood, while those of 
the more advanced species have carried their mimicry of ant larvae even further and 
are fed directly by the ants in a cuckoo-like manner (Elmes et al. 1991; Elmes et al. 
1994). As a result of their specific resource requirements, all Maculinea species can 
only exploit very narrow ecological niches defined by the presence of both the host 
plant and, especially important, the host ant in sufficiently high densities to support a 
viable population of the butterfly (Thomas et al. 1998). The drastic decline and numer- 
ous local extinctions experienced by most Maculinea species in central and northern 
Europe during the 20th century are attributable to the alteration or destruction of 
suitable habitats caused by cessation of traditional methods of land-use (on which 
most Maculinea habitats in central and northern Europe depend) as well as different 
industrial and agricultural activities (for a detailed review see Munguira & Martin 
1999). 

Published information so far available on Maculinea in Bulgaria consists of little 
more than distribution records. The overwhelming majority of these carry virtually no 
information other than locality data and, in very few cases, vague habitat descriptions 
of little practical use. Even until only very recently, the old catalogue of Bulgarian 
butterflies and larger moths (Buresch & Tuleschkow 1930) remained the most com- 
prehensive source of such records. It listed 13 localities of 'Lycaena alcon F.[sic]' 
(=Maculinea rebeli (Hirschke, 1904) under the definition used here, see below), 21 of 
'Lycaena arion L.' {Maculinea avion (Linnaeus, 1758)) and a single, doubtful record 
of 'Lycaena areas Rott.' {Maculinea nausithous (Bergsträsser, 1779)). Since the pub- 
lication of this catalogue, numerous records of Maculinea were reported in scattered 
faunal publications, the majority in Bulgarian language. Of these, most interesting are 
the reports by Gogov (1963) and Vihodcevsky & Gogov (1963), who established be- 
yond doubt the occurrence of M. nausithous in the country. However, the paucity of 
basic information about Bulgarian Maculinea has been aggravated by the fact that 
these sporadic records are virtually inaccessible to non-Bulgarian researchers. This 
was emphatically shown by a recent assessment of Maculinea distributions in Europe 
(Wynhoff 1998) which lacked any spécifie records from Bulgaria. 

The latest publication concerning Bulgarian Maculinea is a distributional atlas which 
summarised most of the currently known records of butterflies in the country (Abadjiev 
2001). Although providing only distibution data, this atlas, written entirely in English, 
combines UTM maps (10x10 km grid) with a list of all mapped localities for each 
species and is thus the single most important source of locality data for Bulgarian 
Maculinea to date. It lists 63 localities for M. arion falling into 51 UTM squares, 33 
localities for M. rebeli falling into 22 UTM squares, and two localities for M. nausithous 
falling into a single UTM square. It has to be noted that this atlas omits a few published 
records of Maculinea, notably of M. arion from the eastern part of Mt. Alibotush 
(Drenowski 1 930) as well as M. arion from Mt. Stara Planina (Shipka) and Mt. Rhodopi 
(Batak dam; Naretchenski Bani) and 'Maculinea sevastos' (=M rebeli under the defi- 



Nota lepid. 25 (2/3): 177-190 179 

nition used here, see below) from Mt. Stara Planina (Shipka) and Mt. Rhodopi 
(Naretchenski Bani) reported by Bâlint ([1995]). 

The first information on the present-day conservation status and priorities for re- 
search and conservation of Bulgarian Maculinea was compiled by the present author 
and eventually appeared in the 'Action plan for Maculinea butterflies in Europe' 
(Munguira & Martin 1999). My research since 1997, when these data were gathered, 
showed that, due to the occasional use of unverified second-hand sources, my original 
contribution contained several errors mostly pertaining to details of the distribution of 
M rebeli and M. nausithous. Corrections were duly suggested to the editors but these 
errors nevertheless found their way into the final version of the Action Plan. Likewise, 
the information concerning threats to and conservation status of M. nausithous pre- 
sented in that publication has to be augmented in the light of new information that 
became available in 1999. 

The purpose of this paper is to provide a concise and updated review of the distribu- 
tion, ecology and conservation status of the Maculinea species occurring in Bulgaria. 
This is particularly important in view of the advances that are presently being made, 
under the auspices of the Council of Europe, towards creating a co-ordinated strategy 
for the study and conservation of European Maculinea (Munguira & Martin 1999). 
The following aspects of each species are discussed here: 

Taxonomy. This is dwelt upon briefly in the case of M avion and M. nausithous, 
which present no special problems in this respect. The closely related taxa alcon ([Denis 
& Schiffermüller], 1775) and rebeli (Hirschke, 1904) present a complicated case that 
remains so far unresolved. 

Distribution. This is outlined in appropriate detail in the text. Due to the large 
number of localities involved in the case of rebeli and especially arion, only previ- 
ously unpublished data are listed. The accompanying maps show all records that could 
be traced to a specific locality as well as unpublished data from several collections, 
which include my own materials and field records amassed since 1986. Localities of 
numerous M arion and M. rebeli specimens collected by A. Slivov and presently pre- 
served in the collection of the Institute of Zoology, Sofia (hereafter abbreviated as 
IZS) are included here, with the following cautionary note. The materials of A. Slivov 
in that collection contain a considerable number of clear, in some cases grave, cases of 
mislabelling (Kolev 2002). Thus, even though all locality data of the Maculinea speci- 
mens are, in my opinion, entirely plausible (which is why they arc included here) an 
eventual confirmation of these records should be attempted. The records by Drenow ski 
(1930) and Bâlint ([1995]) omitted by Abadjiev (2001 ) are also included in the maps; 
these localities are listed above. 

Habitat and biology. Based on my own observations, the habitats oi' each 
species are described and larval host plants are reported lor rebeli and nausithous. No 
host ant species have yet been identified for any of the Bulgarian Maculinea. Brief com- 
ments on flight period and population size are included; the latter are however based on 
casual observations and counts and should not be taken as estimates of population size. 
Conservation status. This is assessed using the latest revised IUCN Red List 
Categories (IUCN 2001). 



1 80 

LOKJ Kolev: Species of Maculinea in Bulgaria 

Threats. I have attempted to estimate if and what potential threats exist for each 
species. Much of this evidence available is speculative as no previous information on 
this issue exists in Bulgaria. 

Priority actions. I give a personal opinion, based on where the most signifi- 
cant data deficiencies lie, as to what aspects of each species should be studied next. 
This is especially important in the case of the relict populations of M nausithous, the 
only Maculinea species in the country that is in need of active protection in view of its 
endangered status. 



Results 

Maculinea arion (Linnaeus, 1758) 

Taxonomy. Bulgarian specimens correspond well to nominotypical M arion. There 
is considerable individual variation in size, ground colour and extent of wing mark- 
ings, apparently in response to local environmental factors and thus, in my opinion, 
without taxonomic significance. 

Distribution. This is the most widespread Maculinea species in Bulgaria. It 
occurs in hilly lowland terrain and mountains, at altitudes between 150 and 1800 m 
(Fig. 1). The higher concentration of records in the central-western and south-western 
parts of the country is at least partly due to the relatively better state of lepidopterological 
exploration of these regions (cf. Abadjiev 2001: 10). The butterfly faunas of large 
areas (e.g. north-eastern Bulgaria, the foothills of Stara Planina, eastern Rhodopi, the 
lower mountains along the western border, etc.) are very poorly known. In view of 
this, there is little doubt that the known localities of arion represent but a fraction of 
the real distribution of the species in the country. 

Previously unpublished localities. Dobrogled village north-west of Vama, 250 m 
(Z. Kolev &N. Shtinkov leg. & coll.). - Dobrudzha: 'Palamara' game reserve [200-250 m] (A. Slivov 
leg., in coll. IZS). - Dobrudzha: Alfatar town [170-200 m] (A. Slivov leg., in coll. IZS). - Mt. Stara 
Plänina: the path from Cherni Osûm village to 'Ambaritsa' chalet, 800-1200 m (N. Shtinkov in litt.). - 
[Karnobat town, 200-250 m] (in coll. Karnobat Zoo). - Mt. Rila: the path from Rilski Manastir to 
Cherni rid, below 'Ravna' locality, 1300-1400 m (Z. Kolev leg. & coll.). - Mt. Pirin: 'Popina Lûka' 
locality, 1200-1300 m (A. Slivov leg., in coll. IZS). - Mt. Pirin: Dobrinishka river 2 km south of the 
'Kozarevi Ribarnitsi' historical site, 1100-1200 m (Z. Kolev leg. & coll.). - Mt. Pirin: 'Yavorov' chalet 
[1750 m] (A. Slivov leg., in coll. IZS). - Mt. Rhodopi: the ridge between 'Kleptuza' mineral springs and 
the valley of Lepenitsa river, 900-1000 m (Z. Kolev leg. & coll.). - Mt. Rhodopi: Velingrad town, [900- 
950 m] (N. Shtinkov in litt.). - Mt. Rhodopi: Lukovitsa river valley, 300-350 m (Z. Kolev leg. & coll.). 
- Mt. Rhodopi: Khvoyna village, 750-900 m (Z. Kolev leg. & coll.). 

Habitat and biology. M arion inhabits a wide range of habitats in Bul- 
garia: flowery meadows, pastures, forest glades and clearings, dry rocky gullies and 
slopes covered with sparse pine woodland, roadsides etc. The species occurs in mesic 
as well as xeric conditions, avoiding truly xerothermic or excessively wet habitats. 
The adults fly in a single generation from mid- June to late July, at higher altitudes till 
mid-August. 

As far as can be judged, most of the known arion habitats in Bulgaria do not depend on 
sustained human activities. So far only a single case is known where grazing by live- 



Nota lepid. 25 (2/3): 177-190 181. 

stock has created an unnatural habitat with extremely favourable conditions for avion. 
In 1992 N. Shtinkov and I discovered an unusually large population in western Rhodopi 
Mts. located at an altitude of 900-1000 m on a west-facing slope of a ridge between 
the valley of Lepenitsa river and the 'Kleptuza' mineral springs on the outskirts of 
Velingrad. The habitat is a dry, heavily overgrazed pasture in sparse pine forest with 
large-scale erosion of the sandy topsoil. Very few butterfly species were observed in 
this highly degraded habitat, avion being relatively the most abundant (precise counts 
could not be made). This is a dramatic reversal of the normal condition of this species' 
relative rarity: Bulgarian populations of avion are typically very localised and small, 
usually with less than four specimens seen at a time. 

The larval host plant of avion has not been identified positively in the country as 
yet. Elsewhere in Europe these are species of the group of Thymus serpyllum L., as 
well as Oviganum vulgave L. (e.g. Elmes & Thomas 1992; Munguira & Martin 1999), 
and Myvmica sabuleti and My. scabvinodis serve as most important ant hosts (Thomas 
etal. 1989). 

Threats. The total population of M. avion in Bulgaria is apparently out of dan- 
ger. The species occurs in numerous localities over a large part of the country. Its 
habitats, for the most part, do not appear to be critically affected by adverse human 
activities. Finally, its actual distribution is certainly much wider than presently known. 
Small isolated populations may be vulnerable to activities with the potential to destroy 
the whole or most of their habitat. 

Conservation status. Lower risk, least concern. 

Priority actions. Research on the plant and ant hosts of M. avion, preferably 
encompassing a wider range of habitats with varying humidity, is desirable. Conserva- 
tion measures are not needed. 



Maculinea rebeli (Hirschke, 1904) 

Taxonomy. The closely related, externally very similar taxa a/con [Denis & 
Schiffermüller], 1775 and vebeli Hirschke, 1904, form a problematic pair whose 
taxonomic relationship to each other and, consequently, the taxonomic status of the 
latter, are still fraught with controversy. The high-altitude 'form' rebeli of M alcon 
was first separated from alcon on species level by Berger (1946) on account of the 
two taxa living in different habitat types, respectively dry and damp. More recent 
research on the ecology (Thomas et al. 1989) and larval morphology (Munguira 
1989) of alcon and vebeli revealed differences that lend what has been accepted as 
decisive support to the existence of two species. However, other authors (e.g. Kaaher 
1964; Kudrna 1996; Tolman & Lewington 1997) have repeatedly raised the argu- 
ment that the purported differences between the two taxa in morphological and eco- 
logical characters are in fact connected by intermediate states and that therefore the 
species status of vebeli is questionable. Only a rigorous and extensive genetic stud) 
can resolve this issue, which cannot be further discussed here, lor the present report 
I follow the currently most widely accepted treatment o\~ rebeli and alcon as two 
species defined on ecological grounds as follows (after Munguira & Martin 1999). 



1 8? 

iOZ ' Kolev: Species of Maculi nea in Bulgaria 

Maculinea alcon is hygrophilous and occurs in wet or marshy, mainly lowland mead- 
ows on acidic soils; its larval host plants are Gentiana pneumonanthe L. and Gentiana 
asclepiadea L. and its host ants are Myrmica scabrinodis Nyl., My. ruginodis Nyl. 
and My. rubra L. Maculinea rebeli is xerophilous and occurs in more or less dry 
meadows in lowlands and mountains, always on calcareous soils; its larval host plants 
are Gentiana cruciata L. and Gentianella germanica (Willd.) Borner and its princi- 
pal host ant is Myrmica schencki Emery (also recorded are My. sulcinodis Nyl., My. 
sabuleti Meinert and My. scabrinodis). An interesting confirmation of the applica- 
bility of this approach also outside western Europe is the recent separation of the 
'alcon' populations of European Russia into alcon and rebeli based on habitat type 
and host plant (Dantchenko et al 1996). 

However, within alcon (and probably also within rebeli) there is geographic varia- 
tion in the use of host plants and ants (e.g. Elmes et al. 1994, Gadeberg & Boomsma 
1997). Moreover, here it must be noted that populations with rebeli-typQ habitat pref- 
erences may also thrive on Gentiana asclepiadea (Tolman & Lewington 1997; see 
below). This should again serve as a reminder that the differences in ecological re- 
quirements between alcon and rebeli (in this case with regard to the habitat and spe- 
cies identity of their host plants) may not always be as clear-cut as it may appear from 
the above definition. 

On species level, the populations of the alcon type in Bulgaria were until recently 
referred to as 'alcon\ with the curious exception of Bâlint ([1995]) who used, with- 
out further explanation, the name 'Maculinea sevastos' in connection with Bulgar- 
ian populations. Based on my observations on the habitats of two newly discovered 
populations (Mt. Rhodopi: the town of Smolyan, 1000m; Mt. Alibotush: Hambar 
Dere gorge, 1300-1400 m) and inferences regarding the geological habitat substrate 
of the majority of known populations in the country (see below), I recently associ- 
ated rebeli with the Bulgarian fauna and accordingly excluded alcon from it (cf. 
Munguira & Martin 1999). On this basis Abadjiev (2001) too assigned all Bulgarian 
populations to ' Glaucopsyche rebeli '. The more detailed observations on the habitat 
and oviposition preferences of another newly discovered Bulgarian population (see 
below) support this conclusion. This agrees with the opinion expressed by some 
authors that all records of 'Maculinea alcon' from the mountains of the Balkans and 
Greece should be referred to rebeli (van der Poorten 1982; Tolman & Lewington 
1997). Pamperis (1997) figured eggs on G cruciata observed at an unspecified north- 
western Greek locality in the Epirus province at 1300 m altitude, which again points 
to an affiliation of at least some Balkan mountain populations with rebeli rather than 
alcon. 

Morphologically, the Bulgarian material at my disposal does not differ from mate- 
rial of the alcon group from different regions of Europe (in the collection of the Zoo- 
logical Museum, University of Helsinki). However, it should be noted that Bulgarian 
females resemble true alcon more than typical rebeli in that the blue suffusion on the 
upperside is much less extensive: it is either absent or, if present, does not reach the 
postdiscal area. However I consider it premature at this point to discuss the issue of 
whether there are sufficient grounds to recognise the taxon sevastos (Rebel & Zerny, 



Nota lepid. 25 (2/3): 177-190 183 

1931), described from Montenegro (Zljeb) and Albania (Pashtrik), as a separate Bal- 
kan and Bulgarian subspecies of rebeli. 

Distribution. In Bulgaria, M. rebeli is rare and very local. It occurs mainly in 
the country's medium-high and high mountains or their foothills: Stara Planina, Vitosha, 
western Rhodopi, Rila, Pirin, Alibotush, the karstic Zemen gorge between the massifs 
Konyavska Planina and Zemenska Planina, and the foothills of Osogovska Planina 
near the town of Kyustendil. The occurrence of this taxon on Mt. Belasitsa in the 
extreme south-west of the country (Munguira & Martin 1 999) is so far unconfirmed. 
The records from the mountains span an altitudinal range of 500-2100 m, with most 
known populations occurring at altitudes between 800 and 1 700 m. Two lowland lo- 
calities (at about 200-250 m) are also known from the limestone region Dobrudzha in 
north-eastern Bulgaria (Fig. 2). The lepidopteran fauna of Dobrudzha is very poorly 
known and further localities of rebeli may be expected to exist there. This applies even 
to the relatively best-known mountainous strongholds of this species such as Rila and 
Rhodopi. 

The apparent disparity between rebeli occurring in lowlands in northern Bulgaria, 
but at much higher altitudes in the southern half of the country is explained by the 
major climatic difference between these two areas. Due to the climatic barrier of Stara 
Planina range, the climate is continental to the north of this mountain chain but much 
warmer, with pronounced Mediterranean influence, to the south of it, with the excep- 
tion of the higher mountains. Thus, species not adapted to survive under more Medi- 
terranean climatic conditions occur only at higher altitudes in southern Bulgaria. Very 
similar 'dichotomous' distributions in the country are exhibited by other central Euro- 
pean butterflies, e.g. Lasiommata petropolitana (Fabricius, 1787) and Coenonympha 
glycerion (Borkhausen, 1788). 

Previously unpublished localities. Dobrudzha: 'Palamara' game reserve [200-250 
m] (A. Slivov leg., in coll. IZS). - Mt. Stara Planina: nature park 'Karandila', 950-1000 m (Z. Kolcv leg. 
& coll.). - Mt. Rila: 'Bayuvi Dupki' biosphere reserve [precise altitude unknown: the reserve encom- 
passes altitudes from 1200 to 2820 m] (A. Slivov leg., in coll. IZS). - Mt. Rhodopi: Smolyan town, 1000 
m (Z. Kolev leg. & coll.). - Mt. Rhodopi: 'Perelik' chalet [1900 m] (A. Slivov leg., in coll. IZS). - Mt. 
Rhodopi: Trigrad village, 1200 m (A. Slivov leg., in coll. IZS). 

Habitat and biology. M rebeli in Bulgaria inhabits flowery meadows, 
dry mountain grassland as well as rocky, grassy glades and margins of deciduous, 
mixed or coniferous forests. Truly xerothermic conditions are avoided. The habitats 
with which I have personal experience or for which sufficiently precise geological 
data could be found (after Gerasimov & Gulubov 1966) e.g. all localities in 
Dobrudzha, Zemen gorge, Mt. Alibotush: Hambar Dere gorge, Mt. Rhodopi, Mt. 
Pirin, Stara Planina Mts: 'Karandila' - lie invariably on calcareous rock (in most 
cases dry karst). However, the substrate for some habitats (e.g. in Mt. Rila, the foot- 
hills of Osogovska Planina, Sofia: Lozenets suburb) remains to be determined \\ ith 
certainty. The adults fly in one generation from the second half of June till the begin- 
ning of August. Populations are typically very small: usually less than four or five 
specimens are seen at a time. An exception is the newly discovered population in the 
nature park 'Karandila', in which about 40 individuals were counted on a single day 



1 84 

10 ^ Kolev: Species of Maculinea in Bulgar ia 

(19.vii.1999): this appears to be the highest count so far for any Bulgarian popula- 
tion of rebeli. The habitat and butterfly fauna of this remarkable locality are de- 
scribed in more detail elsewhere (Kolev 2002). 

Because of its size the last-mentioned population proved particularly well suited 
for observations on oviposition preferences, which I carried out in July 1999. In all 96 
Gentiana plants were found in the habitat which measured about 800 m 2 ; 71 of these 
carried a total of 672 eggs. In addition oviposition was directly observed once. The 
larval host plant, initially presumed by me to be G cruciata, was identified in all cases 
as Gentiana asclepiadea L. by Michaela Yordanova (Faculty of Botany, University of 
Sofia) using the latest identification guide to Bulgarian plants (Andreev et al 1992); 
particular care was taken to ascertain that the plant samples were indeed not G cruciata. 
In the said habitat this plant grows in dry, stony places as well as in more shaded 
conditions at the forest edge and in higher, denser grass. However, robust plants either 
in flower or with well-devéloped flower buds, growing in small groups on exposed, 
dry rocky ground amid sparse and low (0-30 cm) vegetation, were preferred for ovipo- 
sition. The eggs were laid on the flowers and flower buds and at the base of the upper- 
most leaves. Interestingly, according to Andreev et al. (1992) G asclepiadea is found 
in 'grassy, bushy and forested places' in all high mountains of Bulgaria, but only above 
1000 m. In the studied habitat this plant is therefore near the lower limit of its distribu- 
tion. The present discovery may therefore not apply to populations of rebeli at lower 
altitudes. The host plant most commonly associated with rebeli in Europe, Gentiana 
cruciata, occurs in Bulgaria in 'stony, grassy, bushy and forested places' at altitudes 
above 200 m in Dobrudzha and in the hilly and mountainous regions of central and 
southern Bulgaria (Andreev et al. 1992). It is thus a very likely host of at least the 
lowland populations of Bulgarian rebeli, too. 

Threats. No direct threats exist at present to the total population of M rebeli in 
Bulgaria. As in the case of arion, smaller populations may be vulnerable to extinction 
caused by physical destruction of most or the entire habitat. No documented cases of 
such extinctions are known, but it is necessary to establish whether e.g. the population 
that existed more than 70 years ago in Lozenets (Buresch & Tuleschkow 1930), pres- 
ently a heavily urbanised suburb of Sofia, still survives there. The small number of 
known populations and the relatively restricted area of potentially suitable calcareous 
habitats make rebeli a species of higher conservation concern relative to arion. 

Conservation status. Lower risk, near threatened. 

Priority actions. Further research on the taxonomy, distribution and biol- 
ogy of Bulgarian M. rebeli is needed. The possible effects of vegetation succession on 
populations that may be affected by it, such as those at higher altitudes in Mt. Rhodopi, 
should be studied. Conservation measures are presently not needed. 



Maculinea nausithous (Bergsträsser, 1779) 

Taxonomy. Bulgarian specimens correspond well to nausithous from the main 
European range of the species. There is little variation, mainly in size as well as in the 
extent and brightness of the blue upperside suffusion of males. 



Nota lepid. 25 (2/3): 177-190 185 

Distribution. The populations of M. nausithous in this country are widely sepa- 
rated from the main European range: the nearest localities, in Slovenia and northern 
Croatia (Jaksic 1988) and western Ukraine (Wynhoff 1998), are about 600 km away. 
In Bulgaria this species is found in an extremely limited area on the southern outskirts 
of Sofia, namely the foothills and lower slopes of the adjacent mountains Lyulin and 
Vitosha (Fig. 3). Most records are from the slopes of Lyulin above the suburb of Gorna 
Banya. A single specimen was first collected there in 1904 (Drenowski 1907) but this 
record remained doubtful until 1957, when a population was discovered and speci- 
mens were collected during four consecutive years (Gogov 1963). Subsequent records 
from Mt. Lyulin are lacking until 1999, when I discovered a small population at 750-800 
m. It is unfortunately not known whether all these records concern the same population. 
The other known localities of this species are very poorly documented. In 1955 a 
single specimen was found in the suburb of Boyana on the lower slope of Vitosha 
(Vihodcevsky & Gogov 1963); in the collection of the museum of Natural History in 
Burgas there are additional specimens from this locality with labels "Boyana, 5.7.[19]55" 
collected by the late Sevar Zagorchinov. More recently, nausithous has been established 
in two further localities (see below). All records come from an altitude of about 650-850 
m. The information in Munguira & Martin (1999) regarding the occurrence of nausithous 
near the town of Kostinbrod, just north of Sofia, is erroneous. It is interesting that, de- 
spite the presence of extensive meadows with abundant growth of Sanguis or -ha officinalis 
L. (pers. observ.), this butterfly has not yet been discovered on Lozenska Planina, a small 
massif immediately to the east of Vitosha (S. Abadzhiev, pers. comm.). 

Previously unpublished localities. Sofia: Vladaya suburb at the junction of Mt. Lyulin 
and Mt. Vitosha [750-800 m] (S. Beshkov, pers. comm.). - Sofia: Sukhodol suburb north of Mt. Lyulin 
[650-700 m] (I. Stoychev leg. & coll.). - Mt. Lyulin: south-west of Gorna Banya suburb, 750-800 m (Z. 
Kolev leg. & coll.). 

Habitat and biology. Precise habitat descriptions are lacking for most 
Bulgarian localities of M nausithous. In the newly discovered locality on Mt. Lyulin 
this species was found only in a small part of a tall-grass meadow, in which Sanguisorba 
officinalis L. was present. Unlike in central Europe, where nausithous is found in damp, 
marshy habitats with some preference for their relatively drier edges (e.g. Tolman cV: 
Lewington 1997; Munguira & Martin 1999), the newly discovered habitat as well as 
that in Sukhodol (I. Stoychev, pers. comm.) are situated on slopes with well-drained 
sandy soils and are much drier than what is generally considered acceptable to this 
species. M nausithous has a single generation Hying approximately from early July 
(judging by the somewhat worn condition of the specimens observed by me on 
10.vii.1999) till the second half of August. The populations are small. Thus. Gogov 
(1963) reported the number of specimens collected by him in a single locality on Mt. 
Lyulin as follows: '21.vii.1957: 1 male; L.viii. 1958": 4 males, 1 female; 3.viii. 1959: 2 
males, 1 female; 18.viii.1960: 12 very worn specimens'. In the Sukhodol locality less 
than ten specimens were seen during several hours of intensive search (I. Stoychev, 
pers. comm.). My observations yielded the highest count so far for a Bulgarian popu- 
lation of nausithous: about 20 individuals during a two-hour census. 



^"^ Kolev: Species of Maculinea in Bulg aria 

All butterflies observed by me were found on or in immediate proximity to 
Sanguisorba officinalis plants, on whose flowerheads the adults perched and drank 
nectar. Although oviposition was not observed, nor were any eggs found, the close 
association of all observed butterflies with Sanguisorba officinalis leaves no doubt 
that this plant is the host for young larvae of nausithous in this Bulgarian locality, as 
elsewhere in Europe (e.g. Malicky 1969) and western Asia (Hesselbarth et al 1995; 
Korshunov & Gorbunov 1995). 

Threats. The known populations of M. nausithous are situated in immediate 
proximity to the most densely populated region in Bulgaria. Prior to the present study 
the status of nausithous in Bulgaria had not been critically examined, although it was 
listed as 'vulnerable' in the Red List of Bulgarian Butterflies and Moths (Ganev 1985). 
On the basis of this source and in the absence of more definite data, I provisionally 
retained this status (cf. Munguira & Martin 1999). Potential or actual threats have yet 
to be identified for any of the Bulgarian populations. Urban development may prove to 
be of concern in the more urbanised foothills of Vitosha and in the suburb of Sukhodol 
(Munguira & Martin 1999). Mowing of the extensive meadows on Lyulin, which was 
observed also in the meadow inhabited by nausithous, may affect the populations of 
the butterfly on that mountain. The newly found nausithous population as well as the 
only S. officinalis plants in the extensive meadow were located, significantly, at the 
very fringe of the meadow where mowing has been much less thorough due to the 
steeper, more uneven terrain. 

Conservation status. In Bulgaria, presently available data suggest that M 
nausithous meets the criteria for category 'Endangered' (IUCN 2001). It is thus the 
only member of its genus in the country of immediate conservation concern. 

Priority actions. The ecological requirements of M nausithous and its hosts 
must be studied in detail. Extensive search for new populations of the butterfly in the 
southern environs of Sofia as well as neighbouring regions is necessary, as is a regular 
monitoring scheme for at least some localities. The potential or existing threats to all 
populations should be identified. In view of the proximity to the capital and the re- 
stricted size of the area involved, most if not all of the research could be carried out 
efficiently and relatively inexpensively in the form of field exercises or individual 
research projects for students of biology at the University of Sofia. Since mowing may 
prove to be an important factor for preventing afforestation of nausithous habitats, a 
total ban on mowing there should perhaps not be pursued. Instead, it is recommended 
that conservation actions in mown habitats should focus on restrictions of mowing 
during the flight period of the butterflies and the time needed for their larvae to com- 
plete their feeding on the host plant (see Garbe 1993). Providing a legal basis for the 
protection of this species and its habitats in Bulgaria is most desirable. 



Concluding remarks 

The present contribution reports 1 3 new localities of Maculinea arion, 6 of M rebeli 
and 3 of M nausithous, which is a significant increase in the known distribution of all 
these species in Bulgaria. This once again underscores the fact that there is yet much 



Nota lepid. 25 (2/3): 177-190 



187 



fà 








• r^\ 


^ft. v l^ 


5/ 










**j 


W' 


-a..'- * ># 




u 




""S" 


\_J Okm 


50 100 






l M-^~ 




- r \ ■ / 


{ m 200 600 1000 1600 2200 


!^~- 1 1 


1 1 1 i 







Fig. 1. Known records 
of Maculinea arion in 
Bulgaria. 




0m 200 600 1000 1600 2200 

I I I 1 



Fig. 2. Known records 
of Maculinea rebeli in 
Bulgaria. 




Flg. 3. Known records 
of Maculinea 
nausithous m Bulgaria. 



1 88 

100 Kolev: Species of Maculinea in Bulgaria 

basic research to be done on eastern-European Maculinea in general (see also Wynhoff 
1 998 and Munguira & Martin 1 999). 

My studies on M. rebeli in Bulgaria revealed the first case of utilization of Gentiana 
asclepiadea, a host plant so far only linked with M. alcon, by a 'dry-habitat' popula- 
tion. This shows the urgent need for more research on the taxonomy of the alcon 
complex as a whole and especially on the eastern European populations, which until 
now have remained virtually unstudied. The population reported here combines alcon- 
like morphology and host plant with clearly rebeli-likt habitat preferences. This is 
perhaps the best demonstration of the frailty of the conventional, western-European 
view on the specific differences between alcon and rebeli. Though based on extensive 
and detailed research this view may be biased since these studies concentrated on 
populations on the extreme distributional margin of both taxa. Cases like this, should 
they prove to be more widespread, can seriously challenge the validity of present species 
delimitations with respect to the populations in the Balkans and perhaps further east. 

M. avion and M. rebeli are found to be of no immediate, and perhaps long-term, 
conservation concern in Bulgaria. These two species thrive in hilly and mountainous 
terrain that is mostly of little value to potentially harmful agricultural or industrial 
development. It can even be said that both have locally benefited from disruptions in 
the forest cover created by animal husbandry and other human activities in formerly 
densely forested regions such as Mt. Rhodopi and Mt. Stara Planina. This situation is 
in stark contrast to that at the western and northern extremes of the ranges of these 
species, where both are considered endangered and many populations have already 
become extinct. 

Bulgarian M. nausithous is an altogether different case. The present main range of 
the species, from France across central Europe to western Siberia, appears to be a relic 
of a once wider distribution as evidenced by widely separated 'islands' at great dis- 
tances from the main present-day range. Such still survive in e.g. Spain, Bulgaria and 
north-eastern Turkey. These 'islands' have as a whole a greater risk of extinction than 
populations in the main range of the species. In addition such peripheral populations 
may differ from 'mainland' nausithous in certain aspects of their biology. Such is the 
case with some Spanish populations which have a different ant host: My. scabrinodis 
instead of My. rubra (Munguira & Martin 1999). In conservation terms such an excep- 
tional adaptation to local conditions means that, should such a population become 
extinct, an eventual re-introduction with stock from the main range would most likely 
be a costly and complete failure. Similar 'abnormalities' might be expected for Bulgar- 
ian nausithous. Moreover, the distribution and habitat preferences of My. rubra in the 
country apparently do not fit those of the butterfly at all: this ant is widespread in 
Bulgarian mountains above 1500 m, but at lower altitude occurs only in 'stream banks 
in strongly shaded woodland' (Atanassov & Dlussky, 1992). It is interesting to note 
that a species closely related to My. scabrinodis, My. bessarabica Nasonov, is found in 
Bulgaria only in the western part, 'especially on Mt. Lyulin', which is a distribution 
pattern unique among Bulgarian Myrmica (Atanassov & Dlussky, 1992). Studies of 
the biology of the Bulgarian populations of nausithous are therefore of utmost impor- 
tance both locally, as these are essential for the creation of an efficient conservation 



Nota lepid. 25 (2/3): 177-190 189 

scheme, as well as on European scale, as they are likely to contribute new data to the 
biology of the species as a whole. 



Acknowledgements 

I thank all those who facilitated my research in various ways. Stoyan Beshkov (National Museum of 
Natural History, Sofia), Ilko Stoytchev (University of Sofia) and Alexander Slivov (Sofia) provided 
locality data and other relevant information. Michaela Yordanova (Sofia University) determined the 
plant samples and shared relevant botanical information. My special thanks go to Nikolay Shtinkov 
(University of Sofia) for his inspiring companionship on many of the field trips that yielded the data 
reported here, and for sharing his locality data on Maculinea. I am much obliged to Prof. Dr. Konrad 
Fiedler (University of Bayreuth) and two anonymous referees for their critical comments and sugges- 
tions regarding the manuscript. 



References 

Abadjiev, S. P. 2001. An Atlas of the distribution of the butterflies in Bulgaria (Lepidoptera: Hesperioidea 

& Papilionoidea). - Pensoft Publishers, Sofia & Moscow, 335 pp. 
Andreev, N., Anchev, M., Kozhukharov, S., Markova, M., Peev, D. & Petrova, A., 1992. Opredelitel na 

visshite rasteniya v Bulgaria [Identification guide to the higher plants of Bulgaria]. - Nauka i izkustvo, 

Sofia, 788 pp. (in Bulgarian). 
Atanassov, N. & Dlussky, G. M. 1992. Fauna Bulgarica 22. Hymenoptera, Formicidae. - Izdatelstvo na 

BAN, Sofia, 310 pp. (in Bulgarian). 
Bâlint, Z., [1995]. Adalékok a Balkan boglârkalepke-faunâjâhoz (Lepidoptera, Lycaenidae) [Contributions 

to the lycaenid butterfly fauna of the Balkans (Lepidoptera, Lycaenidae)]. - A Janus Pannonius 

Müzeum Évkonyve 39: 69-77 (in Hungarian). 
Berger, L. 1946. Maculinea rebeli Hirschke, bona species. - Lambillionea 46 (6-10): 95-1 10. 
Buresch, I. & Tuleschkow, K. 1930. Horizontalnoto razprostranenie na peperudite (Lepidoptera) v 

Bulgariya [Die horizontale Verbreitung der Schmetterlinge (Lepidoptera) in Bulgarien.] II. - Izvestija 

na Tsarskite Prirodonauchni Instituti v Sofia 3: 145-248 (in Bulgarian). 
Dantchenko, A., Andreev, S., Tchuvilin, A. & Sourakov, A. 1996. Notes on butterfly collecting in a 

natural steppe reserve in Central Russia (Lepidoptera, Rhopalocera). - Atalanta 27: 649-656, colour 

plate XII. 
Drenowski, A. K. 1907. Vtori dopûlnitelen prinos kûm peperudnata fauna na Vitosha i okolnostta i 

[Zweiter ergänzender Beitrag zur Schmetterlings-Fauna des Witoscha-Berges]. - Sbornik za narodni 

umotvoreniya, nauka i knizhnina 22: 1-36 (in Bulgarian). 
Drenowski, A. K. 1930. Spisuk na peperudnite vidove sûbrani po planinata Alibotush (s.-i. Makedoniva) 

[Verzeichnis der auf dem Alibotuschgcbirge gesammelten Lepidopteren (in N. (). Mazedonien)]. 

Izvestija na Bûlgarskoto Entomologichesko Druzhestvo 5: 107 124 (in Bulgarian). 
Elmes, G. W. & Thomas, J. A. 1992. Complexity of species conservation in managed habitats: interaction 

between Maculinea butterflies and their ant hosts. - Biodivers. & Conserv. 1 : 155 169. 
Elmes, G. W., Thomas, J. A., Hammarstedt, O., Munguira, M. L., Martin. M. & van der Made. J. ( i. 1994. 

Differences in host-ant specificity between Spanish. Dutch and Sw edisfa populations of the endangered 

butterfly, Maculinea alcon (Denis et Schilf.) (Lepidoptera). Memorabilia zool. 48: 55 68. 
Elmes, G. W., Thomas, J. A. & Wardlaw, J. C. 1991. Larvae o\' Maculinea rebeli, a large-blue butterfly, 

and their Myrmica host ants: wild adoption and behaviour in ant nests. .1. Zool. (I ondon) 223: 

106-118. 
Elmes, G. W., Thomas, J. A., Munguira, M. L., & Fiedler, K.. 2001. I arvae of lycaenid butterflies that 

parasitise ant colonies provide exceptions to normal insect growth rules. Biol. .1. I. inn. Soe. 73: 

259-278. 
Fiedler, K. 1998. Lycaenid-ant interactions of the Maculinea type: tracing their historical roots in a 

comparative framework. - J. Insect Conserv. 2: 3 14. 
Gadeberg, R. M. E., & Boomsma, .1. J. 1997. Genetic population structure of the large blue butterfly 

Maculinea alcon in Denmark. - ./. Insect Conserv. 1 : 99 111. 



1 QO 

Lyyj Kolev: Species of Maculinea in Bulgaria 

Ganev, J. A. 1985. Red list of Bulgarian butterflies and larger moths. - Entomologist's Gaz. 36: 115-118. 
Garbe, H. 1993. Hinweise zum Schutz des gefährdeten „Dunklen Ameisenbläulings" Maculinea 

nausithous Bergstr. 1779 (Lepidoptera: Lycaenidae). - Nachr. entomol. Ver. Apollo Frankfurt, N.F. 

14: 33-39. 
Garcia-Barros, E., Munguira, M. L., Martin Cano, J., Viejo Montesinos, J. L. 1993. Maculinea nausithous 

(Bergsträsser, 1779) en Madrid. - SHILAP Revta. Lepid. 21: 255-256. 
Gerasimov, I. R & Gulubov, Zh. S. (eds) 1966. Geografiya na Bulgariya. Tom 1: Fizicheska geografiya 

[Geography of Bulgaria. Vol. 1: Physical geography]. - Izdatelstvo na BAN, Sofia, 548 pp., 4 map 

sheets (in Bulgarian). 
Gogov, D. 1963. [Papillons (Lepidoptera) rares et nouveaux pour la faune de Bulgarie]. - Izvestija na 

Zoologicheskija Institut Sofia 14: 237-243 (in Bulgarian). 
Hesselbarth, G, van Oorschot, H. & Wagener, S. 1995. Die Tagfalter der Türkei unter Berücksichtigung 

der angrenzenden Länder. Band 1 : Allgemeiner Teil; Hesperiidae, Papilionidae, Pieridae, Lycaenidae. 

- Selbstverlag Sigbert Wagener, Bocholt, 754 pp. 
IUCN, 2001 . IUCN Red List categories version 3.1. Prepared by the IUCN Species Survival Commission, 

Gland, Switzerland, http://www.iucn.org/themes/ssc/redlists/RLcategories2000.html, 2.12.2001. 
Jaksic, P. 1988. Privremene karte rasprostranjenosti dnevnih leptira Jugoslavije [Provisional distribution 

maps of the butterflies of Yugoslavia] (Lepidoptera, Rhopalocera). - Soc. ent. jugoslavica, editiones 

separatae 1: 1-216 (in Serbo-Croatian). 
Kaaber, S. 1964. Studies on Maculinea alcon (Schiff.) - rebeli (Hir.) (Lep. Lycaenidae) with reference to 

the taxonomy, distribution and phylogeny of the group. - Entomol. Meddelelser 32: 277-319. 
Kolev, Z. 2002. Critical notes on some recent butterfly records (Lepidoptera: Papillionoidea & 

Hesperioidea) from Bulgaria and their source collection- Phegea 30: 95-100 
Kolev, Z. (in press). On the distribution, ecology and conservation status of two little-known Bulgarian 

butterflies: Brenthis ino (Rottemburg, 1775) and Kirinia climene (Esper, [1783]) (Lepidoptera: 

Nymphalidae). - Linneana belg. 
Korshunov, Y. P. & Gorbunov, P. Y. 1995. Dnevnyie babotchki aziatskoy chasti Rossii: Spravotchnik 

[The butterflies of the Asiatic part of Russia: a handbook]. - Izdatel'stvo Ural'skogo universiteta, 

Ekaterinburg, 202 pp. 
Kudrna, O. 1996. Mapping European butterflies: handbook for recorders. - Oedippus 12: 1-60. 
Malicky, H. 1969. Übersicht über Präimaginalstadien, Bionomie und Ökologie der mitteleuropäischen 

Lycaenidae (Lepidoptera). - Mitt.ent.Ges. Basel 19: 25-91. 
Munguira, M. L. 1989. Biologia y biogeografia de los licénidos ibéricos en peligro de extinciön 

(Lepidoptera, Lycaenidae). - PhD thesis, Univ. Autönoma de Madrid. 
Munguira, M. L. & Martin, J. (eds.) 1999. Action plan for Maculinea butterflies in Europe. - Council of 

Europe, Nature and environment, No. 97, 64 pp. 
Pamperis, L. 1997. Butterflies of Greece. - Bastas-Plessas, Athens, 574 pp. 
Thomas, J. A., Clarke, R. T., Elmes, G W. & Hochberg, M. E. 1998. Population dynamics in the genus 

Maculinea (Lepidoptera: Lycaenidae). - In: J. P. Dempster & I. F. G MacLean (eds.): Insect 

populations. Kluwer Academic Publishers, Dordrecht, pp. 261-290. 
Thomas, J. A. & Elmes, G W. 1992. The ecology and conservation of Maculinea butterflies and their 

Ichneumon parasitoids. -In: Pavlicek-van Beek, T., Ovaa, A. H. & van der Made, J. G (eds.). Future 

of butterflies in Europe: strategies for survival. Proceedings of the International Congress 1989, pp. 

116-123. 
Thomas, J. A., Elmes, G W., Wardlaw, J. C. & Woyciechowski, M. 1989. Host specificity among 

Maculinea butterflies in Myrmica ant nests. - Oecologia 79: 452^57. 
Tolman, T & Lewington, R. 1997. Butterflies of Britain and Europe. - Harper Collins Publishers, 320 

pp., 104 pis. 
van der Poorten, D. 1982. Interessante dagvlinderwaarnemingen in Griekenland, juli 1981. - Phegea 10: 

77-87. 
Vihodcevsky, N. & Gogov, D. 1963. [Beitrag zur Schmetterlingsfauna des Vitosa-Gebirges]. - Izvestija 

na Zoologicheskija Institut Sofia 14: 227-235 (in Bulgarian). 
Wynhoff, I. 1998. The recent distribution of the European Maculinea species. - J. Insect Conserv. 2: 15-27. 



Nota lepid. 25 (2/3): 191-204 191 

Opinion 

To agree or not to agree - the question of gender agreement in 
the International Code of Zoological Nomenclature 

Manfred D. Sommerer 

Volpinistr. 72, D-80638 München, Germany; e-mail sommerer.manfred@t-online.de 

Summary. The new (4th) edition of the International Code of Zoological Nomenclature still requires in 
its Articles 31.2 and 34.2 that an adjectival species-group name be in agreement with the gender of the 
name of the genus it is at any time associated with. Prominent and influential publications on the tax- 
onomy of Lepidoptera expressly chose to ignore the gender agreement requirements of the (correspond- 
ing previous) Code, and to use the specific name as given in the original description. For most lepidop- 
terists of our time it is, by lack of knowledge in Latin and Greek, impossible to ascertain unambiguously 
the gender of the generic names in Lepidoptera. Since strict application of the gender agreement provi- 
sions of the Code in the nomenclature of Lepidoptera would, in the course of progress in systematics, 
require continuous changes of epithets of specific names, the task of updating the names in electronic 
databases of large lepidopteran groups is beyond the manpower and financial resources of museums and 
scientific institutions. It is therefore practically not possible to apply those rules of gender agreement. 
Regrettably, the International Commission on Zoological Nomenclature did not accept those arguments 
for the latest version of the Code. The author explains that in lepidopterology there has never been a 
tradition of 'classic purity' as advocated by the Code. Given the priority of the principles of stability and 
permanence of zoological names the author proposes that all lepidopterists follow the example of lead- 
ing authors in taxonomy and disregard the gender agreement requirements of the Code. The leading 
lepidopterists' societies should encourage their members in this respect. The Societas Europaea 
Lepidopterologica (SEL) with about 600 members has, on 4 June, 2002, passed an appropriate resolu- 
tion (which is reproduced in the Appendix). 

Zusammenfassung. Die neue (4.) Fassung der Internationalen Nomenklaturregeln, die zum 1.1.2000 in 
Kraft getreten sind, hält daran fest (Art. 31.2, 34.2), daß ein adjektivischer (Adjektiv oder Partizip im 
Nominativ Singular) Artname immer mit dem grammatikalischen Geschlecht des Gattungsnamens 
übereinstimmen muß, mit dem er jeweils verbunden ist. Eine Reihe namhafter Wissenschaftler und 
Autoren haben bisher die „Übereinstimmung im grammatikalischen Geschlecht" ignoriert und in ihren 
Publikationen den Artnamen in seiner ursprünglichen, in der Urbeschreibung dokumentierten 
(Geschlechts-)Form verwendet. Die Vorschrift ist nämlich schon deshalb für die meisten Lepidopterologen 
in der Praxis kaum vollziehbar, weil sie wegen unzureichender Kenntnisse in Latein oder Griechisch das 
grammatikalische Geschlecht der Gattungsnamen nicht zweifelsfrei feststellen können. Es ist auch 
praktisch unmöglich, weil nicht finanzierbar, die vielen Anpassungen, die sich im Zuge des Fortschritts 
in der Systematik durch neue Gattungskombinationen ergeben müßten, in elektronischen Datenbanken 
für die großen Lepidopteren-Gruppen laufend nachzuvollziehen. Einen solchen Tribut an die Idee der 
„Korrektheit" in der lateinischen Sprache kann sich eine moderne Taxonomie nicht leisten. 
Bedauerlicherweise hat sich die Internationale Nomenklaturkommission im Vorfeld der Neufassung der 
Regeln diesen Argumenten verschlossen. Der Autor legt dar, daß es in der Lepidopterologie auch gar 
keine Tradition für die von den Nomenklaturregeln verlangte grammatikalische ..Reinheit" gibt. Im 
Interesse des Leitprinzips der Namensstabilität und -kontinuität wird daher vorgeschlagen, class alle 
Lepidopterologen nach dem Beispiel anerkannter Kataloge. Faunenlisten und systematischer 
Darstellungen davon absehen sollten, diesen Regeln zur „Übereinstimmung im grammatikalischen 
Geschlecht" zu folgen. Vielmehr sollten die Artnamen in ihrer ursprünglichen (Geschlechts-)Form 
verwendet werden. Hierzu sollten die großen lepidopterologischen Vereinigungen ihre Mitglieder aufrufen. 
Die 600 Mitglieder starke Societas Europaea Lepidopterologica (SI 1.) hat am 4. Juni 2002 bereits eine 
entsprechende (im Anhang wiedergegebene) Resolution verabschiedet. 

Résumé. La nouvelle (4ème) édition du Code International de la Nomenclature Zoologique nécessite. 
dans les articles 31.2, 34.2, qu'un adjectif utilisé comme nom pour un groupe d'espèces s'accorde a\ ce- 
lé genre qui lui est associé. D'importantes publications sur la taxinomie des Lépidoptères choisissent 
expressément de négliger les recommandations du Code pour les genres et d'utiliser les noms spécifiques 
tels que rédigés dans les descriptions originales. A cause d'une manque de connaissances en langues 
classiques (Latin et Grec), il est impossible pour la plupart des Lépidoptéristes de notre époque de 

i Nota lepidopterologica. 15.1 1.2002. ISSN 0342-7536 



I Q9 

1 '^ Sommerer: T he question ot gender agreement in the ICZN 

s'assurer, sans ambiguïté, du genre correct des noms génériques des Lépidoptères. Comme l'application 
des règles du Code sur l'accord de genre dans la nomenclature doit, à la suite du progrès systématique, 
résulter des changements continus des épithètes des noms spécifiques, la tâche de trouver les noms 
"corrects" et de mettre à jour les noms d'espèces dans les banques de données conduira à une énorme 
perte de temps pour le taxinomiste ainsi que de ressources budgétaires des institutions scientifiques 
concernées. Il est donc pratiquement impossible d'observer les recommandations du Code sur l'accord 
de genre. Il est regrettable que la Commission Internationale à la Nomenclature Zoologique n'accepte 
pas ces arguments dans la dernière édition du Code. La grande majorité des noms génériques des 
Lépidoptères étant des termes latinisés plutôt que des noms à signification dans la langue latine, l'auteur 
explique qu'il n'y a jamais eu une tradition de "pureté linguistique" dans la nomenclature des Lépidoptères 
comme le soutient le Code. Vu que les règles de la nomenclature zoologique visent à la stabilité et 
permanence des noms, l'auteur propose aux Lépidoptéristes de suivre en général l'exemple de nombreux 
auteurs de haute réputation qui ont ignoré les dits articles du Code. L'auteur fait appel aux grandes 
sociétés lépidoptérologiques pour encourager leurs membres dans ce sens. La Société Européenne de 
Lépidoptérologie (SEL) vient d'adopter, le 4 juin 2002, lors de son Assemblée Générale, une telle 
Résolution (voir Annexe). 

Key words: nomenclature, stability, gender agreement, generic combinations of species names, elec- 
tronic databases. 



Nomina enim si pereunt périt et rerum cognitio 
[When the names go the perception of the things goes as well] 

Linnaeus 



The burden of nomenclature on systematic research 

Taxonomy and systematics are currently poorly supported as academic subjects in 
scientific research because, among other reasons, they tend to be deemed of low im- 
pact and are thus sparsely funded (Godfray 2002). In Germany, the need for more and 
better research in systematic biology was recognized decades ago by the German Sci- 
ence Foundation (DFG: Kraus 1982) but not much action was initiated. In fact, there 
are very few chairs of systematic zoology at German universities and their role is 
considered weak compared with 'modern' molecular and physiological, and even eco- 
logical, research projects. Permanent scientific staff at the natural history museums in 
Germany are rather 'rare birds' and in most cases also largely immersed in curatorial 
tasks. Following the Rio Conference of 1992 a number of projects involving matters of 
systematic zoology were commenced, some of them are funded by the European Com- 
mission. The focus is mainly on inventorying and databasing the information on zoo- 
logical diversity already to hand in collections. A major resurgence in comprehensive, 
broad, and fundamental research in systematic zoology cannot be expected from those 
projects, and was not intended. 

In the United Kingdom, too, the decline of systematic research was recently de- 
plored, and the question was raised, among others by the President of the Linnean 
Society, as to why taxonomy is currently so unattractive to funding bodies (Smith 
2001; Godfray 2002). It was felt that classifying and cataloguing species to produce 
mere lists of names is unexciting and that resolving complex synonymies (historical 
confusion in nomenclature) that have accumulated as the legacy of the 19th century is 
the sort of time-consuming, unspectacular revisionary work which can hardly win in 
the race for serious funding. It was argued that systematic research needs radical ac- 



Nota lepid. 25 (2/3): 191-204 193 

tion and should reinvent itself as a 21st century information science. A tremendous 
obstacle to that, however, was seen to be this very burden of nomenclatural problems 
which often wastes a large part of the life of a working taxonomist (Godfray 2002). 

The concept of an official, central register of the names of organisms could offer an 
attractive way to improve or secure nomenclatural stability. But, while that concept 
has become working reality in microbiology, and is under way in botany, zoologists 
have so far chosen, for various reasons, not to pursue registration in any form (Howcroft 
& Thorne 1999). The nomenclatural problem is exacerbated by the fact that species- 
rich groups of animals like insects have, in many orders, e. g. Lepidoptera, seen over 
recent decades a remarkable increase in species numbers and new names; this problem 
will continue. Therefore they have been, or will be, faced with fundamental 
reassignments of species amongst genera and genera amongst higher categories as the 
classification is improved. 

Against such a background, the effect on systematic research of established 
nomenclatural rules must be carefully assessed. The changing of names for the mere 
sake of gender agreement might thus appear 'at the same time childish and obnoxious 
to science' (Guenée 1857[1858]). The purpose of the nomenclatural rules would be 
badly served if taxonomists, in order to avoid the disruption of such changes, turned to 
the use of 'numeric' names as was recently proposed (cf. Sommerer 1999). 



The gender trap 

The much debated gender agreement between an adjectival species-group name and 
the grammatical gender of the pertinent genus-group name has persisted through the 
current 4th edition of the International Code of Zoological Nomenclature (ICZN 1999) 
which came into force on 1 January 2000 (=Code hereafter). The actual rule (Articles 
31.2, 34.2) states that 

a species-group name in the form of an adjective or participle in the nominative 
singular must agree with the gender of the generic name, and 
the epithet has to be changed according to any new combination with another 
generic name. 

The application ofthat rule produces a twofold effect: (a) any new adjectival spe- 
cies-group name shall reflect the gender of the generic name it is associated with in the 
original description, and (b) the established species names must in the scientific litera- 
ture be changed in gender to reflect any subsequent combination with a genus other 
than that of the original description. 

In practice in Lepidoptera, however, taxonomists have met with the difficulties of 
the 'niceties' (Holloway 1 993[ 1 994]) of ancient Greek and Latin when trying to find 
out the right grammatical gender of a genus-group name and to decide whether a given 
species-group name is adjectival and therefore liable for gender agreement, or a noun 
in apposition, and therefore immutable. The various worked examples provided in the 
Code (cf. Artt. 30, 31.2, 34.2.1) sufficiently illustrate that difficulty as does the fact 



1 -^ Sommerer: The question of gender agreement in the ICZN 

that the Commission itself had to rely on 'advice on Latin and Greek gender' from a 
university Senior Lecturer in Classics (ICZN 1999: Preface to the Fourth Edition). 

Moreover, the rule is not helpful when applying modern electronic tools in tax- 
onomy and systematic zoology. An entry in a database should remain unmodified as 
long as possible so that easy retrieval and exchange with other systems are safeguarded. 
Any modification of an entry needs human resources and is therefore liable to human 
error. Certainly, software exists that can trace a name regardless of its ending, but a 
database program cannot differentiate names that are nouns in apposition from adjec- 
tives and the database will not furnish 'correct' names as envisaged by the Code unless 
every relevant entry has been changed to the epithet required by the rule of gender 
agreement. Advances in the higher classification will dictate that continuous, costly 
updates are inevitable. 

'Gender agreement' of the Code has been widely ignored in major systematic lists 
and works on the Lepidoptera (cf. Scoble 1999, with further references; Holloway 
2001, 1993 [1994];Karsholt&Razowski 1996; Nielsens al 1996; Poole 1989) if not 
exactly qualified as 'nonsense' (Robinson 1993). The modern practice is to treat the 
generic name as genderless and to retain the original orthography of the specific name 
(Emmet 1991). Thus, many species names are in use in the spelling of the original 
description regardless of the actual generic combination, and since modern taxono- 
mists with 'small Latin and Greek' seem unable to operate the gender agreement rule 
(cf. Emmet 1991), a multitude of 'incorrect' new species names have been entered in 
the Zoological Record through the years. 

But conversely there are also numerous publications testifying to their authors' 
eagerness to comply fully with the Code. Some of such well intentioned attempts failed, 
however, through incorrect latinisation or the doubtful or arguable interpretation of the 
gender of the generic name (Scoble 1999). It is a misfortune that large and very impor- 
tant projects with public funding, such as the current EU-funded Fauna of Europe 
Project (the Lepidoptera work group is headed by O. Karsholt and E. van Nieukerken 
- section moths, - and W. De Prins - section butterflies), formally prescribe full com- 
pliance with all rules of the Code. That again will force taxonomists involved in the 
project to 'delve into the 19th century literature' and to elucidate generic genders, an 
expenditure of time that might be seen as 'simply not good value for money' (Godfray 
2002). 

Hence, there is much confusion about the 'correct' names of species. The scope for 
error (Robinson 1993) persists. If 'stability and universality' of zoological names has 
been the prime purpose of the nomenclatural rules (ICZN 1999: Introduction), the 
latest version of the Code, it seems, has failed to release taxonomists from unnecessary 
nomenclatural problems that are felt to contribute to the crisis in systematic biology. 

Roots evaluated 

As early as 1905 the International Rules of Zoological Nomenclature contained the 
provision that adjectival specific names must agree grammatically with the generic 
name (Art. 14 a). But the gender agreement rule sat on even older shoulders and was 



Nota lepid. 25 (2/3): 191-204 195 

also embedded in a framework of other philological conditions. The Strickland Report 
(the complete title is Series of Propositions for Rendering the Nomenclature of Zool- 
ogy Uniform and Permanent) of 1 842, by the British Association for the Advancement 
of Science, had found that 'by adhering to sound principles of philology, we may avoid 
errors in future, even when it is too late to remedy the past, and the language of science 
will thus eventually assume an aspect of more classic purity than it now presents'. It 
emanates from the spirit in the middle of the 1 9th century that the lingua franca of 
science was felt obliged to reflect the 'Augustan age of Latin' (Strickland 1842). The 
International Rules of 1905 had consequently recommended that 'the best specific 
name is a Latin adjective, short, euphonic, and of easy pronunciation. Latinised Greek 
words or barbarous words may, however, be used.' It had also been recommended that 
'in subdividing an old genus in future, the names given to the subdivisions should 
agree in gender with that of the original group' (Strickland 1842: Recommendations § 
F). The author of a new generic name was, and by the way still is (ICZN 1999: Recom- 
mendations 30A & 30B; Appendix E no. 16), supposed to explain the derivation of the 
name and state its grammatical gender, a rule honoured more often in the breach. 

Obviously, the application of the gender agreement rule would have posed signifi- 
cantly fewer problems had such recommendations been followed ever since. Instead, 
under the influence of dwindling knowledge of the classic languages, it was later found 
that the rule of grammatical agreement of 1905 gave birth to more and more 'impossi- 
ble' names and became an annoying source of uncertainty and error (Richter 1948). If 
the multitude of 'very bad taste' genus-group names, together with the reduced number 
of taxonomists 'who are conversant with the spirit of the Latin language' was deplored 
more than a century ago (Strickland 1 842), the situation had certainly not improved 
when the new Code of 1961 was published. This made gender agreement obligatory 
for all past and new species names, whether in their original or in any subsequent 
generic combination. Although 'examples' were added to help identify the generic 
gender, philological perfection had by that time become Utopia. 

The practical problems connected with gender agreement did, of course, not re- 
main unnoticed. There were proposals like the 'simple' solution that the name of a 
species (not agreeing with the gender of the generic name) be 'completed' by the im- 
aginary insertion of the Latin word 'species' after the generic name so that constant 
feminism of all adjectival species names would be the result (Richter 1948: 1 14). But 
such proposals were never seriously taken up by the Commission. In 1995, the 'Dis- 
cussion Draft' of the Editorial Committee of the proposed fourth edition of the Code 
proposed that the original spelling of an adjectival species-group epithet first pub- 
lished after 1996 should be accepted as correct regardless of disagreement in gender in 
the original combination, and that generic names after 1996 should be treated as words 
having no gender and therefore not affecting the spelling of adjectival specific epi- 
thets. That solution was 'abandoned' because it was 'not acceptable to a sufficiently 
wide consensus of zoologists' (ICZN 1999: Preface). The objections were based on the 
argument that genera would then contain species names with various epithets and that 
it would never be clear whether or not a cited binomen had been 'corrected* so that 
users ofthat name would have repeatedly to check the original spelling and were thus 



196 



Sommerer: The question of gender agreement in the ICZN 



confronted with the difficulties of tracing old or scarce literature. Such argumentation 
sounds half-hearted and is not convincing. The reason why so many participants in the 
discussion of the then proposed text of the 4th edition would not accept any practical 
solution to get around the strict gender agreement principle must be rooted deeper. 

The rule of gender agreement has certainly nothing to do with the fact that the 
working language of the acting International Commission on Zoological Nomencla- 
ture is now English. English adjectives are not varied according to the gender of the 
noun. The contrary is, however, true for most languages on the European continent, 
and is especially the case in the Latin language which was used for zoological nomen- 
clature and had for centuries - until the second half of the 19th century - served as the 
language of science in Europe. To know and observe the rules of philology and gram- 
mar of Latin is certainly part of the cultural tradition of Europe. It seems well founded 
that no taxonomist familiar with classic Latin from his days at school could happily 
accept a Felis marmoratm once systematic meanderings had shifted that species from 
an original male genus to its combination with Felis. Likewise, an adjectival species 
name associated with the genus Papilio could only be tolerated with a masculine epi- 
thet. Such philological, cultural roots of European zoology certainly deserve respect. 

But would a Sarcinodes punctata have a strong case in this respect? The answer is 
rather not, as is shown by the fact that exactly that combination of a feminine adjecti- 
val ending with a male generic noun (according to the Code for genera ending in - 
odes; cf. Examples to Art. 30 a ii in the 3 rd Edition) was chosen by Warren in 1894. 
Warren was following the tradition of Guenée (1857 [1858]), who erected many 
geometrid genera ending in -odes and described numerous species in them with femi- 
nine endings. 

Many authors of lepidopteran descriptions after Linnaeus did not bother much with 
grammatical gender agreement in the sense of the present Code although many 19th 
century lepidopterists were more at home with Latin (and Greek) than most of their 
modern colleagues, especially if they were trained as medical doctors (like Linnaeus, 
Boisduval, Herrich- S chaffer, Rambur), lawyers (like Guenée), or theologians (like 
Schrank) (cf. Herbulot 1983). The Genera and Index Methodicus Europaeorum 
Lepidopterorum by Boisduval (1840) was written in Latin but the species in Elophos 
and Gnophos were listed with their original feminine epithet. Walker's 35-volume List 
of the specimens of lepidopterous insects in the collection of the British Museum con- 
tains numerous bilingual, i.e. Latin and English, descriptions of new species. Never- 
theless the nomenclatural result in very many cases was such that the Commission 
would now have to deplore it as 'regrettable in itself and an unfortunate example to 
others'. Obviously, in the aftermath of the classification of Linnaeus and his contem- 
poraries, the generic names were understood to have general grouping prefixes like the 
Linnaean Phalaena {Bombyx, Sphinx, Noctua, Geometra, Pyralis, Tortrix, Tinea, 
Alucitd) which would then induce feminine species names, or Papilio leading towards 
masculine species names (although most specific names of the Rhopalocera were in 
fact nouns in apposition), regardless of the gender of the real genus name. (Some 
lepidopterists like Emmet 1991, much regretted that this simple and workable pattern 
- butterfly species male and moths female - bequeathed by Linnaeus 'had been torn 



Nota lepid. 25 (2/3): 191-204 197 

into shreds'.) Linnaean species names in some groups are characterized by uniform 
endings such as -ana (Tortrix), -alls (Pyralis), -ella {Tinea), -dactyla (Alucita). In the 
geometrids the distinction between species with pectinated (pectinicornes) and those 
with filiform (seticornes) antennae resulted in the name pattern with the endings -aria 
or -ata respectively. 'Hardly a name has been bestowed since [1758] that is not mod- 
elled on one that is found in Systema Naturae, Edition 10' (Emmet 1991: 20). Tradi- 
tion and culture of lepidopterological nomenclature hence cannot be reduced to mere 
philological purity. The Code's 4th edition claims to mark the 242 nd anniversary of the 
formal starting point of zoological nomenclature, the publication of Linnaeus' Systema 
Naturae Ed. 10 (ICZN 1999: Preface); but the Code adopts philological ideals that are 
not found in the taxonomy of Linnaeus and subsequent systematists. 

While Felis or Papilio were common words of the vocabulary of ancient Rome, 
creations like Sarcinodes and many other artificial latinisations used as generic names 
of Lepidoptera would not have had any meaning in the Roman empire. Cultural tradi- 
tions of philological correctness have no relevance here. If the gender of such artifacts 
or meaningless neologisms can only be determined by specialized linguists trained in 
the etymology of Indo-Germanic words and by means of deduction, extrapolation or 
postulation, it is indefensible that 21st century lepidopterists be burdened with such 
virtual linguistic 'correctness'. Why should taxonomists today be forced, in the name 
of the rules existing in classic Latin, to 'correct' real or imaginary misdemeanors com- 
mitted more than a century ago? Moreover, 'classic purity' as advocated by the Code 
was never deeply rooted in the tradition of lepidopterological science. 

Meanwhile, the task of recording biodiversity has largely shifted beyond the realm 
of the tradition of the Latin language and involves taxonomists with other cultural 
backgrounds. Of course, there have been great zoologists outside Europe with an out- 
standing proficiency in classic languages but that may not reflect the situation in the 
years to come, even less so since such philological abilities tend to become more and 
more isolated if not obsolete among academics in Europe as well. The Gennan press 
reported recently (in early 2002) that a lapsus linguae occurred even to the Holy Fa- 
ther when John Paul II referred to the paupera lingua latina. (There is a dispute among 
philologists about that 'fault'.) In 1895 no one could have foreseen that most users of 
scientific names would have no knowledge of Latin or Greek (Melville 1995: Conclu- 
sion), but in 2002 it is a fact. 'Classic purity' in a system of zoological names, if ever 
sought for, is not a feature of relevant cultural impact any more. The rigid formula of 
gender agreement in the Code must then appear as the anachronism that it was termed 
decades ago (Holloway 1981; Robinson, 1993). 

After all, scientific correctness rather depends upon historical truth. There was no 
Gnophos accipitrarius. by Guenée but accipitraria, no Gnophos ambiguatus described 
by Duponchel but amkiguata, but there is now Gnophos porphyratus. Zerny. 

There may not be a copyright in scientific species names; but there are the author's 
motives, ideas, intentions, mostly unknown to us today, underlying his choice of a 
name for a new species. Respect for the personalities contributing to the nomenclatural 
web, or at least the good taste which was so often claimed by the early drafters of the 
nomenclatural rules, should prevent the pioneers of the nomenclature of Lepidoptera 



198 



Sommerer: The question of gender agreement in the ICZN 



to be deprived of their species names as they had spelled them out. Guenée (1857 
[1858]) once put the question whether there is permission to attack the genius of 
Linnaeus and touch on the names in Systema Naturae, and he cites the fact that even 
Voltaire was blamed for his correcting obvious faults committed by the Great Corneille. 
To give names to a thing always had a special character. 'Nominum ideoque impositio 
primi hominis in aurea aetate actio eraf [naming was the first man's action in the 
golden age], as Linnaeus {Systema Naturae, ed. 10) put it. In a time of endangered 
species and burning primary forests the naming of species may well appear as a treas- 
ure of the golden age which should be cherished. 'Whatever the man called each living 
creature, that was its name' (Genesis 2: 19-20). 



Waiting for adoption 

While the confusion stemming from the impracticality of the gender agreement rules 
was much regretted, no way was found to surmount the seemingly broad resistance to 
them. Some minor changes in the text of the Code, intended to simplify the identifica- 
tion of gender in genus-group names, merely nourish the Commission's 'hope' that 
they will reduce some of the difficulties of those without knowledge of Latin (ICZN 
1999: Introduction). More vigorous attempts to end debates about the correctness of 
names were proposed in the discussions leading to the 4th edition of the Code. To 
secure conformity with the articles of the Code in future, a system of authorisation or 
mandatory registration of names was suggested. Practical difficulties as well as the 
principle of taxonomic freedom were felt to stand against that (ICZN 1999: Preface). 
In fact, lack of resources would preclude any system of formal acts involving the 
Commission. The vision of an authority with the ability to check, within a reasonable 
time, whether a new species name or a species name in a new combination meets the 
gender agreement requirements and/or other provisions of the Code would, indeed, be 
utterly unrealistic (cf. Bouchet 1999). 

. The Code envisages, however, a potential remedy through the official adoption of 
Lists of Available Names in Zoology (Art. 79): A name occurring in an adopted part of 
the List is deemed to have the spelling recorded in the List despite any evidence to the 
contrary (Art. 79.4.1). Once such Lists have been compiled, there will obviously be 
peace with the gender agreement rule and any doubts about the correct species-group 
name will be settled - for the given combination with a generic name! If the species is 
later transferred to another genus with different gender the Code apparently still re- 
quires the specific adjectival name to be adjusted (cf. Art. 80.6.2). The adoption of an 
official list of available names was seemingly not meant to fix the epithet once and for 
ever. Otherwise, specific names with different epithets could assemble in a genus as 
systematic research progresses, a result that has always horrified the drafters of the 
Code. 

The protocols for an adoption system are likely to be complicated and slow (Artt. 
79.1, 79.2). But the main issue is breaking down the immense numbers of generic and 
specific names into adoptable comprehensive lists of genera and/or species which re- 
quire the attention of specialists to an extent that is difficult to imagine as realistic 



Nota lepid. 25 (2/3): 191-204 199 

within a reasonable span of years. A general inventory of the existing species in the 
Lepidoptera alone can be estimated to comprise some 160,000 (valid) names. So, even 
if that option is viable in the long term, it cannot offer a handy solution for the taxono- 
mist working today. 

The option now 

The Code is a set of rules under the aegis (now) of the International Union of Biologi- 
cal Sciences. The articles of the Code are not enforceable under International Law and 
the provisions of the Code are not enforceable against any taxonomist or author. There 
is no court to hear arguments whilst the Commission itself explicitly states that it is 
under no obligation to search out violations of the Code or to initiate any action within 
its field of competence (Art. 83). But the Code claims that zoological names published 
after 1757 are governed by the provisions of the Code (Art. 88) and that its articles are 
mandatory to zoologists when determining the valid name for a taxon or establishing a 
new name. The Code also provides for its own interpretation and administration (ICZN 
1999: Introduction). Whatever its juridical character, the Code was meant to regulate 
zoological nomenclature, and it can still be dealt with in the same way as other obliga- 
tions of law are treated. 

As pointed out, taxonomists have tended to choose a pragmatic formula that disre- 
gards gender agreement. Such procedure clearly contravenes the wording of Artt. 3 1 .2, 
34.2 of the Code. But the verdict is not so clear-cut. 

(a) In the first place, the strict gender agreement provisions of the Code, although in 
their essential content upheld over a century, were, due to the negative effects men- 
tioned above, not at all supported by consent of the majority of the addressees, at least 
in the taxonomy of Lepidoptera. They may thus be deemed derogated by the inten- 
tional and continuous custom of contravention. 

(b) Another strong argument was, in a way, acknowledged by the Commission it- 
self (ICZN 1999: Introduction): the paucity of knowledge of Latin. The knowledge of 
classic Greek is evidently no longer even worth mentioning because it is virtually non- 
existent among the younger zoologists of our days. For example, even the editor of the 
series The Generic Names of Moths of the World, who served himself on the ICZN, did 
not state the genders of the genera listed, an omission that could be inteipreted as being 
a tacit admission that the gender agreement article of the Code is unworkable (Holloway 
1981). If modern taxonomists are unable to find the philologically correct answers as 
to the gender of all generic names and to the linguistic qualification of certain specific 
names then they are not able to apply the gender agreement rule correctly, and cer- 
tainly not within a reasonable time and without unreasonable effort. It has been a 
principle since Roman Law that ultra posse nemo obligetur, i.e. a law cannot oblige 
adherence to something impossible. 

Full application of the rule that adjectival species names must at any time reflect 
the gender of the generic name would demand updating of the species name in elec- 
tronic databases whenever required by a new combination. Institutions maintaining 
databases of large animal groups like Lepidoptera would have to invest much man- 



^UU Sommerer: The question of gender agreement in the ICZN 

power to follow the systematic alterations. A survey of the moths of Borneo recently 
found that about 50% of the macromoths may be in unsatisfactory generic combina- 
tions (Holloway 2002). Obviously, the budgets of museums and other scientific insti- 
tutions cannot match the need for additional staff. It is thus also financially impossible 
to observe the gender agreement rule in the modern electronic tools of taxonomy and 
systematics. 

This twofold impossibility of observing the gender agreement requirements (Artt. 
31.2, 34.2) renders those provisions of the Code void. 

(c) Such understanding of the gender agreement rules of the Code is uniquely con- 
sistent with the foremost principles of stability and permanence of zoological names, 
principles that have predominance over mere rules: 'The objects of the Code are to 
promote stability and universality in the scientific names of animals and to ensure that 
the name of each taxon is unique and distinct. All its provisions and recommendations 
are subservient to those ends and none restricts the freedom of taxonomic thought or 
actions.' (ICZN 1999: Preamble). The Preamble declares itself an 'integral part of the 
Code's provisions'. 

As pointed out, in large animal groups like Lepidoptera, systematic research is 
continuously yielding reallocations of species to existing or new genera. Consequently, 
an adjectival species name might possibly within a few years require different endings 
and would thus, in contrast to the stated objectives of the Code, not remain stable and 
permanent, and miss the single best quality of a scientific name (Minelli 1999). 

(d) The contradiction between the wording of Artt. 31.2, 34.2 and the declared 
objects of the Code leaves a gap that can best be bridged by adopting the interpretation 
offered by the Code, albeit with some restrictions, in Artt. 31.2.2 and 34.2.1: Species 
names in the form of an adjective or participle in the nominative singular may be 
understood as nouns in apposition and hence remain unchanged iri whichever combi- 
nation with a generic name. Regrettably, the Code and the Commission did not dare to 
open that door explicitly, but the restrictions to such a general application indicated in 
the Code (Art. 3 1 .2.2) seem to be of little relevance in Lepidoptera and can be deemed 
overruled by the overriding principle of stability. 



Quae sit actio - what to do? 

Summing up, the conclusion is that, for the sake of stability and in order to avoid 
confusion in the nomenclature of Lepidoptera, something has to be done. The gender 
agreement provisions of the Code (Artt. 31.2, 34.2) must not be allowed to interfere 
with the mainstream attitude of taxonomists in Lepidoptera which is that the species 
name be preserved in its original form, regardless of any genus with which it may later 
be combined. That result can be achieved if species-group names originally estab- 
lished in the form of an adjective or participle in the nominative singular are generally 
treated as nouns in apposition (Artt. 31.2.2, 34.2.1). 

Since neither the (new) Code nor the Commission have so far offered a remedy for 
the worrying situation, it is highly desirable for all working lepidopterists to have clear 
and simple guidelines. In this direction, action could be taken by the leading lepidop- 



Nota lepid. 25 (2/3): 191-204 20 1 

terists' societies as a service to their members engaged in taxonomy and systematics of 
Lepidoptera. For instance, members could be encouraged to adopt generally the preva- 
lent tradition of disregarding the gender agreement requirement of the Code for the 
sake of stability. Additionally the societies could urge, and hopefully convince, the 
Commission to cooperate in finding a formal way to achieve that goal. 

The Societas Europaea Lepidopterologica (SEL), a society of about 600 lepidopter- 
ists of (mainly) the Northern Hemisphere, passed a Resolution in this respect at its 
General Meeting at the XIII European Congress of Lepidopterology in June 2002 (see 
Appendix). Vivant s equentes [followers welcome]! 



References 

Boisduval, J. A. 1840. Genera et Index Methodicus Europaeorum Lepidopterorum. - Paris. 238 pp. 
Bouchet, P. 1999. Recording and registration of new scientific names: a simulation of the mechanism 

proposed (but not applied) for the International Code of Zoological Nomenclature. - 

Bull.zool.Nomencl. 56: 6-15. 
Emmet, A. M. 1991. The scientific names of the British Lepidoptera - their history and meaning. - 

Harley Books, Colchester. 288 pp. 
Godfray, H. Ch. J. 2002. How might more systematics be funded? - Antenna 26: 1 1-17. 
Guenée,A. 1857 [1858]. Uranides et Phalénites. - Pp. ix-xxxvii. -In: Boisduval, J. B. A. d'E. & Guenee, 

A. (eds.), Histoire naturelle des insectes. Species général des Lépidoptères, vol. 9. Généralités. 
Herbulot, C. 1983. Cinq grands Lépidoptéristes français du siècle dernier. - Bull. Soc. ent.Fr. 88: 154-157. 
Holloway, J. D. 1981. Book review: Fletcher, D. S. (1979). Geometroidea. -In: Nye, I. W. B. (ed.), The 

generic names of moths of the world 3. - J.nat.Hist. 15: 539. 
Holloway, J. D. 1993 [1994]. The moths of Borneo. Part 1 1 (Geometridae, Ennominae). - Mal.Nat.J. 47: 

1-309, 593 figs., 19 col. pis. 
Holloway, J. D. 2001. The moths of Borneo. Part 7 (Arctiidae, Lithosiinae). - Mal.Nat.J. 55: 279-486, 

461 figs., 8 col. pis. 
Holloway, J. D. 2002. Checklists of tropical faunas: not the destination, just landmarks when travelling 

hopefully. - Oral presentation at the XHIth European Congress of Lepidopterology of SEL, Korsor, 

Denmark, June 1-6, 2002. 
Howcroft, J. & Thorne, J. 1999. Centralized access to newly published zoological names. - Bull. zool. 

Nomencl. 56: 108-112. 
ICZN (International Commission on Zoological Nomenclature) 1999. International Code of Zoological 

Nomenclature. 4th edition. - The International Trust for Zoological Nomenclature, London, xxx + 

306 pp. 
Karsholt, O. & Razowski, J. (eds.) 1996. The Lepidoptera of Europe. A distributional checklist. -Apollo 

Books, Stenstrup. 380 pp. 
Kraus, O. (ed.) 1982. Biologische Systematik. Denkschrift im Auftrag der Deutschen Forschungs- 
gemeinschaft unter Berücksichtigung der Ergebnisse des DFG-Rundgesprächs sowie des ESRC- 

Interim-Report, Taxonomy in Europe'. - Verlag Chemie, Weinheim. 58 pp. 
Linnaeus, C. 1758. Systema Naturae per régna tria naturae, secundum classes, ordines, genera, species, 

cum characteribus, differentiis, synonymis, locis. Tomus I. Editio décima, reformata. Holmiae, 

Impensis direct. Laurentii Salvii. 824 pp. 
Melville, R. V. 1995. Towards stability in the names of animals. A history of the International Commission 

on Zoological Nomenclature 1895 1995. Intern. Trust for Zool. Nomenclature, London. 
Minelli, A. 1999. The names of animals. - Trends ecol.Evol. 14: 462-463. 
Nielsen, E. S., Edwards, E. D. & Rangsi, T. V. (1996). Checklist of the lepidoptera of Australia. 

Monographs of Australian Lepidoptera 4, xiv + 529 pp. CSIRO, Collingvvood (Australia). 
Poole, R. W. 1989. Noctuidae. Lepidopterorum Catalogus (New Series), Fasc. 1 18, 3 parts. - E. J. Brill 

Flora & Fauna Publications, Gainesville, Florida. 1314 pp. 



^"^ Sommerer: The question of gender agreement in the ICZN 

Richter, R. 1948. Einführung in die Zoologische Nomenklatur durch Erläuterung der Internationalen 

Regeln. - Senckenbergische Naturforschende Gesellschaft, Frankfurt a. M. 
Robinson, G. S. 1993. Book review of Heppner, J. B. & Inoue, H. (eds.), Lepidoptera of Taiwan. - 

Antenna 17: 148-149. 
Scoble, M. J. (ed.) 1999. Geometrid moths of the world. A catalogue. 2 vols. -Apollo Books, Stenstrup. 

1016 pp. 
Smith, D. 2001. A possible solution to the plight of systematic biology and the study of whole organisms. 

-Antenna 25: 269-272. 
Sommerer, M. 1999. Nummernentomologie? [Remarks on] Reinhardt, R., Friedemann, P. & Eitschberger, 

U. (eds.): Fragmentarisches Verzeichnis der Schmetterlinge Europas und angrenzender Regionen 

mit einem vorläufigen Vorschlag zur Festlegung von Identifikationsnummern. - Mitt.münch.ent.Ges. 

89: 118. 
Strickland, H. E. 1 842. Series of propositions for rendering the nomenclature of zoology uniform and 

permanent. - British Association for the Advancement of Science. Report on Zoological Nomenclature 

1842: Minute of the Committee of the Section of Zoology and Botany, June 29, 1842. 
Walker, F. 1854-1866. List of the specimens of Lepidopterous insects in the collection of the British 

Museum. 35 vols. London. 



Appendix 

RESOLUTION 

adopted by the General Meeting of the Societas Europaea Lepidopterologica 
(SEL) at the XIII European Congress of Lepidopterology in Korsor (Denmark) 
on June 4, 2002: 



Lepidopterists are strongly recommended to use species-group names of Lepidoptera 
established in the form of an adjective or participle in the nominative singular only in 
their original (gender) form given in the original description, unless the name was 
fixed otherwise by a subsequent opinion of the International Commission on Zoologi- 
cal Nomenclature. In this respect the gender agreement requirements of Artt. 31.2, 
34.2 of the actual (4th edition) of the Code shall be disregarded, and such species- 
group names of Lepidoptera in the form of an adjective or participle in the nominative 
singular shall generally be treated as nouns in apposition and must in no case be changed 
to agree in gender with whichever generic name they are combined (cf. Artt. 31.2.2, 
34.2.1). 

When naming new species of Lepidoptera, taxonomists shall make sure that the 
form (epithet) of an adjectival species name either matches the obvious gender of the 
genus name (cf. Recommendation 30 A, 3 0B) it shall be combined with or follows the 
example of (the majority of) its congeners. 

The President is empowered to take appropriate action so that the afore men- 
tioned general mode of the application of the gender agreement provisions of the 
Code in the nomenclature of Lepidoptera can be formally accepted by the institu- 
tions concerned. 



Nota lepid. 25 (2/3): 191-204 203 

Anhang 

RESOLUTION 

verabschiedet von der Mitgliederversammlung der Societas Europaea 
Lepidopterologica (SEL) beim XIII. Europäischen Kongress für Lepidopterologie 
in Korsor (Denmark) am 4. Juni 2002: 



Den Lepidopterologen wird dringend empfohlen, Artnamen bei Lepidopteren, die aus 
einem Adjektiv oder Partizip im Nominativ Singular bestehen, nur in der grammatika- 
lischen Form zu verwenden, in der sie ursprünglich beschrieben worden sind, es sei 
denn, daß der Name durch eine spätere Entscheidung der Nomenklaturkommission mit 
anderem grammatikalischem Geschlecht festgeschrieben worden ist. Die Bestimmungen 
zur Übereinstimmung im grammatikalischen Geschlecht (Artikel 3 1 .2, 34.2) der aktuel- 
len (4. Auflage) der internationalen Nomenklaturregeln sollen somit nicht angewandt 
werden. Vielmehr sollen solche Artnamen in Gestalt eines Adjektivs oder Partizips im 
Nominativ Singular wie substantivische Appositionen behandelt werden und bedürfen 
damit nie einer Anpassung an das grammatikalische Geschlecht des Gattungsnamens, 
mit dem der Artname je verbunden sein soll (vgl. Artikel 31.2.2, 34.2.1). 

Wer eine Lepidopteren- Art mit einem neuen, adjektivischen Artnamen benennt, 
soll sicher stellen, daß sich die grammatikalische Endung nach dem offenkundigen 
Geschlecht des Gattungsnamens richtet oder mit den (meisten) anderen Artnamen in 
dieser Gattung übereinstimmt. 

Der Präsident wird gebeten, die erforderlichen Schritte zu unternehmen, damit die 
zuständigen Institutionen diese Handhabung der Nomenklaturregeln für den Bereich 
Lepidoptera akzeptieren. 



Annexe 

RESOLUTION 

adopté par l'Assemblée Générale de la Societas Europaea Lepidopterologica (SEL) 
à l'occasion du XlIIième Congrès de la Lepidopterologie à Korser (Danemark) le 
4 Juin 2002: 



Il est fortement recommandé aux Lépidoptéristes d'utiliser les noms de groupes 
d'espèces de Lépidoptères sous la forme (épithète) établie dans la description originale, 
à moins que ce nom n'ait été fixé autrement par une opinion subséquente de la Com- 
mission Internationale à la Nomenclature Zoologique, et d'ignorer de l'esprit du genre 
recommandé dans les articles 31.2, 34.2 de l'édition actuelle (4ème) du Code. De tels 
groupes de noms d'espèces de Lépidoptères sous forme d'adjectif ou de participe d'un 
nom au singulier doivent être en principe traités comme noms en apposition et ne 
doivent en aucun cas être changés en accord au genre avec lequel le nom de genre est 
accordé (cf. Art. 3 1 .2.2, 34.2. 1 ). 



204 



Sommerer: The question of gender agreement in the ICZN 



Lors de la description de nouvelles espèces de Lépidoptères les taxinomistes doivent 
s'assurer que la forme (épithète) d'un nom d'espèce adjectif s'accorde avec le nom du 
genre associé si le genre en est évident sans aucune ambiguité (cf. recommandations 
30A, 30B), ou suive l'exemple de (la majorité de) ses congénères. 

Le Président de la SEL est mandaté pour entreprendre les actions appropriées en 
vue des modifications proposées en application des recommandations du Code sur les 
genres à propos des Lépidoptères afin qu'elles soient officiellement acceptées par les 
institutions concernées. 



SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e. V. 



Nota lepidopterologica wird den Mitgliedern der SEL zugesandt. Die Mitgliedschaft bei SEL steht 
Einzelpersonen und Vereinen nach Maßgabe der Satzung offen. Der Aufnahmeantrag ist an den Mit- 
gliedersekretär Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgien; e-mail: 
Willy.Deprins@village.uunet.be zu richten. Das Antragsformular ist im Internet auf der Homepage 
der SEL unter http://www.zmuc.dk/EntoWeb/SEL/SEL.htm erhältlich. 

Der Mitgliedsbeitrag ist jährlich am Jahresanfang zu entrichten. Er beträgt für Einzelpersonen € 35,00 
bzw. fur Vereine € 45,00. Die Aufnahmegebühr beträgt € 2,50. Die Zahlung wird auf das SEL-Konto 
1956 50 507 bei der Postbank Köln (BLZ 370 100 50) erbeten. Mitteilungen in Beitragsangeiegenheiten 
sind an den Schatzmeister Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail: 
Sommerer.Manfred@t-online.de zu richten. 

Der Verkauf von Einzelheften und älteren Jahrgängen von Nota lepidopterologica sowie der Verkauf der 
Zeitschrift an Nichtmitglieder erfolgt durch Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Däne- 
mark; e-mail: apollobooks@vip.cybercity.dk. 
Adressenänderungen bitte sofort dem Mitgliedersekretär oder dem Schatzmeister mitteilen! 

Nota lepidopterologica is sent to the members of SEL. The membership is open to individuals and 

associations as provided for by the statutes of SEL. Applications for membership are to be addressed to 

the membership secretary Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgium; e-mail: 

Willy.Deprins@village.uunet.be. The application form will be found on the SEL Homepage http:// 

www.zmuc.dk/EntoWeb/SEL/SEL.htm. 

The annual subscription is to be paid at the beginning of the year. It is € 35.00 for individuals or € 45.00 

for associations. The admission fee is € 2.50. Payments requested to SEL account no. 1956 50 507 at 

Postbank Köln [Cologne] (bank code 370 100 50). In matters concerning the subscription or payments. 

please contact the treasurer Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail: 

Sommerer.Manfred@t-online.de . 

Back numbers of Nota lepidopterologica may be obtained from, and orders of Nota lepidopterologica 

from non-members are serviced by Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Denmark; e- 

mail: apollobooks@vip.cybercity.dk. 

Changes of address should be immediately communicated to the Membership Secretary or the Treasurer. 

Nota lepidopterologica est envoyé aux membres de la SEL. L'affiliation est possible, pour les personnes 
individuelles aussi bien que pour les associations, en accord avec les statuts de la SEL. Les demandes 
d'affiliation doivent être adressées au Secrétaire des Membres Willy O. De Prins, Nieuwe Donk 50. B- 
2100 Antwerpen, Belgique; e-mail: willy.deprins@village.uunet.be. 

Le formulaire d'affiliation est disponible par le biais de la SEL homepage http://www.zmuc.dk/EntoVVeb/ 
SEL/SEL. htm. La contribution annuelle est payable au début de Tannée. Elle est de € 35,00 pour les 
personnes individuelles et de € 45,00 pour les associations. Les frais d'admission s'élèvent à € 2,50. 
Les payements doivent être effectués sur le compte SEL n° 1956 50 507 auprès de la Postbank Köln 
[Cologne] (code bancaire 370 1 00 50). Pour toutes questions en rapport à la souscription ou aux payements, 
veuillez contacter le Trésorier Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail: 
Sommerer.Manfred@t-online.de. Les anciens volumes de Nota lepidopterologica peuvent être obtenus 
et les commandes concernant cette revue de la part de non-membres effectuées auprès de Apollo Books. 
Kirkeby Sand 19, DK-5771 Stenstrup, Danemark; e-mail: apollobooksfr/ \ ip.cybcrcity.dk. 
Tous changements d'adresse doivent être communiqués immédiatement soit auprès du Secrétaire des 
Membres, soit auprès du Trésorier. 



GL/- 



NOTA 
LEPIDOPTEROLOGICA 

A journal devoted to the study of Lepidoptera 

Published by Societas Europaea Lepidopterologica (SEL) 




Vol.25 No. 4 2002 



SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e. V. 



http://www.zmuc.dk/entoweb/sel/sel.htm 



Honorary Members 

Pamela Gilbert (GB), Barry Goater (GB), Prof. Dr. Lâszlô Gozmâny (H), Prof. Dr. 
Vladimir Kuznetzov (RU), Prof. Dr. Clas M. Naumann (D), Dr. P. Sigbert Wagener (D) 



Council 






President: 

Vice-President: 

General Secretary: 

Treasurer: 

Membership Secretary: 

Ordinary Council Members: 

Editor: 
Managing Editor: 



Prof. Dr. Niels P. Kristensen (DK) 

Dr. David Agassiz (UK) 

Dr. Christoph L. Häuser (D) 

Manfred Sommerer (D) 

Willy O. de Prins (B) 

Dr. Bernard Landry (CH), 

Dr. Elisenda Olivella (E), Dr. Laszlö Ronkay (H), 

Dr. Gerhard Tarmann (A), Dr. Alberto Zilli (I) 

Prof. Dr. Konrad Fiedler (D) 

Dr. Matthias Nuß (D) 



Copyright © Societas Europaea Lepidopterologica (SEL) 

ISSN 0342-7536 

Printed by druck-zuck GmbH, Halle/Saale, Germany 

All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or 

mechanical including photocopying, recording or any other information storage and retrieval system, without written 

permission from the publisher. Authors are responsible for the contents of their papers. 




Nota lepidopterologic 

Ajournai devoted to the study of Lepidoptera 
Published by the Societas Europaea Lepidopterologica e. V. 

Volume 25 No. 4 Halle / Saale, 16. 06. 2003 ISSN 0342-7536 

Editorial Board 

Editor. Prof. Dr. Konrad Fiedler, Lehrstuhl fur Tierökologie I, Universität Bayreuth, 

D-95440 Bayreuth, Germany; e-mail: konrad.fiedler@uni-bayreuth.de 
Managing Editor. Dr. Matthias Nuß, Staatliches Museum fur Tierkunde, Königsbrücker Landstr. 159, 

D-01109 Dresden, Germany; e-mail: matthias.nuss@snsd.smwk.sachsen.de 
Assistant Editors: Dr. Enrique Garcia-Barros (Madrid, E), Dr. Roger L. H. Dennis (Wilmslow, UK), 

Dr. Peter Huemer (Innsbruck, A), Ole Karsholt (Kobenhavn, DK), Dr. Yuri P. Nekrutenko (Kiev, UA), 

Dr. Erik J. van Nieukerken (Leiden, NL), Dr. Wolfgang Speidel (Bonn, D.) 



Contents • Inhalt • Sommaire 

Karsholt, O. & Kun, A.: A new species of Ethmia Hübner, 1819 from the Greek 
island of Rhodes (Ethmiidae) 207 

Lvovsky, A. L.: Check-list of the broad-winged moths (Oecophoridae s. I.) 

of Russia and adjacent countries 213 

Elsner, G & Jaros, J.: A new species of Ceratoxanthis Razowski, and 
distribution records for two species of Aethes Billberg from the Balkan 
Peninsula (Tortricidae: Cochylini) 221 

Rougerie, R.: Re-capture of Sinobirma malaisei in China: description of the 
female genitalia and comments on the systematic position of the genus in 
the tribe Urotini (Saturniidae) 227 

Wilcockson, A. & Shreeve, T. G: The subspecific status of Pieris napi (Pieridae) 
within the British Isles 235 

Sielezniew, M., Stankiewicz, A. & Bystrowski, C: First observation of one 

Maculinea arion pupa in a Myrmica lobicornis nest in Poland 249 

Wakeham-Dawson, Parker, R., John, E. & Dhnnis, R. L. H.: Comparison of the 
male genitalia and androconia of Pseudochazara anthelea acamanthis (Rebel, 
1916) from Cyprus, Pseudochazara anthelea anthelea (Hübner, 1924) from 
mainland Turkey and Pseudochazara anthelea amalthea (Frivaldsky, 1845) 
from mainland Greece (Nymphalidae, Satyrinae) 251 



Fiedler, K. & Ruf, C: Araschnia levana larvae (Nymphalidae) do not accept 

Humulus lupulus (Cannabaceae) as food plant 265 

Gorbach, V. V. & Saarinen, K.: The butterfly assemblages of Onega Lake Area 
in Karelia, middle taiga of NW Russia (Hesperioidea, Papilionoidea) 267 

Book reviews 226, 234, 248, 264, 280-283 

Contens of volume 25 285 



Nota lepid. 25 (4), published 2003: 207-212 207 

A new species of Ethmia Hübner, 1819 from the Greek island of 
Rhodes (Ethmiidae) 

Ole Karsholt* & Andràs Kun** 

* Zoological Museum, Universitetsparken 15, DK-2100 Kjabenhavn 0, Denmark; e-mail: 

okarsholt@zmuc.ku.dk 
** Department of Zoology, Hungarian Natural History Museum, H-1088 Budapest, Baross u. 13, 

Hungary; e-mail: kuni@zoo.zoo.nhmus.hu 

Summary. Description of a new species from Greece (Rhodes), Ethmia mariannae sp. n., is given, in 
comparison with its most closely related species, Ethmia iranella Zerny, 1940, and Ethmia treitschkeella 
(Staudinger, 1879). 

Key words. Ethmia, new species, taxonomy, Rhodes, Europe. 



Introduction 

The Ethmiidae is a comparatively small family of rather conspicuous moths, with about 
300 described species in 3-5 genera, which are distributed in all major continents. 
They form a basal clade of the Gelechioidea next to the Stenomatidae, but in spite of 
being rather easily recognizable they are only supported by few synapomorphies 
(Hodges 1999). The group is treated either as a subfamily of the Elachistidae (Minet 
1990; Hodges 1999) or given family status (Sattler 1967; Riedl 1996). Here we follow 
the latter opinion. 

Ethmiids are among the best known gelechioid moths. The Palaearctic fauna was 
monographed by Sattler (1967) who recognized 72 species. He placed all species in 
the genus Ethmia Hübner, 1819, which he divided into 23 species groups. Riedl (1996) 
listed 27 species from Europe. 

The European ethmiid fauna has subsequently been studied by a number of au- 
thors. Taxonomic or faunistic studies of the Ethmiidae were published for the Euro- 
pean part of the former Soviet Union (Zagulajev 1990), Poland (Buszko 1978), north- 
ern Europe (Palm 1989), central Europe (Hannemann 1997), and Great Britain and 
Ireland (Sattler 2002). Other additions to the knowledge of the European ethmiids are 
either data on their bionomics (e.g., Szeöke & Dulinafka 1 989; Prins et al. 1 99 1 ; Kun 
2001), regional faunistic works (e.g., Burmann 1980; Popescu-Gorj 1984; Szyska 1997) 
or checklists of certain regions and/or countries. 

The Ethmiidae of Europe can be considered as well known even though several 
species, and especially their biology, are still imperfectly known. The latest valid spe- 
cies of Ethmia (apart from subspecies and replacements names) described from Eu- 
rope is E. rothschildi (Rebel, 1912). 

During a short holiday trip to the island of Rhodes, Michael Fibiger collected with 
automatic light traps in two localities a series of males of a distinct, undescribed Ethmia 
species, which is described below. 



Nota lepidopterologica, 16.06.2003. ISSN 0342-7536 



208 



Karsholt & Kun: A new species of Ethmia 



Abbreviations 

BMNH - Natural History Museum, London, U. K., HNHM - Hungarian Natural History Museum, 
Budapest, Hungary, SUTT - Coll. R. Sutter, Bitterfeld, Germany, ZMUC - Zoological Museum, Uni- 
versity of Copenhagen, Denmark, ZSM - Zoologische Staatssammlung, München, Germany. 



Ethmia mariannae sp. n. 

Material. Holotype S 'GR, Rhodos, Kolombia, 40 m, 4.-5.VII.2000, leg. M. Fibiger; Gen. slide No. 
3 142, Ethmia, H. Hendriksen' (ZMUC). Paratypes: 9 6 with the same data as the holotype (ZMUC, 
HNHM), Gen. slide 403, A. Kun (HNHM); S, same data as the holotype, except 5 km S. 
Rhodos, 4.-8.vii.2000 (ZMUC). Material excluded from the type series: 3 6 , Greece, Karpathos 
Island, Lefkos, 30 m, 17., 19. & 22.V.1997 (Sutter), Gen. slide 5367, 5485 (SUTT, BMNH). 

Adult (males only) (Fig. 1). Wingspan 14-15 mm. Antenna filiform, scape and 
basal segments with white scales; flagellum grey; maxillary palpus small, with grey 
scales. Labial palpus with black ring on second segment, terminal segment grey, apically 
pointed; base of proboscis with bright grey scales; frons and vertex similarly grey, 
with black scales along junction of head and prothorax. Thorax bright grey with two 
pairs of black dots; tegulae greyish, with a pair of black (anterior) spots. Costal half of 
forewing suffused with darker grey; basal half overlaid with five sharply defined black 
spots, two of them placed along borderline between darker costal and paler inner half 
of wing, dividing this line into three rather equal portions; a further smaller spot situ- 
ated close to tornal angle, just below distal dark spot of borderline; last two spots often 
elongate, patchy or streak-like, placed along basal half of axillary vein; black marginal 
dots present, tiny; cilia bright grey. Hindwing grey, with grey cilia; costal brushes 
absent. Forelegs and midlegs darker grey, hindlegs covered with yellowish scales. 
Abdomen greyish yellow, with blackish scales on ventral surface. 

Variation. Specimens from Karpathos island differ in being slightly larger (wing- 
span 17-19 mm), by having the costal part of the forewings more brownish grey and 
by the more yellow posterior part of the abdomen. 

Male genitalia (Figs. 4, 4a). Uncus bifid, apically pointed, with deep, nar- 
row medial incision. Posterior part of gnathos well developed, dentate, anterior part 
slightly bilobate, finely dentate. Labis wide-based, triangular; anellus sclerotised. Valva 
with bristles; costa broad, with rounded apical part. Cucullus broad, curved ventrad, 
rather hooked; covered with scattered, fine bristles. Sacculus large, rather triangular, 





Fig. 1. Ethmia mariannae sp. n. Paratype (ZMUC). Fig. 2. Ethmia iranella Zerny, 1940 (HNHM). 



Nota lepid. 25 (4), published 2003: 207-212 209 

sclerotized, with pointed process at postero-lateral edge; characteristic sclerotised ba- 
sal fold. Vinculum V-shaped. Aedeagus gun-shaped; cornutus long, pointed. 

Female. Unknown. 

Distribution. Only known from the Greek islands of Rhodes and Karpathos. 

Bionomics. Early stages unknown. The type series (apart from one specimen) 
was collected with automatic light traps near the town Kolombia, behind a petrol sta- 
tion. The habitat is a hot, xerothermic rocky area, with some herbaceous plants. An- 
other specimen was found near Rhodes city, in a rather different vegetation type (M. 
Fibiger, pers. comm.). The type series was collected in early July during a period with 
high temperatures. 

Etymology.- The new species is dedicated to Mariann Fibiger for supporting 
the field work of her husband Michael Fibiger during their holiday in Rhodes. 

Discussion 

E. mariannae belongs to the Ethmia bipunctella species-group (sensu Sattler 1967). 
This group is characterised by a well developed mouth structure, a long proboscis, a 
four-segmented maxillary palpus, dark spots of the thoracic pattern arranged in a simi- 
lar way, last segments of the abdomen and hindlegs yellowish, costal brushes absent, 
uncus divided in some species, posterior and anterior parts of gnathos dentate, labis 
developed, cucullus curved, sacculus with pointed distal process, aedeagus with one 
pointed cornutus, antrum with a thorn, a long helical ductus bursae, corpus bursae with 
appendix and signum trilobate dentate. 

The closest relatives of E. mariannae are E. iranella Zerny, 1940 (Figs. 2, 3, 3a) 
and E. treitschkeella (Staudinger, 1879). The male genitalia of these three species dis- 
play the same ground plan. The external appearance of E. mariannae is, however, 
conspicuously different from those of the two allied species, and it is also much smaller, 
with a wingspan of 14-15 mm, while those of the other members of the bipunctella- 
group measure between 1 8 and 28 mm (Sattler 1967; Kun, unpublished). The forewing 
pattern of E. mariannae is characterized by the smaller black dots in the forewing and 
the uniformly greyish costal part, while the costal half of the forewing is black in E. 
iranella and E. bipunctella. The black spot on the border of the head and the prothorax 
is only present in E. mariannae and E. iranella. The male genitalia of E. mariannae 
(Figs. 4, 4a) differ mainly from those of E. iranella by the differently shaped, broader, 
more curved cucullus, the shorter and pointed distal sacculus process, the shape of the 
sacculus, and the long, more pointed cornutus. 

We have of course considered the possibility that E. mariannae may represent a 
subspecies of E. iranella. We have therefore examined material of the latter, including 
their male genitalia, from throughout its distribution range, apart from Spain, from 
where no specimens were available. From this survey we conclude that E. iranella is a 
species with nearly no variation in wing pattern and genitalia. Despite of its huge 
distribution area it shows no tendency to subspecies formation. E. mariannae is clearly 
separated from E. iranella in the above mentioned characters, and we thus conclude 
that it represents a species distinct from E. iranella. 



210 



Karsholt & Kun: A new species of Ethmia 




Figs. 3^4. Male genitalia. Figs. 3, 3a. Ethmia iranella Zerny, 1940, Gen. prep. Kun No. 206 (HNHM). 
Figs 4, 4a. Ethmia mariannae sp. n. Paratype, Gen. prep. Kun No. 403 (HNHM). 



Material examined of E . iranella (only dissected males). Greece: S , Korinthos 22.vi. 1 985 
(K. Szeöke), Gen. slide 296, A. Kun (HNHM); Hungary: â, Âgasegyhâza, homokbuckâs, l.viii.1956 
(Gozmâny), Gen. slide 292, A. Kun (HNHM); Iran: <?, Elburz Mts., Tacht i Suleiman, Hecarcal valley, 
2800-3200 m, 3.-7.VÜ.1936 (Osthelder), ZSM Gen. slide. No. 125 (ZSM); S, Prov. Teheran, Elburz 
Mts. 10 km S of Semsak, Deezin, 2000 m, 21.vii.2000 (Benedek), Gen. slide 293, A. Kun (HNHM); 
Italy: S, Taranto, Lido Silvana, 23.viii.1968 (Hartig), BM Gen. slide 30106 (BMNH); Turkey: 26, Prov. 
Ankara, Lake Tuz Gölü, 8 km N of Sereflikochisar, 1100 m, 33°16'E, 39°00'N, 24.iv. 1989 (Fabian, 
Ronkay & Ronkay), Gen. slide. 206 (fig 3.), 294, A. Kun (HNHM); 6, Prov. Kayseri, Avanos, 920 m, 
34°55'E, 38°41'N, 19.V.2001. (Fabian & Vig), Gen. slide 295, A. Kun (HNHM). 

The three male specimens from Karpathos Isl. are excluded from the type series 
because of the differences in size and wing pattern described above. Even though their 
genitalia fit to those of E. mariannae further studies, when more material of both sexes 
and host plant data become available, may show them to represent a further taxon, 
probably on subspecific level. 



Nota lepid. 25 (4), published 2003: 207-212 2 1 1 

Hostplants of Ethmiidae are in most cases members of the Boraginaceae. The early 
stages of the taxa of the E. bipunciella species-group and their bionomics are still 
poorly known, apart from E. bipunctella itself, which has been studied in some detail 
(Szeöke & Dulinafka 1989; Prins et al. 1991). The immature stages and the host plants 
of the other members of the species-group are still undiscovered. E. bipunctella, which, 
according to literature data, feeds on various Boraginaceae species, e.g. Onosma 
arenaria, Anchusa officinalis, Echium vulgare, E. calycinum, Cynoglossum officinale, 
Symphytum sp. and Alkanna tinctoria, has also been recorded from Rhodes. E. iranella, 
the most closely related species of E. mariannae, is distributed in Spain, Hungary, 
Romania, Greece, European part of Russia, Turkey, Syria, Iran Transcaucasus and 
Turkmenia (Sattler 1967; Zagulajev 1990; Neumann 2000). Zagulajev (1990) also 
records iranella from northwest Asia, but this requires confirmation. 

Field observations of adult Ethmia suggest that they are most abundant close to 
their host plants and rarely fly far from these. However, it is still surprising that E. 
mariannae has not been discovered before on the island of Rhodes especially during 
the field work of Lâszlô Gozmâny and the late Joseph Klimesch (Gozmâny, in press). 
One can only speculate about the reasons for that, but one reason could be that the 
automatic light traps used by Michael Fibiger worked throughout the night and hence 
also attracted moths flying only late in the night or towards the early morning. 

The type series of E. mariannae is in good condition except that the antennae of 
most specimens are broken. Due to the high temperature the numerous moths col- 
lected in the light traps quickly became dry and their antennae broken by subsequent 
moths moving around after being caught in the trap (Michael Fibiger, pers. comm.). 

Acknowledgements 

We are grateful to Michael Fibiger, Soro, for presenting to the ZMUC the Microlepidoptera material 
collected during his trip to Rhodes, and to Reinhard Sutter, Bitterfeld, Germany for sending specimens 
and genitalia photos for study. We also thank Geert Brovad, ZMUC for photographing the adult of E. 
mariannae, Henning Hendriksen, ZMUC for assisting with preparation of adults and genitalia, and Linda 
Pitkin, BMNH for linguistic correction. We acknowledge the comments on our manuscript received 
from Dr. Klaus Sattler, BMNH and an anonymous referee. Andrâs Kun's research on Ethmiidae was 
supported by the COBICE (ZMUC) and the COLPARSYST (MNHM) EC-funded IHP programs. 



References 

Buszko, J. 1978. Ethmiidae. - Klucze Oznacz. Owad. Pol. 27 (36): 1-21. Warszawa. 

Burmann, K. 1980. Beiträge zur Microlepidopterenfauna Tirols. 2. Ethmiidae (Lepidoptera). - Nachrbl. 

bayer. Ent. 29: 25-29. 
Gozmâny, L., in press. The Lepidopera of Greece. - Hellenic Zoological Society, Athens. 
Hannemann, H. J. 1997. Kleinschmetterlinge oder Microlepidoptera 5: Oecophoridac. C'himabachidae, 

Carcinidae, Ethmiidae, Stathmopodidae. - Tierwelt Dtl. 70: 1-165. 
Hodges, R. W. 1999. The Gelechioidea. In: N. P. Kristensen (ed.): Lepidoptera. moths and butterflies. 

Volume 1 : Evolution, systematics, and biogeography. - Handbuch der Zoologie 4 (35). - Walter de 

Gruyter, Berlin, New York. - Pp. 131-158. 
Kun, A. 2001. Data to the distribution and bionomics of Ethmia dodecea (Lepidoptera: Oecophoridac) 

in Hungary. - Folia ent. Hung. 62: 383-384. [Hung.] 
Minet, J. 1990. Remaniement partiel de la classification des Gelechioidea, essentiellement en fonction 

de caractères pré-imaginaux. - Alexanor 16: 239-255. 



212 



Karsholt & Kun: A new species of Ethmia 



Neumann, H. 2000. Ethmia iranella Zerny, 1940 (Ethmiidae) und Aterpia circumfluxana Christoph, 

1 88 1 (Tortricidae), zwei fuer Rumaenien neue Mikrolepidopterenarten. - Entomol. Romanica 4 (1999): 

69-72. 
Palm, E. 1989. Nordeuropas Prydvinger (Lepidoptera: Oecophoridae). - Danmarks Dyreliv 4: 1-247 

(incl. 8 pis.). Fauna Boger, Kobenhavn. 
Popescu-Gorj, A. 1984. Ethmia lugubris (Staudinger) (Lepidoptera, Ethmiidae), espèce nouvelle pour la 

faune de Roumanie. - Trav. Mus. hist. nat. Gr. Antipa 25: 239-240. 
Prins, A. H., Laan, R. M., Verboom, J. & Verboom, B. 1 99 1 . Food plant quality of Cynoglossum officinale 

and herbivory by Ethmia bipunctella (Lepidoptera, Ethmiidae). - Neth. J. Zool. 41: 184-193. 
Riedl, T. 1996. Ethmiidae. In: O. Karsholt & J. Razowski (eds.): The Lepidoptera of Europe. A 

distributional checklist. - Apollo Books, Stenstrup. - Pp. 63-64. 
Sattler, K. 1967. Ethmiidae. In: H. G. Amsel, F. Gregor & H. Reisser (eds.): Microlepidoptera Palaearctica 

2 (1): i-xi, 1-185; 2 (2): pis. 1-106. Wien. 
Sattler, K. 2002. Ethmiidae. In: A. M. Emmet & J. R. Langmaid: Oecophoridae - Scythrididae (excluding 

Gelechiidae). The Moths and Butterflies of Great Britain and Ireland 4(1).- Harley Books, Colchester, 

Essex. -Pp. 178-187, pi. 5. 
Szeöke, IC. & Dulinafka, G. 1989. Damage of Ethmia bipunctella F. (Lep. Ethmiidae) in Alkanna tinctoria 

plants. - Növenyvedelem 25: 142. [Hung.] 
Szyska, P. 1997. Ethmia fumidella Wocke, ny sjaelden dansk smâsommerfugl. - Lepidoptera 7: 112-113. 
Zagulajev, A. K., 1990. Family Ethmiidae. In: G. S. Medvedev (ed.): Keys to the Insects of the European 

part of the USSR 4, Lepidoptera, part 2. - E. J. Brill, Leiden, New York, Kobenhavn, Köln. - Pp. 

853-871. 



Nota lepid. 25 (4), published 2003: 213-220 213 

Check-list of the broad-winged moths (Oecophoridae s. 1.) of 
Russia and adjacent countries 

Alexandr L. Lvovsky 

Zoological Institute, Russian Academy of Sciences, Universitetskaya nab. 1, RU- 199034 St- 
Petersburg, Russia; e-mail: lepid@zin.ru 



Summary. The distribution of Oecophoridae moths in the territory of Russia and adjacent countries (i.e. 
in the borders of the former USSR) is summarized. The concept of the family is taken broadly, including 
the subfamilies Chimabachinae, Deuterogoniinae, Pleurotinae, Oecophorinae and Amphisbatinae, but 
excluding Depressariinae and Autostichinae. There are 38 genera and 110 species in this territory. Nine 
new generic combinations are introduced. The distributions of species are recorded for every republic of 
the former USSR. From the data the completeness of the current knowledge of this fauna is estimated. 

Zusammenfassung. Die Verbreitung aller aus dem Territorium der früheren Sowjetunion bekannten 
Oecophoridae-Arten wird zusammenfassend dargestellt. Dabei wird die Familie einschließlich der Un- 
terfamilien Chimabachinae, Deuterogoniinae, Pleurotinae, Oecophorinae und Amphisbatinae, aber aus- 
schließlich der Depressariinae und Autostichinae aufgefaßt. Insgesamt kommen 110 Arten aus 38 Gat- 
tungen im Gebiet vor. Neun neue Gattungskombinationen werden eingeführt. Die Diversität der 
Oecophoriden wird tabellarisch für jede Teilrepublik der früheren Sowjetunion dargestellt. Die verfüg- 
baren Daten werden genutzt, um die derzeitige Vollständigkeit des Erfassungsgrades in den einzelnen 
Teilgebieten abzuschätzen. 

Key words. Lepidoptera, Oecophoridae, faunal diversity, Russia, adjacent countries, new combinations. 



Introduction 

The first (and the last) check-list of all Russian Lepidoptera was published many years 
ago (Erschoff & Field 1870). It contained only 3180 species, among them 31 species 
of Oecophoridae (without Depressariidae). In the inventory presented below the number 
of Oecophoridae species known to occur in the territory of the former USSR is raised 
to 1 10 species from 38 genera. Most data used to compile this check-list stem from the 
collection of the Zoological Institute of the Russian Academy of Sciences. Moreover, 
the following modern faunistic literature sources were evaluated: European part of 
Russia (Lvovsky 1981,1 990); Asiatic part of Russia (Lvovsky 1 999); Estonia (Jürivete 
et al. 2000); Latvia (Savenkov et al 1996); Lithuania (Ivinskis 1993); Belarus 
(Merzheevskaya et al. 1976); Ukraine (Sovinskiy 1938; Budashkin 1987); Kyrgyzstan 
(Lvovsky & Kozlov 1983); Tajikistan (Lvovsky & Sherniyazova 1992). 

The suprageneric classification of the family is far from being settled. Diver- 
gent systems are used even in the most modern literature (Leraut 1997; Hodges 
1999; Kuznetzov & Stekolnikov 2001). Here I follow the system of Kuznetzov 
& Stekolnikov (2001), but with some modifications. In particular, I exclude 
Depressariinae and Autostichinae. Thus Oecophoridae as conceived here in- 
cludes Chimabachinae, Deuterogoniinae, Pleurotinae, Oecophorinae and 
Amphisbatinae. The genus Orophia Hübner, 1825 (= Cephalispheira Bruand, 
1851) is retained in a rather 'traditional' manner, as it is probably more correct 
to be included in the family Depressariidae. 

© Nota lepidopterologica. 16.06.2003. ISSN 0342-7536 



214 



Lvovsky: Oecophoridae of Russia and adjacent countries 



Faunistics and biogeographical comments 

The diversity of Oecophoridae species, broken down to genera and regions, is shown 
in Table 1 . This table includes some unusual, surprising findings. Epicallima gerasimovi 
Lvsk. was found in middle Volga (Lvovsky & Sachkov 1996), while before the species 
had been only know from middle Asia. Epicallima haasi Rbl., formerly known only 
from Turkey, was found in East Uzbekistan. Denisia luticiliella Ersch. also occurs in 
Latvia (Savenkov 1988) and Lithuania (Ivinskis 1993), whereas it was earlier known 
only from the Caucasus. These observations indicate very significant extensions of 
formerly suspected distribution ranges and suggest that many more Oecophoridae spe- 
cies with apparently restricted ranges may in fact be much more widespread. Clearly, 
the family is under-sampled still in most territories of the former USSR. 

Table 1. Species numbers within 38 Oecophoridae genera recorded from the former USSR. Regions and 
states are designated as follows: 1 - European Russia; 2 - Asiatic Russia; 3 - Estonia; 4 - Latvia; 5 - 
Lithuania; 6 - Belarus; 7 - Ukraine; 8 - Moldova; 9 - Georgia; 10 - Armenia; 11 - Azerbaijan; 12 - 
Kazakhstan; 13 - Turkmenistan; 14 - Uzbekistan; 15 - Kyrgyzstan; 16 - Tajikistan; 17 - Entire territory. 



Genus 



8 



10 11 12 13 14 15 16 17 



Diurnea Hw. 


2 


1 


2 


2 


2 


2 


2 


2 


2 


1 








1 











3 


Dasystoma Curt. 


1 


2 


1 


1 


1 


1 


1 


1 


























2 


Deuterogonia Rbl. 


1 


2 





1 


1 





1 





























2 


Minetia Leraut 


1 


1 














2 





























2 


PleurotaHb. 


8 


7 


1 


1 


1 


1 


7 





8 


4 


11 


11 


4 


3 


5 





27 


Holoscolia Z. 


1 

















1 





1 


1 




















1 


Aplota Stph. 


1 








1 














1 























2 


Alabonia Hb. 




















1 


1 


























1 


Oecophora Latr. 








1 











1 





1 























2 


Dasycera Stph. 


1 

















1 





























1 


Colchia Lvsk. 


























1 























1 


Harpella Sehr. 








1 


1 


1 


1 


1 


1 


























1 


Callimodes Leraut 


1 


1 




















2 


2 


2 

















3 


Schiffermuelleria Hb. 


1 








1 


1 





1 


1 


























1 


Bisigna Toll 


1 


1 


1 


1 


1 


1 


1 


1 


























1 


Fabiola Busck 


1 

















1 





1 























1 


Decantha Busck 


1 





1 


1 








1 





























1 


Metalampra Toll 


1 





1 


1 


1 


1 


1 











1 

















2 


Epicallima Dyar 


2 


4 


1 


1 


1 


1 


1 


1 


1 


1 


1 


2 


1 


2 


3 


4 


10 


Promalactis Mey r. 





6 












































6 


Denisia Hb. 


7 


2 


2 


4 


4 


2 


3 





2 


1 


2 

















7 


Buvatina Leraut 


1 


1 












































1 


Batia Stph. 




















2 





























2 


Crassa Bruand 


2 





1 


2 


2 





1 





2 





1 

















3 


Borkhausenia Hb. 


3 





3 


3 


3 


1 


1 





























3 


EndrosisWo. 


1 


1 


1 


1 


1 


1 


1 


1 


1 


1 


1 


1 








1 





1 


Hofmannophila Spul. 


1 





1 


1 


1 


1 


1 


1 


























1 


Marty ringa Busck 





2 












































2 


Pseudocryptolechia Lvsk. 


1 















































1 


Carcina Hb. 





1 











1 








1 





1 

















2 


Periacma Meyr. 





1 












































1 


Pseudatemelia Rbl. 


4 


2 


3 


3 


3 





1 





1 





1 

















5 


Amphisbatis Z. 


1 








1 


1 



































1 


Telechrysis Toll 


1 


1 


1 


1 








1 





1 























1 


Hypercallia Stph. 


1 


1 


1 


1 


1 


1 


1 





1 


1 


1 

















1 


Anchinia Hb. 


2 


2 


2 


2 


2 


1 


1 





1 























3 


Orophia Hb. 


3 





1 


1 


1 











2 





1 

















4 


Eutorna Meyr. 





1 












































1 



Total: 



52 39 26 32 29 16 37 10 30 12 23 14 



110 



Nota lepid. 25 (4), published 2003: 213-220 215 

As it is demonstrated in the table, the distribution of the Oecophoridae species is very 
uneven. This may be explained, on the one hand, by the very different climatic and 
natural conditions across this large territory (Lvovsky 1996 a). From north to south there 
are four major natural zones: tundra, forest (with subzones of boreal forest or taiga and 
broad-leaved forest), steppe and desert. The broad-leaved forest is the most favourable 
for Oecophoridae moths. Their fauna is abundant in European Russia and in the south of 
the Russian Far East. In contrast, in tundra and desert ecosystems Oecophoridae moths 
are very rare. The severe continental climate of Siberia also does not appear to be favour- 
able for Oecophoridae moths, therefore their fauna is poor in this vast territory. The same 
is true for highlands. Only few species are recorded here, for example Pleurota exoletella 
Ersch. in the Zailijsky Alatau (Kazakhstan) at elevations up to 3000 m. 

On the other hand, the uneven diversity of Oecophoridae species across regions is 
at least partially explained by the variable degree of completeness of faunal invento- 
ries in different regions. Judging from available distributional records and habitat avail- 
ability, I suspect the completeness of regional faunal inventories as approximately 
95% in Estonia, Latvia and Lithuania; 90% in European Russia, Belarus and Ukraine; 
80% in Asiatic Russia and Georgia; 70% in Azerbaijan; 60% in Armenia and 
Kazakhstan; 50% in Turkmenistan and Kyrgyzstan; 40% in Moldova and Uzbekistan; 
and only 20% in Tajikistan. 



Check-list 

The species distribution in the following check-list is given only for areas within 
the borders of the former USSR. The place names are spelled as Microsoft Encarta 
Interactive World Atlas 2001 default place names. Kray (= territory) and oblast' (= 
region) - administrative divisions of Russian Federation; N - north, northern; S - 
south, southern; W - west, western; E - east, eastern. 

1. Diurnea fagella (Denis & Schiffermüller, 1775) - Russia (centre and S of European part, 
including Dagestan; to the N up to Moscow and Kazan), Estonia; Latvia, Lithuania, Belarus, 
Ukraine, Moldova, Georgia, Armenia. 

2. D. lipsiella (Denis & Schiffermüller, 1775) [= phryganella (Hübner, 1796)] - Russia (centre 
and S of European part, to the N up to Kazan); Estonia, Latvia, Lithuania, Belarus, Ukraine, 
Moldova, Georgia, Turkmenistan (Kopet-Dag.). 

3. D. soljanikovi Lvovsky, 1986 - Russian Far E (Primorskiy Kray [Primorye]). 

4. Dasystoma salicella (Hübner, 1 796) - Russia (European part, S Siberia, Amurskaya oblast'., S 
Khabarovskiy Kray, Primorskiy Kray [Primorye]), Estonia, Latvia, Lithuania, Belarus, Ukrai- 
ne, Moldova. The erroneous misspelling "Dasytroma" (Lvovsky 1996b) unfortunately was 
subsequently used in further publications (Jttrivete et ai 2000). 

5. D. kurentzovi (Lvovsky, 1990) - Russian Far E (Primorski) Kray [Primorye]). 

6. Deuterogonia pudorina (Wocke, 1857) Russia (middle Volga, S Irkutskaya oblast'., S 
Chitinskaya oblast'., S Amurskaya oblast', Primorskiy Kray [Primorye]), Latvia, Lithuania, 
Ukraine. There is a gap in the distributional range from middle Volga to Lake Baykal. The 
species is very rare in Europe, but common in Russian Far E. 

7. D. chionoxantha (Meyrick, 1931) - Russian Far E (Kunashir Island). 

8. Minetia crinitus ( Fabricius, 1 798) [= Topeutis barbella (Fabricius. 1 794)] - Russia (S European 
part up to Saratov, S Ural, Altay, Minusinsk); Ukraine (near Kiev). 

9. M adamczewskii (Toll, 1956) - Ukraine (near Zvenigorod). 



216 



Lvovsky: Oecophoridae of Russia and adjacent countries 



10. Pleurota pyropella (Denis & Schiffermüller, 1 775) - Russia (S European part and N Caucasus); 
Ukraine, Georgia, Azerbaijan, Armenia, Turkmenistan, Uzbekistan, SE Kazakhstan, Kyrgyzstan. 

11. P. malatya atrostriata Lvovsky, 1 992 - Russia (S European part up to Kursk, Dagestan, Altay, 
Minusinsk); Ukraine, Georgia, Azerbaijan, Armenia, SE Kazakhstan. In old Russian literature 
this taxon was mentioned erroneously as P. brevispinella Zeller. 

12. P. karatauella Lvovsky, 1984 - S and SE Kazakhstan. 

13. P. contignatella Christoph, 1 872 - European Russia (lower Volga: Sarepta, Bogdo); Kyrgyzstan. 

14. P. ordubadella Lvovsky, 1992 -Azerbaijan (near Ordubad). 

15. P. zhdankoi Lvovsky, 1992 - N Kyrgyzstan (mountains Kungey Alatau). 

16. P. tristatella Staudinger, 1 8 7 1 - European Russia (Krasnodarskiy Kray and Stavropolskiy Kray) ; 
Ukraine, Georgia (Manglisi), Azerbaijan (Lerik). 

17. P. semiticella Amsel, 1959 -Azerbaijan (Ordubad). 

18. P. scabrella Lvovsky, 1984 - Georgia (Borzhomi). 

19. P. transcaucasica Lvovsky, 1992 -Azerbaijan (Ordubad). 

20. P. bicostella (Clerck, 1759) - Russia (N of European part, Siberia, rare in Far E, only S of 
Amurskaya oblast); Estonia, Latvia, Lithuania, Belarus, W Ukraine (Carpathians). 

21. P. kostjuki Lvovsky, 1990 - Azerbaijan, E Kazakhstan. 

22. P. falkovitshi Lvovsky, 1992 - Turkmenistan, Uzbekistan. 

23. P. aorsella Christoph, 1872 - Russia (Saratov and Volgogradskaya oblast', Dagestan, 
Novosibirskaya oblast'); N and E Kazakhstan. 

24. P. pungitiella Herrich-S chaffer, 1854 - S of European Russia, Dagestan; Ukraine (Crimea), 
Georgia, N Kazakhstan. The record "Siberia" in old literature is erroneous. 

25. P. metricella (Zeller, 1847) - Georgia, Azerbaijan. 

26. P. nitens Staudinger, 1870 - Georgia, Azerbaijan, Armenia, Turkmenistan. 

27. P. aristella (Linnaeus, 1767) - S European Russia, Dagestan; Ukraine, Georgia, Azerbaijan, 
Armenia, Kazakhstan (mountains), Kyrgyzstan. 

28. P. christophi Lvovsky, 1992 -Azerbaijan (Ordubad). 

29. P. exoletella (Erschoff, 1874) [= Megacraspedus exoletellus Erschoff, 1874] - SE Kazakhstan, 
Turkmenistan (Kopet-Dag), E Uzbekistan. 

30. P. rezniki Lvovsky, 1984 - S Kazakhstan (Karatau). 

31. P. marginella (Denis & Schiffermüller, 1775) [= rostrella (Hübner, 1796)] - Ukraine. 

32. P. sibirica Rebel, 1901 - Russia (Altay, Tuva, Amurskaya oblast'); NE Kazakhstan. 

33. P. neurograpta Filipjev, 1929 - Russia (Transbaykalia: Buryatia, Chitinskaya oblast'). 

34. P. tuvella Lvovsky, 1992 - Russia (S Siberia: Tuva). 

35. P. obtusella Rebel, 1917 - SE Kazakhstan, E Kyrgyzstan. 

36. P. monotonia Filipjev, 1924 - Russia (S Siberia near Minusinsk). 

37. Holoscolia huebneri Koçak, 1980 [= forficella (Hübner, 1813)] - Russia (S Ural); Ukraine, 
Georgia, Armenia. 

38. Aplota palpella (Haworth, 1828) - European Russia (Sarepta near Volgograd); Georgia. 

39. A. nigricans (Zeller, 1 852) [= kadeniella (Herrich-S chaffer, 1 854)] - Latvia, collected by N. V. 
Savenkov near Slitere. 

40. Alabonia staintoniella (Zeller, 1850) - Ukraine, Moldova. 

41. Oecophora kindermanni (Herri ch-Schäffer, 1852) - W Georgia. 

42. O. bractella (Linnaeus, 1758) - Estonia (Saarema Island), Ukraine. 

43. Dasycera oliviella (Fabricius, 1794) - European Russia (Belgorodskaya oblast'); Ukraine. 

44. Colchia zagulajevi Lvovsky, 1994 - SW Georgia (Ajaria). 

45. Harpella forficella (Scopoli, 1763) - Estonia, Latvia, Lithuania, Belarus, W Ukraine. 

46. Callimodes heringii (Lederer, 1864) - N Caucasian Russia near Maykop; Georgia, Armenia, 
Azerbaijan. 

47. C. mannii (Lederer, 1870) - E Georgia, Armenia, Azerbaijan. 

48 . C. zelleri (Christoph, 1 882) - Russian Far E (S Khabarovskiy Kray, Primorskiy Kray [Primorye]). 

49 . Schiffermuelleria schaejferella (Linnaeus, 1 75 8) - European Russia from Urzhum to Volgograd, 
S Ural; Latvia, Lithuania, Ukraine. 



Nota lepid. 25 (4), published 2003: 213-220 217 

50. Bisigna procerella (Denis & Schiffermüller, 1775) - Russia from St. Petersburg to Belgorod, 
Ural, Altay, S Amurskaya oblast', Primorskiy Kray [Primorye]), Estonia, Latvia, Lithuania, 
Belarus, Ukraine, Moldova. 

51. Fabiola pokornyi (Nickerl, 1864) - Caucasian Russia (Dagestan); Ukraine (Crimea), Georgia. 

52. Decaniha borkhausenii (Zeller, 1839) - Russia near St. Petersburg; Estonia, Latvia, W Ukraine. 

53. Metalampra cinnamomea (Zeller, 1839) - European Russia from Petrozavodsk and Urzhum to 
Belgorod and Kazan; Estonia, Latvia, Lithuania, Belarus, Ukraine. 

54. M. caucasica Lvovsky, 1994 -Azerbaijan. 

55. Epicallima formosella (Denis & Schiffermüller, 1775) - European part of Russia from St. 
Petersburg to S Siberia eastwards to Novosibirsk; Estonia, Latvia, Lithuania, Belarus, Ukraine, 
Moldova, Georgia, Armenia, Azerbaijan, SE Kazakhstan, Kyrgyzstan. 

56. Epicallima haasi (Rebel, 1902) comb. n. [= Borkhausenia haasi Rebel, 1902] - E Uzbekistan 
(Margelan). Note: the characteristic brown and yellow spots on the fore wings and elongated 
juxta in the male genitalia substantiate the transfer of this species to the genus Epicallima Dyar. 

57. Epicallima gerasimovi (Lvovsky, 1984) comb. n. [= Borkhausenia gerasimovi Lvovsky, 1984] 
- European Russia only near Samara, collected by S. A. Sachkov; SE Kazakhstan, Turkmenis- 
tan, Kyrgyzstan, Tajikistan. Note: The reason for the change of the genus name of this species 
is the same as in the previous species. 

58. Epicallima kuldzhella (Lvovsky, 1982) comb. n. [= Callima kuldzhella Lvovsky, 1982] - SE 
Kazakhstan near Alma-Ata, Kyrgyzstan. Note: the genus name Epicallima Dyar, 1903 was 
proposed as a replacement name for the genus Callima Clemens, 1860, nee Herrich- Schäffer, 
1858. 

59. Epicallima tadzhikella (Lvovsky, 1982) comb. n. [= Callima tadzhikella Lvovsky, 1982] - 
Tajikistan. Note: the reason for the change of the genus name is the same as in the preceding 
species. 

60. Epicallima conchylidella (Snellen, 1884) comb. n. [= Lampros conchylidella Snellen, 1884] - 
E Russia (Chitinskaya oblast', Amurskaya oblast', S Khabarovskiy Kray, Primorskiy Kray 
[Primorye]). Note: the peculiar brown spot on the dark yellow fore wings and elongated juxta 
with two processes in the male genitalia explain the transfer of this species to the genus 
Epicallima Dyar. 

61. Epicallima bisinuella (Erschoff, 1874) comb. n. [= Oecophora bisimiella Erschoff, 1874] - 
Uzbekistan, Tajikistan. Note: the brown spots on the dark yellow fore wings and sclerotized 
cuiller near the distal end of the valva in the male genitalia substantiate the transfer of this 
species to the genus Epicallima Dyar. 

62. Epicallima subsuzukiella (Lvovsky, 1985) comb. n. [= Promalac/is subsuzukiella Lvovsky, 
1985] - Russian Far E (S Primorskiy Kray [Primorye]). Note: the peculiar dark brown spot on 
the yellow fore wings of this species differentiates it from all Promalactis species. 

63. Epicallima nadezhdae (Lvovsky, 1985) comb. n. [= Promalactis nadezhdae Lvovsky, 1985] - 
Russian Far E (S Primorskiy Kray [Primorye]). Note: the reason for transferring this species to 
the genus Epicallima Dyar is the same as in the preceding species. 

64. Epicallima dushanbella (Lvovsky & Arutjunova, 1992) comb. n. [= Callima dushanbella 
Lvovsky & Arutjunova, 1992] - W Tajikistan. Note: the reason for transfer of this species to 
the genus Epicallima Dyar is the same as in E. kuldzhella Lvovsky. 

65. Promalactis venustella (Christoph, 1882) [= odaiensis Park. 1980] - E Russia (S Irkutskaya 
oblast', S Chitinskaya oblast', S Khabarovskiy Kray, Primorskiy Kray [Primorye]). 

66. P. jezonica (Matsumura, 1931) [= symbolopa Mcyrick, 1935] - Russian Far E (S Primorskiy 
Kray [Primorye]). 

67. P. svetlanae Lvovsky, 1985 - Russian Far E (S Primorskiy Kray [Primorye]). 

68. P. ermolenkoi Lvovsky, 1986 - Russian Far E (Sakhalin. Iturup, Kunashir. Shikotan Islands). 

69. P. parki Lvovsky, 1986 - Russian Far E (Primorskiy Kray [Primorye]). 

70. P. sinevi Lvovsky, 1986 - Russian Far E (S Primorskiy Kray [Primorye]). 

71. Denisia stipella (Linnaeus, 1758) - N and central part of European Russia, S Siberia, Sakhalin 
Island; Estonia, Latvia, Lithuania, Belarus, W Ukraine (Carpathians). 



218 



Lvovsky: Oecophoridae of Russia and adjacent countries 



72. D. similella (Hübner, 1 796) - N and central part of European Russia, Ural, S Siberia, Kamchatka; 
Estonia, Latvia, Lithuania, Belarus, N Ukraine. 

73. D. luticiliella (Erschoff, 1877) - S of European Russia (Stavropol, Essentuki, Dagestan); very 
rare in Latvia and Lithuania; common in Georgia, Azerbaijan, Armenia. 

74. D. augustella (Hübner, 1796) [= angustella auct.] - Centre and S of European Russia; W Uk- 
raine, Azerbaijan. Information about occurrence in Russia (Kozhantshikov 1955) and Azerbaijan 
(Ahundova-Tuaeva 1958) needs verification. 

75. D. stroemella (Fabricius, 1779) - N and central part (Samara) of European Russia; Latvia, 
Lithuania. 

76. D. coeruleopicta (Christoph, 1888) - N Caucasus of Russia (Teberda); Georgia, Armenia. 

77. D. obscurella (Brandt, 1937) - NW Russia (Sortavala). 

78. Buvatina iremella Junnilainen & Nupponen, 1999 - Russia (S Ural, Chelyabinskaya oblast'). 

79. Batia lunaris (Haworth, 1828) - Ukraine, record needs verification. 

80. B. lambdella (Donovan, 1793) - Ukraine. 

81. Crassa unitella (Hübner, 1796) [= Batia unitella (Hübner, 1796)] - S of European Russia; 
Latvia, Lithuania, Ukraine, Georgia, Azerbaijan. 

82. C. tinctella (Hübner, 1796) [= Tichonia tinctella (Hübner, 1796)] - central part of European 
Russia; Estonia, Latvia, Lithuania. 

83. Crassa ochricolor (Erschoff, 1877) comb. n. [= Oecophora ochricolor Erschoff, 1877] - 
Georgia. Note: the ochreous fore wings without spots, juxta with two peculiar processes, and a 
large cornutus in the aedeagus of the male genitalia substantiate the transfer of this species to 
the genus Crassa Bruand, 1851. 

84. Borkhausenia minutella (Linnaeus, 1758) - central part of European Russia; Estonia, Latvia, 
Lithuania, Ukraine. 

85. B.fuscescens (Haworth, 1828) - NW European part of Russia; Estonia, Latvia, Lithuania. 

86. B. luridicomella (Herrich- S chaffer, 1856) - European Russia (middle Volga: Samara, Saratov); 
Estonia, Latvia, Lithuania, Belarus. 

87. Endrosis sarcitrella (Linnaeus, 1758) [= lactella (Denis & Schiffermüller, 1775)] - in all 
territories. 

88. Hofmannop'hila pseudospretella (Stainton, 1849) - European part of Russia; Estonia, Latvia, 
Lithuania, Belarus, Ukraine, Moldova. 

89. Martyringa ussuriella Lvovsky, 1 979 - SE Russia (Altay, Chitinskaya oblast', Primorskiy Kray 
[Primorye], Kunashir and Shikotan Islands). 

90. M. xeraula (Meyrick, 1910) [= Santuzza kuwanii Heimich, 1920; = Martyringa ravicapitis 
Hodges, 1960] - Russian Far E (S Primorskiy Kray [Primorye]). 

9 1 . Pseudocryptolechia sareptensis (Möschler, 1 862) - S European Russia (Sarepta near Volgograd). 

92. Carcina quercana (Fabricius, 1775) - S Belarus, Georgia, N Azerbaijan. 

93. C. luridella (Christoph, 1882) [= Heterodmeta homomorpha Meyrick, 1931] - Russian Far E 
(S Khabarovskiy Kray, Primorskiy Kray [Primorye], Sakhalin and Kunashir Islands). 

94. Periacma delegata Meyrick, 1914 - Russian Far E (S Primorskiy Kray [Primorye]). 

95. Pseudatemelia flavifrontella (Denis & Schiffermüller, 1775) - central part of European Russia; 
Estonia, Latvia, Lithuania, Ukraine. 

96. Pseudatemelia Kurentzovi Lvovsky, 2001 - Russian Far East (Primorskiy Kray). 

97. P. subochreella (Doubleday, 1859); [= Tubuliferola panzerella auct.] - Caucasian Russia 
(Dagestan); Georgia, Azerbaijan. 

98. Pjosephinae (Toll, 1956) - N and central part of European Russia, S Siberia, Russian Far E (S 
Primorskiy Kray [Primorye]), Kunashir and Shikotan Islands); Estonia, Latvia, Lithuania. 

99. P. elsae Svensson, 1982 - NW Russia; Estonia, Latvia, Lithuania. 

100. Amphisbatis incongruella (Stainton, 1849) - W Russia (Kaliningradskaya oblast'); Latvia, 
Lithuania. 

101. Telechrysis tripuncta (Haworth, 1828) - S European Russia (Sarepta), N Caucasus (Teberda), 
S Siberia (Irkutskaya oblast'), Russian Far E (S Primorskiy Kray [Primorye], Kunashir Island); 
Estonia, Latvia, Ukraine, Georgia. 



Nota lepid. 25 (4), published 2003: 213-220 219 

102. Hypercallia citrinalis (Scopoli, 1763) - European Russia from Petrozavodsk to N Caucasus, S 
Siberia (Altay, Minusinsk, Irkutsk); Estonia, Latvia, Lithuania, Belarus, Ukraine, Georgia, 
Armenia, Azerbaijan. 

1 03 . Anchinia cristalis (Scopoli, 1 763) - Russian Far E (Kunashir Island); Estonia, Latvia, Lithuania. 

104. A. daphnella (Denis & Schiffermüller, 1775) - European Russia from Petrozavodsk to N 
Caucasus, S Siberia (S Irkutskaya oblast'); Estonia, Latvia, Lithuania, Belarus, Ukraine. 

105. A. grandis Stainton, 1867 - N Caucasian Russia from Teberda to Dagestan; Georgia. 

1 06. Orophia denisella (Denis & Schiffermüller, 1 775) [= Cephalispheira denisella (Denis & Schiffer- 
müller, 1775)] - S European Russia (Stavropol). 

107. O. ferrugella (Denis & Schiffermüller, 1775) - central part of European Russia (St. Petersburg, 
Vladimir, Kasan); Estonia, Latvia, Lithuania. 

108. O. sordidella (Hübner, 1796) - Caucasian Russia from Krasnodarskiy Kray to S Dagestan; 
Georgia, Azerbaijan. 

109. O. imbutella (Christoph, 1888) comb. n. [= Depress aria imbutella Christoph, 1888)] -Georgia. 
Note: the peculiar double gnathos and reduced tegumen in the male genitalia explain the transfer 
of this species to the genus Orophia Hübner, 1825. 

110. Eutorna leonidi Lvovsky, 1979 - Russian Far E (S Primorskiy Kray [Primorye], Kunashir 
Island). 



Conclusions 

The fauna of Oecophoridae moths in the territory of the former USSR is by far not 
completely known. Additional species are expected to be found particularly in under- 
explored regions such as the Caucasian mountains, southern Siberia, Central Asia (es- 
pecially in the mountains) and in the south of Russian Far East. Altogether, about 10- 
1 5 additional species may be expected to occur in the entire territory of the former 
USSR. The total number of species considered here (1 10) is substantially lower than in 
the smaller territory of Europe (152 species). This difference would remain even if 
accounting for the expected rise in species numbers, if the faunas of still under-sam- 
pled areas were better known. This lower diversity of Oecophoridae in Russia is most 
likely explained by the severe continental climate in Siberia and in the deserts of Cen- 
tral Asia, which apparently restrain the establishment of a richer oecophorid fauna. 



Acknowledgements 

It is my pleasure to thank Dr. V. G. Mironov and Dr. S. Yu. Sinev (Zoological Institute of the Russian 
Academy of Sciences) for their help in preparing this paper for publication. The study received financial 
support from the Russian Foundation for Fundamental Research (project 01-04 49637). The work was 
conducted using scientific collections of the Zoological Institute. Russian Academy of Sciences, which 
obtain Financial support from the Science and Technology Ministry of the Russian Federation (Ren. No. 
00-03-16). 



References 

Ahundova-Tuaeva, L. M. 1958. Lepidoptera harmful for field-protecting forest plantations in Azerbaijan. 

- Uchenie zapiski Azerbaijanskogo Universiteta. Biol. Scr. I: 51 59 |russ.]. 
Budashkin, Yu. I. 1987. Cheshuyckrylye, soobshchenive 3. [Lepidoptera. communication 3]. fir. Flora 

i Fauna Zapovednikov SSSR. Cheshuyckrylyye Karadagskogo Zapovednika (Operativno- 

informatsionnyi material). - Moscow. P. 32-62. [russ.]. 
Erschoff, N. & Field, A., 1 870. Catalogus Lepidopterorum imperii Rossici. - Trudy russ. ent. Obshch. 4: 

130-204. [russ.]. 



Lvovsky: Oecophoridae of Russia and adjacent countries 

Hodges, R. W. 1999. The Gelechioidea. In: Kristensen, N. P. (ed.), Lepidoptera, moths and butterflies, 

Vol. 1: Evolution, systematics, and biogeography. - Handbook of Zoology 4 (35). - Berlin, W. de 

Gruyter. P. 131-158. 
Ivinskis, P. 1993. Check-list of Lithuanian Lepidoptera. - Ekologijos Institutas, Vilnius. 210 pp. 
Jiirivete, U., Kaitila, J., Kesküla, T., Nupponen, K., Viidalepp, J. & Ounap, E. 2000. Estonian Lepidoptera 

catalogue. - Tallinn. 151 pp. 
Kozhantshikov, I. V 1955. Gelechiidae. In: Stackelberg, A. A. (ed.), Vrediteli lesa [The pests of forest] 

1. -Moscow-Leningrad, USSR Academy of Sciences. P. 146-155. [russ.]. 
Kuznetzov, V I. & Stekolnikov, A. A. 2001. New approaches to the system of Lepidoptera of the world 

fauna. - St. Petersburg, Nauka, 463 pp. [russ.]. 
Leraut, P. J. A. 1997. Liste systématique et synonymique des Lépidoptères de France, Belgique et Corse 

(deuxième édition). - Paris. 526 pp. 
Lvovsky, A. L. 1981. Oecophoridae. In: Medvedev, G. S. (ed.), Opredelitel nasekomykh evropeyskoi 

chasti S S SR [Key to the insects of the European part of the USSR] 4 (2). - Leningrad, Nauka. P. 

560-638. [russ.]. 
L'vovskii (Lvovsky), A. L. 1990. Oecophoridae. In: Medvedev, G S. (ed.), Key to the insects of the 

European Part of the USSR 4 (2). - Leiden & Cologne, E. J. Brill. P. 747-852. 
Lvovsky, A. L. 1996a. The diversity of the Oecophoridae fauna in the boreal and temperate zones of 

Eurasia (Lepidoptera). -Acta Zool. Fennica 200: 3-8. 
Lvovsky, A. L. 1996b. Chimabachidae. In: Karsholt, O. & Razowski, J. (eds.), The Lepidoptera of Europe .- 

Apollo Books, Stenstrup. P. 78. 
Lvovsky, A. L. 1999. Oecophoridae. In: Ler, P. A. (ed.), Opredelitel nasekomykh Dal'nego Vostoka 

Rossii [Key to the insects of Russian Far East], Trichoptera and Lepidoptera 5 (2). - Vladivostok, 

Dalnauka, P. 43-57. [russ.]. 
Lvovsky, A. L. & Kozlov, M. V 1983. On the fauna of broad- winged moths (Lepidoptera, Oecophoridae) 

of Kirgiz SSR. - Entomol. Issledovania v Kirgizii 16: 11-14. [russ.]. 
Lvovsky, A. L. & Sachkov, S.A. 1994 (1996). Callima gerasimovi (Lvsk.) (Lepidoptera, Oecophoridae) 

- new species for Europe from Zhigulevsk reservation. - Bull. Samarskaya Luka 5: 199-203. [russ.]. 
Lvovsky, A. L. & Sherniyazova, R. M., 1992. On the fauna of broad-winged moths (Lepidoptera, 

Oecophoridae) of Tajikistan. - Izvestia Akad. Nauk Respubliki Tajikistan, ser. Biol. 2 (126): 3-7. 

[russ.]. 
Merzheevskaya, O. I., Litvinova, A. N. & Molchanova, R. V. 1976. Cheshuyekrylyye (Lepidoptera) 

Byelorussii. Katalog. [The Lepidoptera of Byelorussia. Catalogue]. - Minsk, Nauka i tekhnika. 132 

pp. [russ.]. 
Savenkov, N. V 1988. New and rare Lepidoptera species of the fauna of Latvia. - Latvijas entomologs 

31: 64-68. [russ.]. 
Savenkov, N. V, Suies, L, Kerppola, S. & Huldén, L. 1996. Checklist of Latvian Lepidoptera - Latvijas 

Taurinu Katalogs. - Baptria 21 (3a): 1-71. 
Sovyns'kiy, V. V. 1938. Moli (Lepidoptera: Tineidae, s. lat.) tsentralnoyi chastyny Kyivs'koyi oblasti. 

[Moths (Lepidoptera: Tineidae, s. lat.) of the Kiev oblast' central part]. - Zbirnyk Prats' Zoomuzeyu 

(Kyiv) 21-22: 3-95. [ukrain.]. 



Nota lepid. 25 (4), published 2003: 221-225 221 

A new species of Ceratoxanthis Razowski, and distribution 
records for two species of Aethes Billberg from the Balkan 
Peninsula (Tortricidae: Cochylini) 

Gustav Elsner* & Josef Jaros** 

* Hulkova 304, CZ-197 00 Praha 9 - Kbely, Czech Republic; e-mail: gustav.elsner@volny.cz 
** Institute of Entomology, Czech Academy of Sciences, Branisovskâ 31, CZ-370 05 Ceské 
Budëjovice, Czech Republic; e-mail: jaros@entu.cas.cz 



Summary. Ceratoxanthis adriatica sp. n., a new species of Cochylini (Lepidoptera, Tortricidae) is de- 
scribed from southern Yugoslavia (Montenegro). A key to all known species of the genus Ceratoxanthis 
Razowski 1960, based on the male genitalia, is provided. Aethes caucasica (Amsel, 1959) is recorded 
from Bulgaria for the first time. Aethes margaritifera Falkovitsh, 1963 is recorded from Bulgaria and 
from the Balkan Peninsula for the first time. 

Key words. Tortricidae, Cochylini, Ceratoxanthis adriatica sp. n., Aethes, new records, Yugoslavia, 
Montenegro, Bulgaria. 



Introduction 

The Cochylini of the Balkan Peninsula have been comparatively well documented in 
the last revision devoted to Cochylini of the Palaearctic Region (Razowski 1970). The 
most comprehensive publication dealing with Cochylini of this Peninsula was devoted 
to species of Bulgaria (Slivov 1973). 

This paper presents the description of Ceratoxanthis adriatica sp. n. from Yugosla- 
via (Montenegro) and two new distribution records of Cochylini from Bulgaria, which 
are interesting from the zoogeographical point of view. 



Ceratoxanthis adriatica sp. n. 

Material examined. Holotype 6: "Yugoslavia mer., Buljarica, 13.7.1 985, G. Eisner Igt." Deposited in 
the collection of the National Museum Praha (NMPC). 

Description. Adult (Fig. 1). Wingspan 20 mm. Antenna brown. Labial palpus 
approximately twice as long as the diameter of the eye, pale yellow with a brownish 
hue. Frons and vertex concolorous with palpus. Thorax and tegula pale yellow. Forewing 
ground colour pale yellow; basal half of costa edged with ferruginous-brown; mark- 
ings consist of dark ferruginous-brown metallic erect scales; basal and sub-basal fas- 
ciae obsolete; median fascia represented by conspicuous elongate subdorsal patch; a 
conspicuous streak from above tornus inward-oblique to middle, inflexed outwards, 
terminating on upper margin of cell; cilia pale yellow with brown admixture, more 
strongly suffused with brown on tornus, with a weak ferruginous sub-basal line. 
Hindwing pale greyish-brown, cilia whitish yellow with pale brown sub-basal line. 
Male genitalia (Figs 2, 3). Tegumen short and broad. Socius moderately 
sclerotised, sub-triangular, with the ventral margin slightly emarginated. Transtilla 
strongly sclerotised, broad and convex, without spines. Valva very broad; process situ- 

© Nota lepidopterologica. 16.06.2003. ISSN 0342-7536 



222 



Elsner & Jaros: Cochylini from the Balkan Peninsula (Tortricidae:) 







, 






x 
















Éfc^!| ^\ 


/ 




\ "-^ à>^ ^««^_ »i 


I -^f/ ^ÇfS*' -*f 






k 4fci" ' '^ ' ' V ' : '"4r 






BL/ ^d^M^v^y 


"^ "W"' 


WrâjËEaa&MNlllK • .vurtSXil^^lfl 


-dh mMR -...■ -.^WBKMjMfltt^^ri .. , , 


- "-^ffajjj 




W'M^ '• EBs^^^^MiÉiAr"- 


■**** r - ' ' "'• - 






jft^W 


"^'^^l 


Ib& ,'"*W~ ~ , * >, ^w_ 


1 ' v ^£&j 


pS^äSF^'' u 


\f^ : 




llBP^W' 


^1 









Fig. 1. Ceratoxanthis adriatica sp. n., cî, holotype. 




Fig. 2. Male genitalia of Ceratoxanthis adriatica sp. n., holotype, ventral view. Fig. 3. Ceratoxanthis 
adriatica sp. n., a caudal view at the aedeagus-juxta complex in detail (natural position). 



ated below base of costa of the valva broad basally with strong, hook-like termination, 
armed with strong spines. Caulis large, extending laterally along aedeagus. Lateral 
processes of juxta, connected with caulis and base of sacculus, relatively short with a 



Nota lepid. 25 (4), published 2003: 221-225 223 

cluster of ca. 1 5 long hairs distally. Aedeagus long and narrow with extremely broad 
bilobate coecum penis, one minute cornutus present. 
Female genitalia. Unknown. 

Biology. Unknown. The holotype was collected at UV light (fluorescent tube 320- 
480 nm), in 'steppe' habitat on dry slopes near the Adriatic Sea at an altitude of 500 m. 
Distribution. Known only from the type locality: SW Yugoslavia - 
Montenegro. 

Etymology. The new species is named after the position of the type locality on 
Adriatic coast. 

Differential diagnosis. The genus Ceratoxanthis Razowski, 1 960 is related 
and externally similar to the genera Agapeta Hübner, 1 822 and Fulvoclysia Obraztsov, 
1943, but may be safely distinguished from both, by its male genitalia (cf. Razowski 
1968, 1987). C adriatica is externally similar to some forms of Agapeta hamana 
(Linnaeus, 1758) with reduced markings in the costal area, but differs conspicuously 
by an elongate subdorsal patch, which in A. hamana is usually oval. The most closely 
related species C. externana (Eversmann, 1 844) differs from C. adriatica by its nearly 
complete transverse fascia extended from costa to tornus and oval subdorsal spot. C. 
externana differs from C adriatica also by its smaller size. Due to the remarkable 
differences in the male genitalia, C adriatica may be safely distinguished from all 
four previously known Ceratoxanthis species. C adriatica seems to be most closely 
related to C externana (figured in Razowski 1968: 79, fig. 2, 1970: pi. 65, fig. 142, 
1987: 225, figs 115-119) by the shape of the transtilla and moderately short lateral 
process of the juxta which considerably differ from those of C argentomixtana 
(Staudinger, 1870), C iberica Baixeras, 1992 and Ceratoxanthis rakosyella Wieser & 
Huemer, [2000]. The more typical features of the male genitalia of C. adriatica are the 
cluster of long hairs on the distal part of the lateral process of the juxta and extremely 
broad coecum penis. C adriatica also differs considerably from C externana by the 
shape of the process situated below the base of the costa of the valva. In C adriatica 
this process has a relatively long and narrow hook-like termination and is armed with 
strong and very short spines, while in C. externana this process is more or less ovate 
and is armed with considerably narrower and longer spines. 

A key to species of the genus Ceratoxanthis based on the male genitalia: 

1 Lateral process of juxta approximately equally long as aedeagus 2 

Lateral process of juxta conspicuously longer than aedeagus 3 

2 Lateral process of juxta provided with a row of spines terminally, aedeagus with coecum 

penis moderately broad externana 

Lateral process of juxta provided with a cluster of long hairs terminally, aedeagus with 

coecum penis extremely broad adriatica 

3 Lateral process of juxta more than twice as long as aedeagus rakosyella 

Lateral process of juxta approximately 1 .5 times longer than aedeagus 4 

4 Lateral process of juxta provided with a long row of spines extended from basal to 

terminal part argentomixtana 

Lateral process of juxta provided with a row of spines on terminal part only iberica 



994 

z,z ^ 1 ' Elsner & Jaros: Cochylini from the Balkan Peninsul a (Tortricidae:) 

Comments. The new species is known only from the holotype. There are 5 species 
of Ceratoxanthis known to date. The distribution of the genus Ceratoxanthis com- 
prises a few isolated localities reaching from SW Europe to Asia Minor and Central 
Asia. Until recent years only two species of this genus were known (Razowski 1970): 
C externana which is distributed from south-eastern part of European Russia to cen- 
tral Kazakhstan and Azerbaijan and C argentomixtana which is distributed from south- 
eastern part of European Russia to West Kazakhstan and North Syria. Surprisingly, C. 
iberica was recently described from Spain (Baixeras, 1992), now a further new spe- 
cies Ceratoxanthis rakosyella has been described from Romania (Wieser & Huemer, 
[2000]). The fifth species, C adriatica is known only from one locality on the Yugo- 
slavian Adriatic coast. Although C externana and C argentomixtana are distributed 
over a relatively large area, the other three species of the genus Ceratoxanthis are 
known only from three isolated western localities. The biology of the representatives 
of the genus Ceratoxanthis remains poorly known. The immature stages and larval 
host plants are unknown. The adults occasionally come to light. C. externana is the 
only species whose female is known (Razowski, 1968, 1970). 

Aethes caucasica (Amsel, 1959) 

Material examined. 2o\ Bulgaria mer., Kresna, 13.V.1975, K. Cerny Igt, G. Eisner coll. 

Comments. A. caucasica is known from the Caucasus (Georgia: Tbilisi), south- 
ern Ural Region (Orenburg), northern Italy (Trentino) (Razowski 1970) and central 
Romania (Transylvania) (Kovâcz & Kovâcz 1996). Kovâcz & Kovâcz (1996) described 
the female genitalia for the first time. The species is associated with 'pseudo-steppe' 
habitats on dry slopes at lower elevations up to 400 m. Bulgarian specimens were 
collected in typical warm and dry sub-mediterranean habitat of Kresna Gorge of the 
Struma River valley (SW Bulgaria). This is the first record from Bulgaria. 

Aethes margaritifera Falko vitsh, 1963 

Material examined. 9, Bulgaria mer., Kresna, 31.V.1984, J. Jaros Igt. et coll. 

Comments.l margaritifera is known from the south-eastern part of European 
Russia (Uralsk, Krasnoarmiejsk, Orenburg), Central Asia and Armenia (Razowski 1970) 
and has been recorded also from NE Turkey (F. Groenen, pers. comm. and identifica- 
tion of his specimens by J. Jaros). A. margaritifera is externally similar to A. 
margaritana (Haworth, [1 8 1 1]) but differs from it by a slender subterminal deep ochre- 
ous streak extending to termen in contrast to A. margaritana which has a continuous or 
interrupted area of clear silver-white ground colour between the subterminal streak 
and termen. These two species may be easily separated on genitalia characters (see 
Razowski 1970). The Bulgarian specimen was collected in the warm and dry sub- 
mediterranean habitat of Kresna Gorge of the Struma River valley (SW Bulgaria), 
where A. margaritifera reaches the most north-western part of its range. This is the 
first record from Bulgaria and the Balkan Peninsula. 



Nota lepid. 25 (4), published 2003: 221-225 225 

Acknowledgements 

We thank to Dr. Joaquin Baixeras and Dr. Peter Huemer for valuable information and helpful discus- 
sions. We are also grateful to Dr. Ing. Karel Cerny, who provided the material of Microlepidoptera from 
his Bulgaria expedition. Our cordial thanks are due to Mr. Robert J. Heckford for his linguistic help and 
valuable comments on the manuscript. The study was partially supported by the Grant of the Czech 
Academy of Sciences S 5007015. 



References 

Baixeras, J. 1992. A new species of Ceratoxanthis Razowski from Spain (Lepidoptera, Tortricidae). - 

Nota lepid. 14: 294-296. 
Kovâcz, Z. & S. Kovâcz 1996: The occurrence of Aethes caucasica (Amsel, 1959) (Lepidoptera: 

Tortricidae: Cochylini) in Transylvania (Romania). - Folia entomol. hung. 57: 85-89. 
Razowski, J. 1968. Revision of the generic group Agapeta Hübner (Lepidoptera, Cochylidae). -Acta 

zool. cracov. 13: 73-102. 
Razowski, J. 1970. Cochylidae. In: Amsel, H. G, Gregor F. & H. Reisser (eds.), Microlepidoptera 

Palaearctica. - Verlag Georg Fromme & Co., Wien. 3: i-xiv, 528 pp., 161 pis. 
Razowski, J. 1987. The genera of Tortricidae, I: Palaearctic Chlidanotinae and Tortricinae. -Acta zool. 

cracov. 30: 141-355. 
Slivov, A. 1973. List of species and distribution of moths of the family Cochylidae in Bulgaria. - Izv. 

Zool. Inst. Muz., Sofia. 38: 79-104 (In Bulgarian). 
Wieser, C. & P. Huemer [2000]. Ceratoxanthis rakosyella sp. n., eine bemerkenswerte neue 

Schmetterlingsart aus Rumänien (Lepidoptera, Tortricidae). - Entomol. rom. 4 (1999): 5-9. 



226 



Book review 



Book Review 

Rotschke, H. & K. Huber (eds.) 2002. The Noctuids (Noctuidae) of Central Europe. An 

Interactive Identification Guide on CD-ROM. ISBN 3-9805958-5-1. Price: 99 EURO. Orders: 
V.I.M. Verlag für interaktive Medien GbR, Orchideenweg 12, D-76571 Gaggenau, Germany, 
e-mail: postmaster@vim.de. http://www.vim.de 

"The Noctuids (Noctuidae) of Central Europe" is the first CD in the interactive series "The Moths and 
the Butterflies of the World". It is a part of the "World Species Database, Professional Identification 
Series". When asked to review this software I was, initially, a little bit sceptical about its value, but 
several hours later I found myself still siting at the computer, enjoying this marvellous product and 
saying to myself "What a wonderful program, I must have it!" The guide covers Denmark, Germany, 
Belgium, The Netherlands, Luxembourg, Switzerland, Liechtenstein, Austria, northern Italy (Italian Alps), 
Hungary, Slovakia, Czech Republic and Poland. The latest version of the CD contains more than 1300 
pictures of 740 species. Species are shown on several plates, and the underside of many are also illus- 
trated. Details of wings pattern are' provided. For difficult to identify, closely related species, detailed 
information for separation is included, for example figures of genitalia. Technical terms used are ex- 
plained by figures in the Introduction. Some comments concerning recent taxonomic changes are given 
when necessary. Nomenclature follows different authors: Nowacki & Fibiger in: Karsholt & Razowski, 
1996, Forster & Wohlfahrt, 1971, Koch, 1984, Ebert, 1994, 1997, 1998, Heath & Emmet, 1979, 1983 
and the reader can choose which system to use. Readers can arrange plates according to the system they 
prefer and can also arrange their own plates. Moths figures can be displayed on screen all the same size 
or of relative natural size. Each species can be maximized on a full screen or displayed together with 
similar species. Many species are illustrated alive, in natural positions; where such illustrations are 
present they are marked on the species sheets. Each specimen has its own data label, which is hidden, but 
also can be easily displayed. Filters allow species lists to be arranged in accordance with the different 
classifications, alphabetically by genera or by specific names, by countries, by size and by seasons. For 
example, if you choose as a country Denmark, and as a season December- January, the nine noctuids 
known in this season from this country will be displayed automatically. Quick reference can be made to 
all the species inhabiting each of the countries included. It is also possible to view by country or for the 
entire Central European area, species 1.5 cm in size or below, etc. This, together with selection of wing 
or body shape, pattern and colour of the wings allows for quick and smooth species determination as the 
possible species are displayed. Species sheets include current scientific name with author and year of the 
description, figure(s) of the insects with size in mm and variations (the illustration of Xylomoia strix 
Mikkola, 1980 is missing), locality labels, synonyms and their source (for Central Europe only, mostly 
from the monographs quoted above), vernacular names, information for similar species, taxonomic com- 
ments, distribution by countries and distribution map, showing occurrence in the whole of Europe, not 
only in Central Europe and additional data when necessary: key characters, genitalia etc. One small 
drawback is that distribution is shown by whole country, so that the entire of a country where a species 
occurs is shaded. This does not, therefore, always give detailed information on the real distribution. In 
addition, a puzzle, a mind game and an identification quiz with different levels are provided for fun, 
testing knowledge and for relaxing in enjoyable way. The CD-ROM contains 507 MB and it is offered in 
a hard A5-sized box with instructions. Copies are available in English and German. To use this software, 
which is based on HTML technology, you need at least 64 MB RAM. It is best viewed with MS Internet 
Explorer version 5 or above. As software this program is extremely well composed and it is a real 
pleasure to use. All illustrated specimens are of top quality and all the photographs are excellent, so each 
species can be seen in details in real vivid colours on full screen. This product is strongly recommended 
to everyone, amateur or professional, interested in moths and particularly in Noctuidae. It will be useful 
to naturalists, students and teachers, and will be of help in educational programs by initiating in young 
people an interest in the wonderful world of moths. 

Stoyan Beshkov 



Nota lepid. 25 (4), published 2003: 227-233 227 

Re-capture of Sinobirma malaisei m China: description of the 
female genitalia and comments on the systematic position of the 
genus in the tribe Urotini (Saturniidae) 

Rodolphe Rougerie 

Muséum national d'Histoire naturelle (Entomologie), 45 rue de Buffon, F-75005 Paris, France, e-mail: 

rougerie@mnhn.fr 
Muséum d'Histoire naturelle de Toulouse, 27 rue Bernard Délicieux, Site Sang du Serp, F-31200 

Toulouse, France. 



Summary. The recent re-capture in China of the enigmatic Sinobirma malaisei (Bryk, 1944), the only 
Asian member of the otherwise wholly African tribe Urotini of the subfamily Saturniinae, is recorded. A 
few previously uncertain characters of the external habitus are verified and the female genitalia are 
described and illustrated for the first time. The systematic position of S. malaisei is discussed and a 
possible close relationship with the Madagascan species Maltagorea auricolor (Mabille, 1 879) is proposed. 

Résumé. L'espèce énigmatique Sinobirma malaisei (Bryk, 1944) a été re-capturée en Chine; elle est la 
seule représentante en Asie de la tribu des Urotini dont tous les autres membres vivent en Afrique ou à 
Madagascar. Quelques caractères incertains de 1' habitus sont précisés et l'armature génitale femelle est 
décrite et illustrée pour la première fois. La position systématique de S. malaisei est discutée et une 
relation de parenté étroite avec l'espèce malgache Maltagorea auricolor (Mabille, 1879) est proposée. 

Key words. Saturniidae, Urotini, China, Sinobirma malaisei, relict, eastern Gondwana fragmentation. 



Introduction 

Sinobirma malaisei (Bryk, 1 944), the sole known species of the genus Sinobirma Bryk, 
1944, was discovered in 1934 by René Malaise in mountains on the border between 
north-eastern Burma and the Yunnan Province of China. Since the original few speci- 
mens of both sexes taken by Malaise, only a single male is known to have been col- 
lected in 1998 in northern Burma by a Russian collector (S. Naumann, pers. comm.). 

Because so few specimens of this species are available for study, and because of its 
extraordinary taxonomic and biogeographical significance (Nässig & Oberprieler 1 994), 
the author initiated an expedition to China in 2001 to try and recollect it. An account of 
this successful venture is presented here, together with the description of the previ- 
ously unrecorded female genitalia of S. malaisei and some comments on the analysis 
of its taxonomic position and relationships by Nässig & Oberprieler (1994). 

Sinobirma was described as a subgenus of the Australian and New Guinean genus 
Opodiphthera Wallengren, 1858, a member of the tribe Saturniini in the Saturniinae. 
Nässig & Oberprieler (1994) raised Sinobirma to generic status and demonstrated its 
belonging to the Afro-Madagascan tribe Urotini (= Pseudapheliini sensu Bouvier 1928, 
see Oberprieler 1997 for details about the tribal name and its full synonymy). From an 
examination of the wing pattern, antennae and male genitalia, these authors concluded 
that, within Urotini, Sinobirma is closely related to a group of three genera, namely 
Tagoropsis Felder, 1874, Pseudantheraea Weymer, 1892 (both from continental Af- 
rica) and Maltagorea Bouyer, 1993 (from Madagascar). 

© Nota lepidopterologica. 16.06.2003, ISSN 0342-7536 



228 



Rougerie: Sinobirma malaisei in China 



A possible closer relationship between Sinobirma and Maltagorea led them to hypoth- 
esise that S. malaisei may be "the relict (or offspring) of a formerly eastern Gondwanan 
species that lived in India and Madagascar during the late Cretaceous and then trav- 
elled north on the 'Arc India' to Asia" and that "it does seem very likely [...] that 
Sinobirma is some kind of 'living fossil' of considerable age". 

Re-capture of Sinobirma malaisei 

The capture of Sinobirma malaisei was one of the major aims of a collecting trip in 
south-western China which took place between 3 June and 9 July, in accordance with the 
dates of Malaise's expedition and the original captures of S. malaisei (9 and 17 June 
1934). The collecting site was chosen as close as possible to the type locality of the 
species, which was given by Bryk (1944) as 'China, Yunnan Province, Kambaiti, 2000 m 
a.s.L' It is situated in the Tongbinguan nature reserve, less than two kilometres from the 
Burmese border and about 70 km south of Malaise's locality, in the same mountain 
massif, at 2080 m a.s.L (GPS co-ordinates: 24°49'N 97°44'E). The vegetation consisted 
of low and medium-sized trees, including numerous flowering Castanopsis (Fagaceae), 
and small cleared zones with grass and ferns. The vegetation composition of this region 
appeared very singular to us, and we have never seen similar forests elsewhere in Yunnan 
province. At the site, we operated a single 125 W mercury- vapour lamp powered by a 
small generator and placed in front of a vertical white sheet facing the forest. During the 
nights of 12 and 13 June we collected, among numerous other Lepidoptera, seven males 
and four females of S. malaisei (Figs. 1-2). Their flight times were remarkably constant, 
the females arriving at the sheet at about 21 :00 and the males between 23:30 and 00:00 
local time. Like many other saturniids, S. malaisei arrived at the light in an erratic fash- 
ion, fluttering around on the ground before settling on the sheet or surrounding shrubs. 
This rediscovery of S. malaisei, almost 70 years after René Malaise took the first speci- 
mens, proves that the species is still present and relatively abundant in this border zone 
mountain massif. The recent capture of a single male in northern Burma (at Nan Thi, 50 
km east of Putao, GPS co-ordinates: 27°27N 97°55'E, 950 m, 11-16 May 1998) by a 
Russian collector indicates that S. malaisei also occurs further north and probably has a 
wider distribution in this region. 




Figs. 1-2. Female (1) and male (2) of Sinobirma malaisei. 



Nota lepid. 25 (4), published 2003: 227-233 229 

Morphology 

The habitus of Sinobirma malaisei (Nässig & Oberprieler 1994: 373, Figs. 2-3, and 
Figs. 1-2 in this paper) was redescribed by Nässig & Oberprieler (1994), who also 
described and illustrated its male genitalia for the first time, adding some new and 
important information about its relationships and systematic position. The redescription 
by Nässig & Oberprieler (1994) differs from Bryk's (1944) original account in a few 
features, assumed to be due to fading of the specimens. Our fresh specimens allow 
clarification of these aspects, as follows: 

the antennae are indeed rusty brown, as described by Bryk, not yellowish brown as observed by 

Nässig & Oberprieler on Bryk's specimens 50 years later; 

similarly, the anterior part of the head and the legs are purplish brown, as described by Bryk; 

the black borderline of the patagia mentioned by Bryk, but invisible on some specimens available to 

Nässig & Oberprieler, is clearly present on fresh specimens of both sexes (Figs. 1-2); 

the distal area of the female forewings, beyond the postmedial line, is clearly covered with reddish 

scales (Fig. 1) in all four female specimens collected, as is the case in the female holotype specimen 

illustrated by Nässig & Oberprieler (1994). 

Nässig & Oberprieler (1994) did not study an important character, the number of 
segments of the labial palpus, so as to avoid destruction of the head of one of the few 
specimens known at the time. The head of a damaged male of the newly collected 
specimens was partially dissected, revealing that the labial palpus consists of two 
ventrally partially fused segments (Fig. 3). 

With regard to the male genitalia (Nässig & Oberprieler 1994: 376, Figs. lOa-c), 
one of the most important characters is the presence of a pair of postero-medial proc- 
esses on the eighth abdominal sternum. Nässig & Oberprieler also described a strongly 
sclerotised structure - guiding the phallus dorsally - and interpreted this as "probably" 
representing a transtilla. Closer examination of this structure showed it to be con- 
nected not only to the proximal part of the costae of the valves - what is consistent 
with the 'transtilla' as defined in Klots (1970) and Scoble (1992) - but also to the 
lateral arms of the gnathos, arising from the uncus at a ventral position. This transverse 
sclerite is also present in other Saturniidae and its identity has been the subject of 
several discussions (Michener 1952, Lemaire 1978, Balcazar-Lara & Wolfe 1997). I 
interpret this part as a fusion of the transtilla and the gnathos. Another character of the 
male genitalia of S. malaisei, not noticed by previous authors, is that the posterior tip 
of the aedeagus opens toward the left side of the moth (Fig. 4), whereas this opening is 
apical or oriented to the right in most of the other related Saturniidae (Tabic 1 ). Such 
variations were already documented in sphingids by Kitching (2002), and were attrib- 
uted to a twisting of the aedeagus (clockwise or counter clockwise) assessed by the 
observation of internal structures. The hypothesis of a similar twisting of the aedeagus 
in some saturniid moths would be premature but is an interesting candidate to explain 
our observations; further anatomical studies are necessary to assess the origin of the 
variations in the orientation of the distal opening of the aedeagus. 

The genitalia of one of the collected females of Sinobirma malaisei were dissected; 
they are described and illustrated here for the lust time (Figs. 5-8). The ovipositor is 



230 



Rougerie: Sinobirma malaisei in China 



formed by a pair of fleshy papillae anales with numerous setae; the posterior apophy- 
ses, attached to the anterior edges of the papillae anales, are about one quarter longer 
than the anterior apophyses (Fig. 7). Ventrally, between the papillae anales, the mem- 
branous zone is weakly sclerotised and shows some marked longitudinal folds (Fig. 
5). The vaginal plate ('sterigma') is composed of two, clearly distinct, ventral parts 
(Figs. 5-6): a strongly sclerotised anterior part contiguous with tergum A8 (forming a 
complete ring with it), and a large sclerotised posterior part with an important poste- 
rior thickening. The latter, usually called "lamella postvaginalis", is clearly distinct 
from, though very close to the posterior edge of the anterior part of the sterigma. The 
ostium bursae is large and lies on the anterior part of the sterigma. Tergum A8 is di- 
vided by a membranous zone which is enlarged anteriorly (Fig. 8). The ductus bursae 
is short, weakly sclerotised dorsally; the corpus bursae is small, with numerous wrin- 
kles on its surface and without signum. The ductus seminälis enters on dorso-lateral 
right side of the posterior part of the corpus bursae. The spermatheca (Fig. 7) is large, 
nearly as long as the whole genitalia; the internal and external canals are short and 
very thin, converging towards a thick and long receptacular canal that separates into an 




Figs. 3-8. - 3 - Left labial palpus in lateral view (anterior at left) of male S. malaisei. 4 - Aedeagus in 
ventral view. 5,6- Female genitalia in ventral and lateral view. 7 - Spermatheca. 8 - Tergum A8. Scale 
bar: 0.5 mm (Fig. 3), 1 mm (Figs. 4 to 8). 



Nota lepid. 25 (4), published 2003: 227-233 2M 

ellipsoid lagena and a long utriculus which is slightly thickened for a length approxi- 
mately equal to that of lagena. 

Systematics 

For comparative purposes, the material examined for this study is listed in Table 1 
together with the conditions of the characters described below. Nässig & Oberprieler 
(1994) uncovered Bryk's error of placing Sinobirma malaisei in the Australian and 
New Guinean saturniine genus Opodiphthera, and demonstrated its surprisingly close 
relationship with the Afro-Madagascar Tagoropsis group of genera (Bouyer 1993) of 
Urotini, based on characters of the male (bipectinate) antennae, general wing pattern, 
and male genitalia. In particular, they pointed out that Sinobirma and Pseudantheraea 
share a similar general habitus, with eyespots present on the hindwings (a plesiomorphic 
character in the Saturniinae), and that Sinobirma and some species of the genus 
Maltagorea share an unusual character: the presence of a pair of posterior processes 
on the eighth sternum in the male (possibly indicating a sister-group relationship but 
then leaving Maltagorea as paraphyletic, Table 1). Oberprieler (1997) later showed 
that this character also occurs in other genera of Urotini and even in Eochroa Felder, 
1874, currently included in the tribe Bunaeini but of uncertain placement. 

The present study of the female genitalia and mouthparts of S. malaisei reveals 
further characters of possible taxonomic significance. First, S. malaisei has a two- 
segmented labial palpus like Tagoropsis and unlike Maltagorea (three segments) or 
Pseudantheraea (one segment); however, as already pointed out by Nässig & 
Oberprieler (1994), this character is of poor phylogenetic value and very likely to be 
homoplastic, as reductions in the number of labial palpus segments occur widely in 
Saturniidae. Second, S. malaisei and Maltagorea auricolor (Mabille, 1879) share a 
number of characters: 

(1) the membranous interruption of female tergum A8 (Fig. 8), whereas it is continuous in all other 
species of the group (Table 1); 

(2) the conformation of the posterior lobes of male sternum A8; these lobes are weakly sclerotised and 
directed toward the posterior end of the body, whereas (when present) they are shorter, strongly 
sclerotised and directed toward the interior of the body in the other species of the genus Maltagorea 
(Table 1); 

(3) the presumed fusion of gnathos and transtilla; 

(4) the distal opening of the aedeagus (Fig. 4) is oriented to the left (Table 1). 

Within the Tagoropsis group, these four shared character states are unique to Sinobirma 
malaisei and Maltagorea auricolor, suggesting a probable sister-group relationship be- 
tween these two taxa. The evolution of characters (3) and (4) must be considered cau- 
tiously and further research is needed within the subfamily to evaluate their phylogenetic 
significance. The isolated taxonomic position of M auricolor among the Madagascan 
Urotini was already pointed out by Griveaud (1962) and again by Bouyer (1993) who 
suggested a possible relationship between M. auricolor and Pseudantheraea, but he was 
then unaware of the affinities of Sinobirma to this group of genera. A close relationship 
between M. auricolor and S. malaisei had not been proposed before. 



232 



Rougerie: Sinobirma malaisei in China 



Table 1. Material examined and character distribution within the Tagoropsis group of genera, n - number 
of preparations (m - males, f - females), ad - aedeagus (its opening can be apical (ap), oriented toward 
the left (1) or the right (r) side of the moth), st.8 - male sternum A8 (x - posterior lobes absent, w - 
posterior lobes weakly sclerotized and directed toward the posterior end of the body, s - posterior lobes 
strongly sclerotized and directed toward the interior of the body, t - reduced tubercle- shaped posterior 
lobes). t8 - female tergum A8 (i - interrupted medially, c - continuous). - lp = number of segments of 
the labial palpus. 



Genus 


Species 


n 


ad 


st.8 


t8 


Ip 






m 


f 










Sinobirma 


malaisei (Bryk, 1944) 


2 


1 


1 


w 


i 


2 


Maltagorea 


andriai (Griveaud, 1962) 


18 


7 


r 


s 


c 


3 




ankaratra (Vierte, 1954) 


3 


1 


r 


X 


c 


3 




auricolor Mabille, 1879 


6 


1 


1 


w 


i 


3 




cincta Mabille, 1879 


1 


- 


r 


s 


- 


- 




dentata (Griveaud, 1962) 


1 


- 


r 


s 


- 


3 




dura (Keferstein, 1870) 


3 


1 


r 


s 


c 


3 




fusicolor (Mabille, 1879) 


2 


1 


r 


X 


c 


3 




griveaudi Bouyer, 1996 


5 


1 


r 


s 


c 


3 




monsarrati (Griveaud, 1968) 


1 


1 


r 


X 


c 


3 




rostaingi (Griveaud, 1962) 


8 


1 


r 


X 


c 


3 




rubriflava (Griveaud, 1962) 


2 


1 


r 


X 


c 


3 




sogai (Griveaud, 1962) 


3 


- 


r 


s 


- 


3 




vulpina (Butler, 1880) 


10 


1 


r 


s 


c 


3 


Pseudantheraea 


discrepans (Butler, 1878) 


2 


1 


ap 


X 


c 


1 




imperator Rougeot, 1962 


1 


1 


ap 


X 


c 


1 


Tagoropsis 


genoviefae Rougeot, 1950 


2 


1 


ap 


t 


c 


2 




hanningtoni (Butler, 1883) 


2 


- 


ap 


t 


- 


2 




natalensis (Felder, 1874) 


1 


1 


ap 


t 


c 


2 



Conclusions 

The re-capture of Sinobirma malaisei in China confirms that this enigmatic species 
still exists in the mountain massif on the border between Burma and the Chinese prov- 
ince of Yunnan, and apparently in a sizeable population. It also enabled the first study 
of the female genitalia of this species and now allows a more detailed comparison with 
other members of the Tagoropsis group of Urotini. Such a study and a phylogenetic 
analysis of the group, using both morphological and molecular data, are currently in 
progress (Rougerie, in preparation) and intend to clarify the relationships and taxo- 
nomic position of this extraordinary species, as well as the presumed paraphyly of 
Maltagorea. 

As already pointed out by Nässig & Oberprieler (1994), the occurrence of this 
single species of the otherwise wholly Afrotropical tribe Urotini in south-east Asia has 
considerable biogeographical implications. Reconstructing the evolutionary history 
and biogeography of S. malaisei is, however, dependent on a rigorous phylogenetic 
analysis of its relationships within the Urotini. Nässig & Oberprieler (1994) preferred 
a vicariant hypothesis of the ancestor of S. malaisei drifting to Asia on the Indian 
subplate after the cretaceous break-up of eastern Gondwana, over a dispersal hypoth- 
esis of colonisation by long-distance flight or migration within a formerly more exten- 



Nota lepid. 25 (4), published 2003: 227-233 233 

sive (forest) habitat. Clarification of whether Sinobirma is most closely related to a 
Madagascar member of Urotini {Maltagorea or part of it) or a continental African one 
{Pseudantheraea or Tagoropsis) will significantly increase our understanding of the 
evolutionary history of not only S. malaisei and the Urotini but also the subfamily 
Saturniinae. 



Acknowledgements 

I am very grateful to Thierry Deuve of the Muséum national d'Histoire naturelle (MNHN, Paris) and 
Tian Mingyi of the Chinese Agricultural University of Canton for their dedicated support of my 'quest' 
for Sinobirma in China. Joël Minet (MNHN, Paris), Rolf Oberprieler (CSIRO, Canberra, Australia), 
Wolfgang Nässig (Senckenberg-Museum, Frankfurt am Main, Germany), Kirby Wolfe (Escondido, Cali- 
fornia), and an anonymous reviewer provided valuable comments and corrections to the manuscript. I 
also wish to thank Alain Dubois (MNHN, Paris) for his help in obtaining a grant for our expedition. This 
paper is publication n° xx of the "Programme Pluriformation: Étude de la faune et de la flore de l'Asie 
du Sud-Est" of the MNHN [previous publication n° 75): David, P., Vogel, G. & N. Vidal 2003. On 
Trimer esurus fas ciatus (Boulenger, 1896) (Serpentes: Crotalidae), with a discussion on its relationships 
based on morphological and molecular data. - Raffles Bulletin of Zoology, 51 (1): 155-163]. 



Literature 

Balcazar-Lara, M. & K. L. Wolfe 1997. Cladistics of the Ceratocampinae (Lepidoptera: Saturniidae). - 

Tropical Lepid. 8 (Suppl. 2): 1-53. 
Bouvier, E.-L. 1928. Observations sur la structure et le classement des Saturniens d'Afrique. - Mém. 

Acad. Sei. 59 (4): 1-42. 
Bouyer, T. 1993. Maltagorea n. gen., un nouveau genre de Saturniidae malgache (Lepidoptera: Saturniidae, 

Saturniinae, Pseudapheliini). - Lambillionea 93: 97-102. 
Bryk, F. 1944. Entomological results from the Swedish expedition 1934 to Burma and British India. 

Lepidoptera: Saturniidae, Bombycidae, Eupterotidae, Uraniidae, Epiplemidae and Sphingidae. -Ark. 

förZool. 35(A)8: 1-55. 
Griveaud, P. 1962. Insectes, Lépidoptères Eupterotidae et Attacidae. - Faune de Madagascar 14: 1-64. 

12 pis. 
Kitching, I. J. (2002) The phylogenetic relationships of Morgan's Sphinx, Xanthopan morganii (Wal- 
ker), the tribe Acherontiini, and allied long-tongued hawkmoths (Lepidoptera: Sphingidae, 

Sphinginae). - Zool. J. Linn. Soc. 135: 471-527. 
Klots, A. B. 1970. Lepidoptera. Pp. 115-130 in: S.L. Tuxen (ed.), Taxonomist's glossary of genitalia in 

insects. - Munksgaard, Copenhagen. 
Lemaire, C. 1978. Les Attacidae Américains: Attacinae. Neuilly-sur-Seinc. 238 pp., 49 pis. 
Michener, C. D. 1 952. The Saturniidae (Lepidoptera) of the western hemisphere: morphology, phylogeny, 

and classification. - Bull. Amer. Mus. Nat. Hist. 98: 335-501, 1 pi. 
Nässig, W. A. & R. G Oberprieler 1994. Notes on the systematic position of Sinobirma malaisei (Bryk 

1944) and the genera Tagoropsis, Maltagorea, and Pseudantheraea (Lepidoptera, Saturniidae: 

Saturniinae, Pseudapheliini). - Nachr. ent. Ver. Apollo, Frankfurt, N. F. 15: 369 382. 
Oberprieler, R. G. 1997. Classification of the African Saturniidae (Lepidoptera) the quest lor natural 

groups and relationships. - Metamorphosis. J. Lepid. Soc. Air., Occ. Suppl. 3: 142 155. 
Scoble, M. J. 1992. The Lepidoptera: form, function and diversity. - Oxford Unix Press, Oxford, xi * 

404 pp., 4 pis. 



9^4 

*">^ Book review 

Book Review 

Ernestino Maravalhas (ed.): As borboletas de Portugal [in Portuguese], viii + 455 pp. Dis- 
tributed by Apollo Books, Stenstrup (Denmark). 2003. Price: DKK 320.00 (= approx. € 40.00) 
plus postage. ISBN 972-9603 1-9-7. 

Butterfly books are now available for most regions and countries in the world. They range in 
scope from popular picture books designed for nature lovers to scientific monographs of re- 
gional faunas. Now a new butterfly book on the fauna of Portugal is on the European market. 
Written mostly by E. Maravalhas, contributions come also from a variety of other authors. The 
book starts with a series of introductory chapters, e.g. on arthropods in general, on the evolu- 
tion, life-cycles, and natural enemies of butterflies, on habitats, conservation or migration, but 
also on methods for the study of butterflies (monitoring, mapping, population genetics). These 
chapters are useful for readers who are not (yet) familiar with entomology. The main part of 
the book are the richly illustrated species accounts (one page per species), separately presented 
for the mainland Portuguese fauna and the Macaronesian islands. Twenty-seven colour plates 
of set specimens facilitate identification. Various indexes, a references list, a glossary, and 
English translations of figure captions complete the book. The full text is also available on the 
web http//www. tagis.net for download and translation. A fair rating of the book against the 
many other available books on European butterflies requires to consider the particular reader- 
ship which the authors aimed to address. For certain, the book will find many readers among 
Portuguese nature lovers, and it deserves to be used by all organizations and authorities con- 
cerned with nature conservation in that country or in neighbouring Spain. However, the book 
will be of only marginal interest to a wider international audience. The use of Portuguese 
language does not seem to be a major obstacle, since brief English abstracts are provided to all 
chapters (although one might have wished these to be somewhat more extensive and present- 
ing more data). The colour plates do not reach the high standards the butterfly community is 
now used to, and occasionally very worn specimens are depicted (this does not facilitate safe 
identification). While many illustrations in the species accounts are excellent, quite a number 
are suspect of showing anaesthetised (if not killed) specimens in 'pseudo-natural' positions. 
The maps provide schematic sketches of distributions in Portugal (as opposed to dot maps of 
true records). While such schematic maps may still be informative, point or grid maps are 
much more valuable for all those who wish to use distributional data for subsequent analyses. 
Quite a number of hostplant affiliations seem to be simply perpetuated from earlier literature 
without critical re-evaluation, and some are suspect of being wrong. To give but one example, 
I am unaware of any populations of the lycaenid butterfly Polyommatus bellargus feeding on 
Trifolium species. A number of citations in the text did not lead me to a reference in the biblio- 
graphic list. Overall, the book leaves a mixed impression. For butterfly enthusiasts or decision 
makers from the Iberian Peninsula this will be a valuable source of information. From a more 
international perspective, probably only few lepidopterists with special interest in the Iberian 
fauna will find this volume to be of sufficient interest, since there is rather little information to 
be gained in comparison to other recent books on European butterflies. 

Konrad Fiedler 



Nota lepid. 25 (4), published 2003: 235-247 235 

The subspecific status of Pi'eris napj (Pieridae) within the 
British Isles 

Andrea Wilcockson & Timothy G. Shreeve 

School of Biological and Molecular Sciences, Oxford Brookes University, Headington, 
Oxford 0X3 OBP, UK e-mail: andreawilcockson@yahoo.co.uk 



Summary. Previously, Pieris napi (Linnaeus, 1758) within the British Isles has been divided into differ- 
ent subspecies and also separated from mainland European populations on the basis of androconial and 
wing morphology variation. Using image analysis we obtained quantitative data on androconial scale 
shape measurements and wing morphology characters (size and colour pattern elements) of P. napi from 
the British Isles and France (wing morphology only) to examine the subspecific status of P. napi within 
the British Isles. Androconia are variable in shape but this variation is normally distributed. There is no 
basis for describing different scale types within the British Isles. Variation within populations in Scot- 
land and southern England is greater than between regions and there is no basis for using androconial 
measures to describe Scottish specimens as subspecies. Wing size, shape and colouration are variable 
within populations and variation in particular characters is not consistent between generations or geo- 
graphic regions. Wing morphology is a poor taxonomic tool for describing regional forms. We conclude 
that there is no evidence to divide P. napi in the British Isles into subspecies or to differentiate populations 
in the British Isles from mainland Europe. 

Key words. Lepidoptera, Pieridae, taxonomy, biogeography, British Isles, androconia, morphology, 
image analysis, Pieris napi. 



Introduction 

Morphological variation within species can be a response to current selection proc- 
esses and/or the result of historic patterns of range changes and past patterns of isola- 
tion and divergence. Assessments of the effects of selective processes in different loca- 
tions and biogeographic inference require reliable and quantitative estimates of trait 
variation at the morphological and/or genetic levels. 

The Pieris napi (Linnaeus, 1758) complex has a number of different geographic 
forms within its Holarctic distribution (Geiger & Shapiro 1 992). Within the Palaearctic, 
P. napi and closely related species are widespread. P. napi is seasonally and geographi- 
cally variable and there is considerable confusion and uncertainty about the taxonomic 
status of most geographic forms, including specific and subspecific divisions. Within 
the British Isles the nominate species, P. napi napi, is described as absent (Emmet 
1989) and three subspecies have been named: sabellicae (Stephens. 1 827), type local- 
ity England, which is described as occurring within southern and northern Britain; 
britannica (Müller & Kautz, 1939), type locality Ireland, in Ireland and Scotland, and 
thomsoni (Warren, 1968), type locality Dunblane, in Scotland. Originally the basis for 
the separation of sabellicae and britannica from each other and from the nominate 
species was on differences of wing shape, colour and pattern expression and, in the 
case of thomsoni, on androconial variation. Warren ( 1961, 1968) originally described 
Scottish P. napi as having four androconial scale types but Thomson (1970. 1980) 
identified two further scale types in Scottish populations and only one in specimens 
from southern England. The occurrence of different scale types and a comparison with 

! Nota lepidopterotogica. 16.06.2003. ISSN 0342-7536 



236 



WiLCOCKSON & Shreeve: Pieris napi within the British Isles 



androconia from other geographic regions led Warren (1968) and Thompson (1980) to 
conclude that Scottish populations were more similar to P. napi adalwinda (Fruhstorfer, 
1909), type locality Finnmark, with a distribution north of 65°N in Fennoscandia. Sub- 
sequently Bowden (1983) identified Irish specimens as having androconial scale types 
similar to those of thomsoni. 

Described morphological and androconial variation has been used as supporting 
evidence for a double invasion of Pieris napi into the British Isles during the Holocene 
(Dennis 1977). According to him, early arriving (15,000-13,000 years BP), cold toler- 
ant P. napi survived the Younger Dryas and spread northward with warming at the 
beginning of the Holocene (11,500 years BP to present), but were replaced by P. napi 
from more southerly locations in southern Britain. It was also suggested that if two 
forms exist there has been interbreeding, providing a mosaic of populations in Scot- 
land (Dennis 1977; Bowden 1983). 

Studies of allozymes from P. napi in Scotland and northern England reveal non- 
equilibrium in respect to gene flow and genetic drift (Porter & Geiger, 1995). This has 
been interpreted as the result of secondary contact between a northern population group 
and more recently invading populations, consistent with the hypothesis of Dennis (1977), 
or genetic isolation within population sets within northern parts of the British Isles. 

The morphological variation which has been used to elevate regional populations 
to subspecific status has been on the basis of comparing relatively few individuals 
from a species which is known to display within-population variation, some of which 
is related to the rate of pupal development (Thompson 1947) and thus temperature. 
There has also, in the case of britannica, been an emphasis on the yellow ground 
colour revealed by breeding experiments to be the product of more than one recessive 
allele also present in other parts of the British Isles (Emmet 1989). Described androconial 
variation has either been qualitative or when quantitative, based on visual examination 
(Bowden 1983) and not subject to statistical analysis. Using limited qualitative data is 
poor taxonomic practice to employ in such a variable species. Here, we use a quantita- 
tive analysis of morphological and androconial variation of P. napi to provide a reas- 
sessment of its status in the British Isles. 



Methods 

Androconial measurements. Neither Warren (1968), Thomson (1970, 
1980) or Bowden (1983) provided any information about the wing area, which they 
removed androconia from (they just stated that these were taken from the upper sur- 
face), or used any quantifiable criteria to define 'scale types'. Assessment of scale 
types was based on visual inspection, but from published illustrations the main differ- 
ence between types is on the basis of shape, principally scale length and width, espe- 
cially midway between the base and apex. Bowden (1983) also stated that some scale 
types could occur at low frequency (2-3 %) within any individual. We use a quantita- 
tive approach using individuals from eight Scottish and six southern British sampling 
locations (Table 1). Preliminary observations confirmed the presence of androconia 
over the whole of the fore and hind wing upper surfaces, with more on the forewing. 



Nota lepid. 25 (4), published 2003: 235-247 



237 



Tab. 1. Sampling locations and sample sizes of individuals of Pieris napi used for androconial and wing 
morphology measurements 





Location 


Coordinates 


Sampling 


Androconial 


Morphology sample 








date 


sample (N) 






Scotland 










Males 


Females 


Spring 


Loch Aline 


NM702473 


05/1998 


10 








Breacleit 


NB155376 


05/2001 




20 


20 


Summer 


Loch Aline 


NM702473 


07/1996 


1 








Glen Lonan 


NM938280 


07/1996 


2 








Glen Achulish 


NN045583 


07/1996 


2 








Barcaldine 


NM962411 


07/1996 


2 








Sneils 


NM998577 


07/1996 


1 








Glas Drum 


NN009461 


07/1996 


1 








Ford 


NN023788 


07/1996 


1 








Breacleit 


NB155376 


07/1996 
07/2000 


1 


20 


20 


Southern 


England 












Spring 


Long Crendon 


SP6839093 


05/2000 




5 






Shotover 


SP566058 


05/2000 






1 




Lye Valley 


SP549060 


05/2000 




15 


13 


Summer 


Shotover 


SP566058 


08/2000 & 


4 


13 


11 








2001 


2 


10 


10 




Lye Valley 


SP549060 


08/2000 & 
2001 


1 
1 








Loosley Row 


SP816011 


07/1996 


2 








Cothill Fen 


SU465996 


08/1999 










Buckfastleigh 


SX7366 


08/1996 








Southern 


France 












Summer 


St. Andeol 


44°45'N 
05°22'E 


06/1999 




12 


10 




Gumaine 


44°45'N 
05°22'E 


06/1999 




2 


1 




Menée 


44°45'N 
05°22'E 


06/1999 




9 


1 




Bois de Tauligan 


44°45'N 
05°22'E 


06/1999 






11 



1 National Grid Reference for the British Isles; latitude and longitude in France 

Using a fine paintbrush, scales were removed from the cell of the upper forewing and 
then gently tapped onto a microscope slide. This was done separately for 10 males 
from each sampling location. These were then examined using a Zeiss™ bifocal mi- 
croscope at 200-fold magnification. Images of the first 100 androconia from each indi- 
vidual which were flat were then captured using a digital camera (JVC KY-F55B) 
attached to a frame grabber (Imaging Technology IC-PCI) and stored for subsequent 
analysis using OPTIMAS™ (v.6.0) imaging software. Measurements of length, mid- 
width and neck width were taken for each androconial scale. From these, three shape 
describing variables were calculated; length/mid-width ratio, length/neck-width ratio 
and mid-scale/neck-width ratio. In addition, forewing length from the wing base to 
apex was also measured using the same camera, framegrabber and software. All meas- 
urements were made in calibrated measurements and exported to Statistica version 5.5 
(Statsoft 1999) for subsequent analysis. Repeated measures for all variables gave a 



^" WiLCOCKSON & Shreeve: Pieris napi within th e British Isles 

reliability of 95%. Populations and generations were compared using MANOVA 
(multivariate analysis of variance) using all androconial scale variables. The test sta- 
tistic Wilk's X (determinant of the within groups variance/covariance matrix over the 
determinant of the total variance/covariance matrix) was used to compare between and 
within region/generation variation. Wilk's X scales from (perfect discrimination) to 1 
(no discrimination). Regional and seasonal variation is visualised using non-metric 
multidimensional scaling of an individual x individual matrix of Spearman rank corre- 
lation coefficients produced from values of (neck-width x mid-width)/length for all 
androconia measured from single individuals. 

Wing colour and pattern. Digital colour images were captured of both 
surfaces of wings removed from adults from first and second generation adults from 
Scottish and southern English locations and second generation individuals from French 
locations (Table 1). Previous distinctions between different named subspecies have 
been on the basis of the intensity of yellow ground colour and vein colouration (black/ 
grey/green) of the hindwing lower surface; the intensity and area of basal area 
melanisation of forewing and hindwing upper surfaces and wing sizes and shapes of 
both sexes (Stephens 1827; Verity 1916; Müller & Kautz 1939; Emmet 1989). Other 
distinctions have also been made for individual subspecies, such as the size and colour 
of postdiscal spots in female sabellicae. We took quantitative measurements of wing 
characteristics (Table 2) that have been described for all named subspecies within the 
British Isles. For image analysis, wings were illuminated with a Zeiss™ fibre optic 
ring light and captured and processed with the same camera and software used for 
androconial measures. All images were calibrated and repeat measures gave a reliabil- 
ity of at least 95%. Colour was measured in the red, green and blue planes. Each plane 
has a separate luminance value ranging from (none) to 255 (complete saturation). 
(Pure black = 0:0:0 and pure white =255:255:255). For the analysis of 'white/yellow' 
and black in this study, the threshold values of 200-235:200-225:157-195 for white/ 
yellow and 0-177:0-184:0-129 were applied. Mean luminance values of wing com- 
ponents in each of the thresholded bands for each colour were used in subsequent 
analyses. Because we randomly sampled from wild populations not all captured speci- 
mens were perfect and intact. Thus measurements of fore- and hindwing dorsal and 
ventral surfaces within populations were not all from the same individuals, with approx. 
5% being taken from different individuals. As field sampling was random and our 
analysis is primarily concerned with between population variation such an approach is 
justified. Wing morphology comparisons were made using ANOVA. 



Results 

Androconial variation. There was no relationship between the mean 
values of the three basic androconial measurements of length, neck width and mid- 
length width of any individual with wing area for any geographic or seasonal sample 
or for all samples (Table 3). Thus, all further analysis is of unsealed measurements. 
Within any region or brood, there is no evidence for multimodality in any measure. All 
variables are normally distributed (Kolmogorov-Smirnov tests, P>0.2 in all cases) in- 



Nota lepid. 25 (4), published 2003: 235-247 



239 



Tab. 2. The wing morphology characteristics used to quantitatively compare Pieris napi from Scotland, 
England and southern France and their use by previous authors to distinguish subspecies. 



Wing surface 



Wing character measured 



Previous use in describing subspecies 



Fore and hindwing 



Hindwing ventral surface 



Forewing dorsal surface 



Hindwing dorsal surface 



Wing area 

Area : perimeter length ratio 

Luminance of yellow 

colouration 

Proportion of wing yellow 

Melanisation of veins 

Extent of black scales over 

veins 

Brightness of white background 

colour 

Melanisation of veins 

Extent of black scales over 

veins 

Melanisation of basal area 

Brightness of white background 

colour 

Melanisation of veins 

Extent of black scales over 

veins 

Melanisation of basal area 



Used by Stephens (1827) to distinguish sabellicae 
from napi, the former described as having more 
angular wings 

Stephens (1827) and Verity (1916) describe sabellicae 
as yellower and more melanised than napi. Warren 
(1968) and Thomson (1970) describe a greater 
frequency of yellow forms in ihomsoni than sabellicae 



Stephens (1827) and Verity (1916) describe sabellicae 
as brighter than napi, with greater and more extensive 
melanisation; Müller & Kautz (1939) and Warren 
(1968) describe thomsoni as yellower and more 
melanised than sabellicae on forewing and hindwing 
dorsal surfaces 



Tab. 3. Androconial length, neck and mid-scale widths and ratios of widths to length and mid-scale to 
neck width ratios of specimens of Pieris napi from Scotland and southern England. All means are reported 
± 1 SD. N.S. - not significant (P > 0.05). 

Gl - first generation; G2 - second generation; r s - Spearman's rank correlation of individual mean 
measurement with forewing area; P - significance of r s 













Region anc 


generation 






Overall 






















relationship 






















with wing 






















area 








Scotland 






Southern England 








Androconial 


Gl 


r s 


P 


G2 


r s P 


Gl 


r s P G2 


l\ 


P 


P 


variable 






















Length 


0.092 


0.14 


N.S. 


0.092 


-0.32 N.S. 


0.093 


0.43 N.S. 0.092 


-0.08 


N.S. 


0.29 N.S. 


(mm) 


± 0.007 






±0.007 




±0.007 


±0.007 








Mid-scale 


0.029 


-0.28 


N.S. 


0.029 


0.32 N.S. 


0.02') 


0.09 N.S. 0.029 


0.25 


N.S. 


-0.25 N.S. 


width 


± 0.004 






±0.004 




±0.004 


±0.004 








(mm) 






















Neck width 


0.026 


-0.28 


N.S. 


0.026 


0.32 N.S. 


0.026 


0.05 N.S. 0.026 


0.25 


N.S. 


■0.19 N.S, 


(mm) 


± 0.004 






II (MM 







±0.004 








Length/mid- 


3.26 






3.25 




3.27 


3.27 








scale width 


±0.55 






±0.54 




±0.56 


±0.55 








ratio 






















Length/neck 


Î.61 






3.60 




3.63 


3.62 








width ratio 


±0.62 






±0.61 




±0.63 










Mid-scale/ 


1.11 






1.11 




LH 


1.11 








neck width 


±0.13 






±0.13 




±0. 1 3 










ratio 























240 



WiLCOCKSON & Shreeve: Pieris napi within the British Isles 



eluding the ratio of androconial length to mid-length width (Figure 1) and the ratio of 
width measurements, both of which are the most likely measures to categorise 
androconial scale type classes. Overall, there are no significant differences between 
the distributions of androconial scale dimensions from the Scottish and southern Eng- 
lish regions. 



280 

240 

200 

160 

120 

80 

40 





280 

240 

200 

160 

120 

80 

40 





Scotland spring 



El 



southern England spring 




280 

240 

200 

160 

120 

80 

40 





280 

240 

200 

160 

120 

80 

40 





Scotland summer 



El 



2.93 3.33 3.72 



southern England summer 



Fig. 1. Distributions of the ratios of androconial length to mid-width for spring and summer generations 
of Pieris napi from Scotland and southern England. 



MANOVA (multivariate analysis of variance) is used to examine within and be- 
tween region and season differences of androconial size and shape measures (Table 4). 
Within any region and season there are differences between individuals in androconial 
size and shape measures. For both Scotland and southern England there are greater 
differences between samples within a season than between seasons (Scotland, Wilk's 
X 0.77 versus 0.16 and 0.07; southern England Wilk's X 0.66 versus 0.10 and 0.12). In 
addition, differences between regions are no greater than within regions (Wilk's X 0.67 
versus 0.77 and 0.66). This is indicative of between individual variation exceeding 
between season or region variation. 

A two dimensional non-metric scaling plot derived from an individual x individual 
matrix of Spearman correlation coefficients produced from individual values of 
androconial neck-width x mid-width)/length reveals a lack of any underlying geo- 



Nota lepid. 25 (4), published 2003: 235-247 



241 



Tab. 4. MANOVA comparisons of within region and between region androconial variation, using all 
androconial scale variation measures. Sample sizes are 10 individuals from each region and 100 scales 
from each individual. 

Comparison Wilk's Rao's R P 

Lambda 

Scotland spring 0.16 95.3 <0.01 

Scotland summer 0.07 161.1 <0.01 

southern England spring 0.10 129.1 <0.01 

southern England summer 0.12 116.7 <0.01 

Scotland spring vs summer 0.77 193.2 <0.01 

England spring vs summer 0.66 339.0 <0.01 

Scotland vs southern England 0.67 195.6 <0.01 

Wilk's Lambda is the determinant of the within groups variance/covariance matrix over the determinant of the total 

variance/covariance matrix. It ranges from 0, perfect discrimination, to 1 , no discrimation. 

Rao's R is a transformed value of Wilk's Lambda to determine the significance of each effect. It follows the F-distribution. 

P - Significance of Rao's R. 

graphic or between-population structuring in androconial scale variation (Figure 2). 
No grouping of specimens on the basis of location is evident, dimensional distances 
between individuals from the same location are as large as those between individuals 
from different locations. 





1.4 








































S2 


S2 


















■ S1 


■ 


















S1 S2 " 
















1.0 




■ B 

S2 N1 
N2 - B 

B " N1 


S1 

■ 


N2 

■ 




N2 


















■ 








0.6 




S1 ■ 
■ 

S1 




S2 










CM 






S1 N1 B S2 




■ 










C 


0.2 




B ■ ■ 






N1 


N1 






o 








S1 




■ 


■ 






c 

0) 

E 






N1 N2 


■ 












-0.2 




B ■ 

N1 




S2 

■ 




N2 

■ 












S1 ■ 














Q 


-0.6 
-1.0 
-1.4 




■ S2 
N2 B 

B N2 

B N J 81 

■ S1 

■ 

N2 N2 

■ ■ 


N2 

■ 


N1 




























-1.6 


-1.0 -0.4 0.2 

Dimension 1 




0.8 






1.4 



Fig. 2. Two-dimensional non-metric scaling plot of Scottish (N) and southern English (S) androconial 
scales from first (1) and second (2) generations derived from an individual x individual Spearman corre- 
lation matrix derived from androconial length and width measurements. 



242 



WiLCOCKSON & Shreeve: Pieris napi within the British Isles 



Tab. 5. Mean wing morphology measures of Pieris napi from Scotland, southern England and southern 
France and statistical comparisons between generations within regions and between regions and 
generations. 



Variable 



FW area 
(mm 2 ) 

FW area: 
perimeter 
length ratio 



male 
female 

male 
female 



Scotland 



Gl 

209.2 ±20.1 

203.6 ±20.6 

3.5 ±0.2 

3.5 ±0.2 



G2 

215.0 ±22.0 
195.3 ±9.4 
3.6±0.1 
3.5±0.1 



southern England 



Gl 

182.6 ±21.5 

176.0 ±21.2 

3.3 ±0.2 

3.2 ±0.2 



G2 

218.5 ±23.0 

193.5 ±17.3 

3.6 ±0.2 

3.4 ±0.2 



southern 
France 

G2 

252.7 ±24.1 

242.9 ±14.0 

3.9 ±0.2 

3.9 ±0.1 



F&P 

(between region 
and generation) 



F(4,95) — 35.5 

PO.001 

F (4 ,88)=19.2P<0.001 

F(4.95) = 32.8 

PO.001 
F,4.88) = 42.4 

PO.001 



HW area 
(mm 2 ) 



male 
female 



226.3 ± 20.5 
213.7 ±22.4 



230.8 ±30.9 
212.6 ±17.5 



205.3 ± 19.8 
190.9 ±26.0 



233.4 ±15.4 
208.4 ±21.1 



250.8 ±24.5 
262.5 ± 33.6 



F(4,94) — 23.7 
PO.001 

F (4 ,88) = 22.9 
PO.001 



HW area: 
perimeter 
length ratio 



male 
female 



3.9 ±0.2 
3.8 ±0.2 



4.1 ±0.1 
3.8 ±0.1 



3.8 ±0.2 
3.6 ±0.3 



4.0 ±0.3 
3.8 ±0.2 



4.3 ±0.3 
4.2 ± 0.3 



= 20.3 PO.001 



HW ventral 

yellow 

luminance 



male 
female 



177.0 6.5 
174.Ö 4.1 



179.2 ±2.7 
175.4 ±1.2 



180.5 2.3 

180.6 3.4 



184.0 ±0.6 
180.7 ±2.8 



182.8 ±2:6 
180.7 ±2.9 



F (4 ,95)=11.3 PO.001 

F (4 ,87) = 23.3 
PO.001 



HW ventral 
surface 
proportion 
yellow 



male 
female 



0.22 ± 0.02 
0.16 ±0.03 



0.26 ±0.01 
0.13 ±0.03 



0.27 ± 0.02 
0.33 ±0.03 



0.33 ± 0.02 
0.54 ±0.03 



0.41 ±0.04 
0.63 ± 0.02 



F( 4 .96) = 10.7 
PO.001 



HW ventral 
surface vein 
melanisation 
(luminance) 



male 
female 



125.3 ±3.8 

122.4 ±3.6 



127.3 ±2.6 
122.5 ±3.1 



133.2 ±2.7 
129.1 ±2.9 



130.6 ±3.5 
126.8 ±3.2 



127.3 ±4.3 
127.6 ±4.3 



F(4,95) = 16.6 
PO.001 

F(4.87) = 6.6 
PO.001 



HW ventral 
proportion of 
wing covered 
by black 
scales 



male 
female 



0.59 ±0.05 
0.53 ± 0.09 



0.52 ±0.07 
0.46 ±0.10 



0.51 ±0.04 
0.49 ± 0.06 



0.36 ±0.13 
0.23 ±0.81 



0.13 ±0.08 
0.07 ± 0.03 



F (4 ,95)= 106.9 

PO.001 



FW dorsal 

white 

luminance 



male 
female 



200.4 ± 7.7 

176.5 ±60.3 



199.0 ±0.5 
179.9 ±61.5 



199.0 ±0.5 
200.2 ± 0.8 



198.9 ±4.4 
199.5 ±0.7 



199.0 ±0.5 
200.2 ± 0.5 



F (4 .95)=1.73 
P>0.05 

F(4,88) = 1-7 

P>0.05 



FW dorsal 
vein 

melanisation 
(luminance) 



male 
female 



125.9 ±6.1 
113.1 ±19.5 



136.1 ±3.4 
134.4 ±3.8 



135.9 ±4.7 
131.9±4.8 



137.7 ±3.3 

134.8 ±6.0 



141.8 ±3.8 
138.8 4.7 



F(4,95) - 37.8 
PO.001 

F(4,88) = 15.5 

PO.001 



FW dorsal 
proportion of 
wing covered 
by black 
scales 



male 
female 



0.08 ±0.01 
0.12 ±0.01 



0.07 ±0.01 
0.11 ±0.01 



0.08 ±0.01 
0.11 ±0.01 



0.07 ±0.01 
0.10 ±0.01 



0.11 ±0.01 
0.09 ±0.01 



F(4,95) -1.1 

P>0.05 

F(4,88) = 14.7 

PO.001 



FW basal area 

melanisation 

(luminance) 



male 
female 



125.2 ±5.0 
113.2 ±19.0 



136.3 ±3.4 
133.2 ±4.5 



135.7 ±4.4 
131.9±4.8 



138.0 ±3.3 
135.0 ±5.9 



141.7 ±3.6 
139.0 ±4.5 



F (4 ,95)=48.0 

PO.001 

F(4,88) = 20.6 

PO.001 



Nota lepid. 25 (4), published 2003: 235-247 



243 



Continued Tab. 


5. 














HW dorsal 


male 


195.1 ±3.7 


197.3 ±0.8 


197.1 ±0.4 


197.6 1.0 


198.6 ±0.6 


F(4.95) = 8.94 


white 
luminance 


female 


195.8 ±3.3 


198.6±1.7 


199.2 ±0.6 


197.6 ±0.8 


200.0 ±0.9 


P<0.001 

F(4,88) =12.1 

PO.OOl 


HW dorsal 


male 


134.0±6.1 


141.1 ±3.2 


139.3 ± 3.1 


141.4±2.3 


141.2 ±3.0 


F ( 4.95,= H.25 


vein 
melanisation 


female 


139.8 ±3.9 


140.5 ±2.6 


140.1 ±4.6 


141.6±2.5 


138.8 ±3.2 


PO.001 

F(4,88) = 2.02 

P>0.05 


(luminance) 
















HW dorsal 


male 


0.19 ±0.08 


0.17 ±0.03 


0.15 ±0.02 


0.11 ±0.03 


0.08 ±0.03 


F,4.9j)= 18.75 " 


proportion of 
wing covered 
by black 


female 


0.39 ±0.18 


0.32 ±0.08 


0.31 ±0.12 


0.15 ±0.04 


0.07 ±0.03 


P< 0.001 

F(4,88) = 32.5 

PO.OOl 


scales 
















HW dorsal 


male 


125.2 ±5.7 


137.3 ±3.4 


135.1 ±3.9 


145.1 ±17.3 


140.2 ±3.3 


F (4 ,94)= 14.6 


basal area 
melanisation 


female 


130.4 ±4.8 


137.9±3.1 


136.7 ±3.46 


139.7 ±3.5 


137.1 ±3.8 


P<0.00\ 

F (4 ,88)=17.5 

PO.001 


(luminance) 

















Wing morphology variables are normally distributed and their variation is summarised 
in Table 5. (All comparisons are supported by LSD post-hoc tests, P < 0.05). Within 
any region there is some seasonal variation in characteristics but seasonal variation is 
not consistent between regions, or between sexes within regions. Males are smaller 
(forewing and hindwing) in the first generation compared to the second in Scotland 
and in southern England. For females, seasonal size variation is more complex. In 
Scotland they are smaller in the second generation, but in southern England they are 
larger in the second generation. Second generation individuals also have more rounded 
wings (area/perimeter ratios) than those of the first. First generation individuals of 
both sexes have darker melanised basal wing areas on the upper wing surfaces than 
second generation individuals in Scotland, but not in southern England where this 
difference is restricted to females only. Upper wing surfaces are brighter in the first 
than second generation in both Scotland and England. Upper surface melanisation, 
excluding basal melanisation, is greater in the first generation in Scotland and only on 
the hindwing for males in the first generation in southern England. The extent of dark 
scales on the dorsal surfaces is greater in the first generation in both Scotland and 
southern England for both sexes. Some individuals had yellow suffusion on the ventral 
hindwing. For both sexes in Scotland and for females in southern England there were 
no seasonal differences in either the intensity of yellow or its extent. Males from southern 
England had more extensive and darker yellow underside colouration in the second gen- 
eration than the first. In both regions and sexes the veins on the hindwing underside were 
more heavily melanised in the spring than the summer in both intensity and extent. 

Comparisons including the French samples are more complex. Within males, first 
generation individuals differ between regions in size, but second generation males do 



^^ WiLCOCKSON & Shreeve: Pier is napi within the Britis h Isles 

not differ in size between Scotland and southern England but are larger in southern 
France. Females of the first generation are larger in Scotland than southern England. In 
the second generation they are the largest in France and the smallest in southern Eng- 
land. Females of the second generation from southern England do not differ in either 
forewing or hindwing shape from females from France but those from the first genera- 
tion do. There are also no significant differences in shape between females from Scot- 
land and from southern England for either generation. In contrast, males differ in shape 
between the regions in spring, and in summer between Scotland and southern England 
but not between southern England and France. Dorsal basal wing area melanisation is 
darker in first generation males and females in southern England than in Scotland. 
This characteristic does not differ between Scotland, southern England and southern 
France in the second generation. The ventral ground colour of both males and females 
is brighter yellow in the first generation in Scotland than in southern England but there 
are no significant differences in this characteristic in males between the three regions 
in the second generation. The ventral hindwing of second generation females is brighter 
yellow in Scotland than elsewhere but does not differ between southern England and 
southern France. In both generations the darkness of the wing venation of the ventral 
hindwing of both sexes does not differ between regions, but the dark scales surround- 
ing the veins are the most extensive in Scotland and the least extensive in southern 
France. In the first generation in Scotland the yellow ground colour of both sexes and 
female dorsal basal melanisation is more variable than in any other region or generation. 
Regional and seasonal comparisons reveal an overall pattern of variability and a 
lack of consistency in the way individual characteristics vary. 

Discussion 

Our quantitative findings on androconial and wing morphology variation within 
the British Isles are not consistent with earlier work (e.g., Stephens 1827; Verily 1916; 
Müller & Kautz 1939; Warren 1961, 1986; Thomson 1970, 1980). The only consistent 
finding between our measures of androconia and previous ones is the lack of a rela- 
tionship between forewing size and androconial scale size (Warren 1961). All the meas- 
ures of androconial shape we have made are normally distributed and variation within 
Scottish samples is no greater than in southern Britain. This is not consistent with the 
scale type of southern Britain being monomorphic, and Scottish specimens having 
four or six distinct types (Warren 1961, 1968; Thomson 1970, 1980). Bowden (1983) 
described different scale types from different regions of the British Isles, raising doubts 
about the validity of any distinction between populations from Scotland and elsewhere. 
In particular the named subspecies britannica was described as having thomsoni type 
androconial scales. Bowden (1983) never conducted a statistical analysis of his cat- 
egorical data. Such an analysis reveals that there is no significant difference between 
the frequencies of scale types in different regions (G = 10.50; df = 15; P > 0.05) al- 
though such a comparison is not valid because according to our data distinct scale 
types do not exist. Even if distinct types cannot be identified using quantitative meas- 
ures, the possibility of differences between the distributions of androconial shape 



Nota lepid. 25 (4), published 2003: 235-247 245 

descriptors could exist if there was a distinction between regional types. Our analysis 
is not consistent with this hypothesis and there is no regional separation on the basis of 
androconial variation. 

Quantification of wing morphological characteristics reveals a pattern that is far 
more complex than previously described. Separation of regional forms in a quantita- 
tive analysis is not consistent between generations. When quantified, variation of the 
characteristics that have been previously used to describe subspecies, including the 
separation of sabellicae in southern England from napi in mainland Europe, is not 
consistent with previous work. Those individual wing characteristics that have been 
used to describe subspecies do not vary between seasons or between regions in a con- 
sistent fashion. For example ventral ground colour, basal melanisation and vein 
colouration have been used to differentiate the nominal subspecies sabellicae from 
napi, and thomsoni and britannica from sabellicae (Stephens 1827; Verity 1916; Müller 
& Kautz 1939; Emmet 1989). Patterns of variation in these characteristics are not 
consistent between generations and when quantified, differences in one (basal 
melanisation) are the reverse of that which has previously been described. Whilst 
multivariate analysis shows some pattern in the differentiation of seasonal and re- 
gional forms of both sexes, there is also overlap in the morphology of regional forms. 
If regional separation of forms is possible, it has to be restricted to overall tendencies 
in individual characteristics but these characteristics are not necessarily correlated in 
how they vary, either with season or region. 

The wing morphology of Pier is napi is recognised as being variable within regions 
and influenced by environmental conditions experienced in the pupal stage (Thompson 
1947). The results presented here indicate that wing morphology characteristics, or at 
least those which have been used previously, lack the stability that would be required to 
use them to differentiate regional forms. Perhaps the most revealing result to emerge 
from this analysis is that some characteristics, especially size, yellow underside ground 
colouration and basal melanism are variable, and the most variable in northern populations. 
In P. napi these characteristics are of potential importance to thermoregulation, crypsis 
and flight performance (Wilcockson 2002). For example, reduced basal melanisation of 
southern French P. napi in comparison to the British Isles is consistent with an emphasis 
on thermal constraints on activity whilst small size in first generation and northern areas 
may facilitate rapid warming and maximise activity in cool conditions. A large size in 
southern France may also be consistent with reduced thermal constraints in wanner ar- 
eas. Variability may be the result of a lack of directional selection in environments that 
vary in weather over short time scales. Thus, the greater variation within north-western 
populations may be explained by consistent within-season weather variation, which is 
more extreme than elsewhere. Whilst wing morphology variation does not resolve issues 
about levels of regional differentiation, controlled studies of reaction norms would re- 
veal much about responses to selection on individual wing elements in variable environ- 
ments. A more comprehensive analysis using more wing characteristics reveals the same 
pattern of variability as demonstrated here (Wilcockson 2002). 

On the basis of androconial and wing morphology variation there seems to be little 
evidence for making any distinction between regional forms of Pieris napi in the Brit- 



^^■O WiLCOCKSON & Shreeve: Pieris napi within the British Isles 

ish Isles. Furthermore there seems to be little basis for making any distinction between 
forms on the European mainland and the British Isles. Porter & Geiger (1995) exam- 
ined ¥ st values derived from nine loci using populations throughout Europe, including 
Scotland and northern England. Their analysis revealed non-equilibrium amongst 
populations in the British Isles, which they attributed to either mixing of different 
forms or differences in local selection. Their analysis was designed to examine infer- 
ences of gene flow at different geographic scales, not specifically phylogenetic differ- 
entiation. But allozyme data has shown that many of the taxa in the Pieris napi com- 
plex lack a genetic justification. The use of such enzymes as markers for revealing 
phylogeography in a species in which there is likely to be considerable mobility (Por- 
ter & Geiger 1995; Asher et. al. 2001), and which is possibly subject to different re- 
gional and local selection gradients, is unlikely to be conclusive. Whilst we are aware 
of arguments about the neutrality of allozymes we emphasise that at least one (PGI) is 
subject to selection in relation to thermal requirements in one other pierid butterfly 
(Kingsolver & Watt, 1984), and other commonly used allozymes are also involved in 
metabolic processes that could be under selection. 

We conclude that on the basis of androconial and wing morphology characteristics 
there is no justification for raising any geographic forms within the British Isles to 
subspecific status. Direct evidence for any specific invasion sequence is also lacking 
and is unlikely to be obtained from allozyme data. Studies using the mitochondrial 
genome based on appropriate markers (microsatellites, RFLPs) are needed. Our stud- 
ies of wing morphology also reveal that there is regional overlap, but within regions 
variation is greater in northern areas than elsewhere. 



Acknowledgements 

Andrea Wilcockson was funded by a School of Biological and Molecular Sciences, Oxford Brookes 
University, studentship. We thank two anonymous referees for their valuable comments. 



References 

Asher, J., Warren, M, Fox, R., Harding, P., Jeffcoate, G & Jeffcoate, S. 2001. The millenium atlas of 

butterflies on Britain and Ireland. - Oxford University Press, Oxford. 433 pp. 
Bowden, S. R. 1983. Androconial scales and Scottish Artogeia napi. - Entomol. Gaz. 34: 237-245. 
Dennis, R. L. H. 1977. The British butterflies - their origin and establishment. - E.W.Classey, Faringdon. 

318 pp. 
Emmet, A. M. 1989. Pieris napi (L.). Pp. 107-1 11. -In: Emmet, A.M. & Heath, J. (eds.), The moths and 

butterflies of Great Britain and Ireland, Volume 7(1), Hesperiidae-Nymphalidae, The butterflies. - 

Harley Books, Colchester. 
Geiger, H. & Shapiro, A. M. 1992. Genetics and evolution of holarctic Pieris napi species group 

populations (Lepidoptera: Pieridae). -Z. Zool. Syst. Evol.-Forschg. 30: 100-122. 
Kingsolver, J. G & Watt, W. B. 1984. Mechanistic constraints and optimality models: thermoregulatory 

strategies in Colias butterflies. - Ecology 65: 1835-1839. 
Müller, L. & Kautz, I. H. 1939. Pieris bryoniae Ochs, und Pieris napi L. - Österr. Entomolgen-Ver. 

Wien, 16+191 pp., 16 plates. 
Porter, A. H. & Geiger, H. 1995. Limitations to the inference of gene flow at regional geographic scales 

- an example from the Pieris napi group (Lepidoptera: Pieridae) in Europe. - Biol. J. Linn. Soc. 54: 

329-348. 



Nota lepid. 25 (4), published 2003: 235-247 247 

Statsoft, 1999. STATISTICA for Windows. - Statsoft Inc., Tulsa, Oklahoma. 4022 pp. 

Stephens, J. F. 1827. Illustrations of British entomology; or, a synopsis of indigenous insects: containing 

their generic and specific distinctions: with an account of their metamorphoses, times of appearance, 

localities, food, and economy. Haustellata, Volume 1 . - Baldwin & Cradock, London. 
Thomson, G. 1970. The distribution and nature of Pieris napi thomsoni Warren (Lep.: Pieridae). - Ent. 

Rec. J. Var. 82, 255-261. 
Thompson, J. A. 1947. Some preliminary observations on Pieris napi (L.). - Proc. Trans. S. Lond. 

Entomol. Nat. Hist. Soc. 1947: 115-122. 
Verity, R. 1916. The British races of butterflies: their relationship and nomenclature. - Ent. Rec. J. Var. 

28: 73-80. 
Warren, B. C. S. 1961. The androconial scales and their bearing on the question of speciation in the 

genus Pieris. — Entomol. Tidskr. 82: 121-148. 
Warren, B. C. S. 1968. On an instable race of Pieris adalwinda, located in Scotland. - Ent. Rec. J. Var. 

80: 299-302. 
Wilcockson, A. 2002. The functional significance of wing morphology in Pieris napi. - PhD thesis, 

Oxford Brookes University, Oxford. 346 pp. 



248 



Book review 



Book Review 

Hellmann, F., Brockmann, E. & Kristal, Ph. M.: I Macrolepidotteri della Valle d'Aosta. 
17 x 24 cm, 284 p., 1 color plate, 2 maps, hardback, 1999. Museo Regionale di Scienze 
Naturali, I- 11010 Saint-Pierre (Aosta), Italy. Price and ISBN not available. 

In this publication, the studies of various researchers on the macrolepidopterous fauna of the 
Aosta Valley are summarized. Only very few older publications contain faunistic data on the 
Lepidoptera of this region and only during the past 50 years has the study been intensified, e.g. 
by installing permanent light traps. No less than 1141 different species have been recorded 
from this single northwest Italian valley. This high species richness is due to the great variety 
of habitats which are distributed vertically from 315 to 4807 m. The average altitude of the 
region amounts to 2106 m and the area measures 3262 km 2 . The introductory part of the book 
starts with general data about the geology, climate and vegetation of the Aosta Valley. This 
brief explanation is followed by some lists of interesting species, arranged according to different 
criteria. The first list contains four endemic species (all figured in color), the second six species 
new to the Italian fauna and the last one contains species which are remarkable for their 
distribution in the southern Alps. At the end of the introduction, an ecological and chorological 
analysis of the moth fauna is given, as well as an explanation of the used material and methods. 
The main part of the book consists of the systematic list of observed species with data on their 
occurrence in the Aosta Valley, their general distribution and a list of all localities in the valley 
where the species have been observed. The book ends with a reference list and an alphabetic 
index. It is well, though not luxuriously published and can serve as an information source for 
the students of European and especially alpine moth faunistics. 

Willy De Prins 



Nota lepid. 25 (4), published 2003: 249-250 249 

Short Communication 

First observation of one Maculinea arion pupa in a Myrmica 
lobicornis nest in Poland 

Marcin Sielezniew 1 , Anna Stankiewicz 2 & Cezary Bystrowski 3 

1 Warsaw Agriculture University, Department of Applied Entomology, Nowoursynowska 166, PL-02- 
787 Warszawa, Poland (corresponding author; e-mail: sielezniew@alpha.sggw.waw.pl 

2 Museum and Institute of Zoology, Polish Academy of Sciences, Laboratory of Social and 
Myrmecophilous Insects, Wilcza 64, PL-00-679 Warszawa, Poland. 

3 Institute of Forestry Research, Department of Forest Protection, Sekocin Las, PL-05-090 Raszyn, 
Poland. 



Maculinea arion (Linnaeus, 1758) (Lycaenidae) is a fast declining species endan- 
gered in many European countries. In Poland M. arion has disappeared from the 
whole western part of the country within the last few decades (Buszko 1997). Cater- 
pillars feed initially in the flowerheads of Thymus or Origanum spp. (Lamiaceae), to 
complete development in Myrmica colonies preying on ant larvae. Although all 
Myrmica workers transport caterpillars to their nest, survival is high only with the 
main host ant species, My. sabuleti Meinert, 1861 (Thomas 1995). Habitat demands 
of M arion and its major host ant vary according to regional climate (Thomas et al. 
1998), but almost nothing is known in this respect from vast areas in Eastern Europe 
and Asia. 

In mid- June 2002 we therefore attempted to identify the habitat requirements of M 
arion in Poland more precisely. A survey, which coincided with the emergence of the 
first adults, was performed at Gugny (52°24'N/18°59'E) in the Biebrza National Park 
(NE Poland) on raised, sandy land surrounded by fens. Three neighbouring dry hills, 
regularly grazed by cattle and wild game, were covered by sparse trees (mainly oaks 
and some pines) and bushes. Thymus serpyllum, the host plant of M arion, was abun- 
dant almost everywhere in the turf and overgrew sandy places as well as parts of the 
site bordering on swamps. Areas within a radius of 2m around host plants were searched 
for Myrmica ants. All nests encountered were carefully inspected, progressing from 
the uppermost to the deepest chambers. Voucher samples (5-10 workers) were col- 
lected and identified in the laboratory according to Czechowski et al. (2002). 

A total number of 51 Myrmica nests were excavated and 5 species were recorded, 
the commonest being My. sabuleti (27 nests, 53%). Thirteen nests (25%) of My. 
scabrinodis Nylander, 1846, 6 (12%) of My. schencki Viereck, 1903, 3 (6%) of My. 
rubra (Linnaeus, 1 758) and 2 (4%) of My. lobicornis Nylander, 1 846, were also found. 
Only one M. arion pupa in a My. lobicornis nest was recorded, about 4 cm below 
ground level in a chamber with ant pupae. The nest was hidden in a tuft of grass and 
was situated in the lower (but sandy) place of the hill about 5 m away from the edge of 
the wet area. 

© Nota lepidopterologica. 16.06.2003. ISSN 0342-7536 



^JV SiELEZNiEW, Stankiewicz & Bystrowski: Maculinea arion pupa in Myrmica lobicornis nest 

My. lobicornis, preferring cooler habitats than My. sabuleti (Elmes et al. 1998), has 
never been noticed so far as a host of M arion or any Maculinea species (Wardlaw et 
al. 1998). Occasional individuals of the predacious Maculinea species survive in 'non- 
host' Myrmica colonies (Thomas & Elmes 1998). Hence, our finding does not allow to 
asses if My. lobicornis is a regular host ant of M arion on the investigated site. Appli- 
cation of a population model developed by Thomas (1995) rather suggests M. sabuleti 
being the main host here as well. Possibly, pupae in My. sabuleti nests were over- 
looked during the survey, if these were hidden deeper in the ground, below the cham- 
bers where ants were observed. Moreover nests parasitised by M. arion are often de- 
serted by ants and then invaded by neighbouring Myrmica colonies. The association of 
the single M. arion pupa with My. lobicornis could also have originated this way. 
Anyway, the unexpected finding reported here emphasizes the need for further studies 
on the host ant relationships of Maculinea butterflies, in particular in the more eastern 
parts of their distributional ranges. This seems to be vital for understanding the ecol- 
ogy and evolution of Maculinea, especially if we consider that this genus probably 
evolved in a steppe-like habitat in Asia (Fiedler 1998). 



Acknowledgements. We thank J. A. Thomas and K. Fiedler for constructive comments on an earlier 
manuscript draft. 



Literature 

Buszko, J. 1997. A distribution atlas of butterflies in Poland 1986-1995. - Torun, Turpress. 170 pp. 
Czechowski, W., A. Radchenko & W. Czechowska 2002. The ants (Hymenoptera, Formicidae) of Poland. 

- Warsaw, MIZ PAN. 200+1 pp. 
Elmes, G. W., J. A. Thomas, J. C. Wardlaw, M .E. Hochberg, R. T. Clarke & D. J. Simcox 1998. The 

ecology of Myrmica ants in relation to the conservation of Maculinea butterflies. - J. Insect Conserv. 

2: 67-78. 
Fiedler, K. 1998. Lycaenid-ant interactions of the Maculinea type: tracing their historical roots in a 

comparative framework. - J. Insect Conserv. 2: 3-14. 
Thomas J. A. 1995. The ecology and conservation of Maculinea arion and other European species of 

large blue butterfly. In: A. S. Pullin (ed.), Ecology and conservation of butterflies. - London, Chapman 

& Hall. Pp. 180-197. 
Thomas, J. A., G. W. Elmes, J. C. Wardlaw & M. Woyciechowski 1989. Host specificity among Maculinea 

butterflies in Myrmica ant nests. - Oecologia 79: 425^157. 
Thomas, J. A. & G. W. Elmes 1998. Higher productivity at the cost of increased host-specificity when 

Maculinea butterfly larvae exploit ant colonies through trophallaxis rather than by prédation. - Ecol. 

Entomol. 23: 457-464. 
Thomas, J. A., D. J. Simcox, J. C. Wardlaw, G. W. Elmes, M. E. Hochberg & R. T. Clarke 1998. Effects 

of latitude, altitude and climate on the habitat and conservation of the endangered butterfly Maculinea 

arion and its Myrmica ant hosts. - J. Insect Conserv. 2: 39-46. 
Wardlaw, J. C, G W Elmes & J. A. Thomas 1998. Techniques for studying Maculinea butterflies: II. 

Identification guide to Myrmica ants found on Maculinea sites in Europe. - J. Insect Conserv. 2: 

119-127. 



Nota lepid. 25 (4), published 2003: 25 1-263 25 1 

Comparison of the male genitalia and androconia of 
Pseudochazara anthelea acamanthis (Rebel, 1916) from Cy- 
prus, Pseudochazara anthelea anthelea (Hübner, 1824) from 
mainland Turkey and Pseudochazara anthelea amalthea 
(Frivaldsky, 1845) from mainland Greece (Nymphalidae, 
Satyrinae) 

Andrew Wakeham-Dawson 1 , Rob Parker 2 , Eddie John 3 & Roger L. H. 

Dennis 4 

1 The International Commission on Zoological Nomenclature, c/o The Natural History Museum, 
Cromwell Road, London, SW7 5BD, Great Britain (e-mail: andrw@nhm.ac.uk); corresponding 
author 

2 66 Cornfield Road, Bury St Edmunds, Suffolk, IP33 3BN, Great Britain 

3 Davies Cottage, Penllyn, Cowbridge, Vale of Glamorgan, CF71 7RQ, Great Britain 

4 Department of Entomology, The Manchester Museum, Manchester University, Oxford Road, 
Manchester, Ml 3 9PL, Great Britain 



Summary. Statistical analysis of measurements made on genitalia and androconia of Pseudochazara 
anthelea acamanthis (Rebel, 1916) butterflies from Cyprus, P. anthelea anthelea (Hübner, 1924) from 
mainland Turkey and P. anthelea amalthea (Frivaldsky, 1845) from mainland Greece shows that there is 
considerable overlap between the three taxa as represented by the specimens used in this study. The 
general similarity of the genitalia and androconia of these specimens supports Olivier's (1996) syn- 
onymy of P. anthelea acamanthis with P. anthelea anthelea based on his study of wing pattern. 

Key words. Lepidoptera, Satyrinae, Pseudochazara anthelea, genitalia, androconia, Cyprus, Greece, 
Turkey, biometrics, statistical analysis. 



Introduction 

The genus Pseudochazara de Lesse, 1951 (type-species by original designation 
Hipparchia pelopea Klug, 1832) consists of over twenty species and subspecies that 
are restricted to Europe and Asia. Gross (1 978) reviewed the genus, but recent discov- 
ery of additional species means that a fresh revision is now necessary and preliminary 
work towards such a revision is underway (Wakeham-Dawson & Kudrna 2000; 
Wakeham-Dawson & Dennis 200 1 ). As noted by Gross ( 1 978), Hesselbarth et al. ( 1 995) 
and Wakeham-Dawson & Dennis (2001), Pseudochazara species can be divided into 
two subgroups: (1) those that have male genitalia and androconia that are broadly 
similar to the type species P. pelopea and (2) those that have male genitalia and 
androconia that are broadly similar to P. anthelea anthelea (Hübner, 1824). It is in- 
tended that these two groups be formally described as subgenera in the planned revi- 
sion. 

The P. anthelea anthe/ea-subgroup is represented in the area around the Aegean 
Sea by a number of nominal subspecies. Olivier (1996) concluded, on the basis of 
wing pattern examination, that the nominal subspecies Pseudochazara anthelea 

© Nota lepidopterologica, 16.06.2003. ISSN 0342-7536 



£~>^ Wakeham-Dawson, Parker, John & Dennis: Male genitalia and androconia of Pseudochazara 

acamanthis (Rebel, 1916) from Cyprus is conspecific with/! anthelea anthelea (Hübner, 
1 824) from mainland Turkey. However, he did not consider male genitalia or androconia 
in his deliberations. In continuation of a long-running study of the butterflies of Cy- 
prus (Parker 1983, John 2000) and as part of the revision of the genus Pseudochazara 
mentioned above, measurements made on androconia and genitalia from specimens of 
P. anthelea acamanthis from Cyprus are compared in the current study with measure- 
ments made on specimens of P. anthelea anthelea from mainland Turkey. This paper 
presents the results of an analysis of these measurements and comments on the rela- 
tionship between mainland and Cyprus populations (subspecies). It also compares these 
findings with androconia and genitalia measurements from specimens of P. anthelea 
amalthea (Frivaldsky, 1 845) captured in mainland Greece and areas just north of Greece. 



Methods 

Sources of data and measurements .The genitalia and androconia 
measurement data used in the current study are taken from 60 male Pseudochazara 
butterfly specimens: 23 P. anthelea acamanthis, 20 P. anthelea anthelea and 11 P. 
anthelea amalthea. The locations in which these specimens were captured are pro- 
vided in the Appendix. 

The genitalia have been measured using the methods described in Wakeham-Dawson 
& Dennis (2001) and the androconia using methods described in Wakeham-Dawson & 
Kudrna (2000) (also see Figs. 1-3), although in the current study androconia were 
mounted under cover slips in DPX medium on microscope slides, rather than being 
preserved dry under the cover slips (as in Wakeham-Dawson & Kudrna 2000). Diago- 




Fig. 1. Diagram of male genitalia of Pseudochazara anthelea subspecies, aa = apex angularis; b = bra- 
chium; f = furca; p = penis; s = saccus; t = tegumen; u = uncus; v = valve; vi = vinculum. Terminology 
after Higgins (1975). 



Nota lepid. 25 (4), published 2003: 251-263 



253 




Fig. 2. Diagram of measurements made on male genitalia of Pseudochazara anthelea subspecies. DL = 
diagonal length, measured from dorsal junction of tegumen and uncus to base of saccus (the line running 
at the same angle as the vinculum); VL (indicated by the solid line running beneath the valve) = valve 
length; VB = valve breadth, measured at 0.5 mm from valve apex and at 90° to the line VL; UL = uncus 
length, measured from uncus apex to mid-point between junction of tegumen and uncus; UB = uncus 
breadth, measured at 0.5 mm from uncus apex and at 90° to the line UL; BL = brachium length, meas- 
ured from apex of brachium to dorsal junction of tegumen and brachium; BB = brachium breadth, meas- 
ured across junction of tegumen and brachium; TL = tegumen length, measured from dorsal junction of 
tegumen and uncus to junction of apex angularis and vinculum; TB = tegumen breadth; PL = penis 
length; PB = maximum penis breadth. 



nal length (DL) is divided by valve length (VL) to produce a unit-less ratio D, which 
measures overall proportion (shape) of the genitalia independently of size variation 
between individuals in a taxon. Similarly, valve length (VL) is divided by valve breadth 
(VB) to produce a ratio V, representing valve shape. Uncus length (UL) is divided by 
uncus breadth (UB) to produce a ratio U, representing uncus shape. Brachium length 
(BL) is divided by brachium breadth (BB) to produce a ratio B, representing brachium 
shape. Tegumen length (TL) is divided by tegumen breadth (TB) to give a ratio T, 
representing tegumen shape, and penis length (PL) is divided by uncus breadth (UB) 
(as penis breadth, PB, is not available for all specimens) to give a ratio PL In addition, 
penis length (PL) is divided by penis breadth (PB) (with linear regression estimates of 
PB for thirteen specimens; r = 0.67, F 3 42 = 11.59, p < 0.00001) to give a ratio P2. 



254 



Wakeham-Dawson, Parker, John & Dennis: Male genitalia and androconia of Pseudochazara 




Fig. 3. Diagram of Pseudochazara anthelea androconium and the 
measurements made. AL = androconium length, measured from ba- 
sal stalk (bs) to terminal points (tp) at apex; AB = androconium 
breadth, measured across widest part of androconium. Terminology 
after Kudrna (1977). 



Androconium length (AL) is divided by androconium breadth (AB) to give ratio A. 
This provides 21 variables (13 measurements and 8 ratios) for analysis. 

Statistical analysis. All variables, with the exception of BB, are nor- 
mally distributed. These variables are analysed untransformed. BB shows a positive 
skew and is treated with a log 10 transformation before analysis. Data are analysed 
using one-way analysis of variance (ANOVA), stepwise discriminant function analy- 
sis (DFA) and Euclidean non-metric multi-dimensional scaling (NMMS) (see Sneath 
& Sokal 1973; Statsoft 1999). These methods have been shown to be effective in re- 
vealing morphological relationships between taxa (e.g. Wakeham-Dawson & Dennis 
2001). 



Results 

The means, standard errors and maximum and minimum values of measurements 
and ratios from genitalia (Fig. 2) and androconia (Figs. 3 & 4) of all three taxa are 
presented for comparison in Tables 1 (measurements) and 2 (ratios). Only five of the 
13 measurements (VL, UL, log 10 BB, TB, PL) reveal significant differences (p<0.05) 
between the taxa, with PB marginally significant at p=0.06, when ANOVA is applied 
(Table 3). For the eight ratios, only three (U, B and PI) show significant differences 
when ANOVA is applied (Table 4). 

In these cases, the taxonomic pattern is similar in all variables, except for the com- 
parison of BB and ratio B (brachium length, BL, divided by brachium breadth, BB). P. 
anthelea acamanthis is distinct from P. anthelea anthelea (significant differences, 
p<0.05, shown in all variables except B) and P. anthelea amalthea (significant differ- 



Nota lepid. 25 (4), published 2003: 251-263 



255 




Fig 4. The androconia of P. anthelca anthelea from mainland Turkey [specimen nos. 443 (diagram a), 
345 (b, bi, bii), 444 (c), 192 (d, di)] and P. anthelca acamanthis from Cyprus [specimen nos. 437 (dia- 
gram e), 439 (f), 438 (g), 436 (h), 435 (i)]. Note the variation in androconium base shape both within and 
between specimens. The androconia of P. anthelca amalthea (not illustrated) are similar in shape and 
show similar variation in base shape to those illustrated. There is no significant difference in the shape of 
the androconia between any of these taxa (see Tables 3 & 4). 



256 



Wakeham-Dawson, Parker, John & Dennis: Male genitalia and androconia of Pseudochazara 



-O 




cd 








eel 




> 








cd 








G 




O 




o 




O 








-o 




G 




cd 




T3 




G 




cd 








cfl 












G 




M 




SJJ 




^H 




n 




^ 




r/i 




<1> 




3 


d 


cd 


o 


> 


cd 




d 




rrl 


X 




cd 


Oh 


S 


X 

0) 










-1 


£ 


H 


X 




<1> 


y 




cd 


eu 


■/) 


-o 




d 


zn 


cd 


d 


, — N 


eu 


d 


H 


g 


o 

CU 



d 


eu 


S S 


d 


G 
G 


cd 


II 


W 


Z 


C/1 








co 


G' 


o 


S 


b 


n 


eu 




1 


G 


G 


(U 


cd 


<]) 


CO 


s 








ni 


G 


<1> 


cd 
eu 


S 


g 


v ' 

co 






O 


Ö 




S- 

eu 










CO 


5 


& 


5 
a 


E 


c^ 


G 
G/3 


-s: 

■8 


• 


S 



ë<3 



"a 

a 
a 

-Si 

R 

1 

-S; 

«5 


00 


-d- 

o 
d 


un 

O 

d 


o 
d 


<d- 

o 
o 
d 


CN 

O 

d 


o 
d 


m 

co 
o 
d 


en 
m 
O 

d 


CN 

O 

d 


CN 

m 

O 
d 


o 
o 
d 


en 

O 
O 

d 


O 

o 
d 


cl 


o 
<* 

un 

en 


o 
un 

m 

d 


o 
*d- 


o 
in 

d 


o 
d 


o 
in 
"d- 

d 


o 

CN 
en 


O 
oo 
q 

CN 


o 

00 

q 


o 
o 

00 
CN 


o 

oo 

CN 

d 


CN 
CN 

d 


CN 
CN 

O 

d 


"S 


o 
o 
p 
en 


o 
m 

d 


o 
o 

CN 


o 
o 

d 


o 
m 
P- 

d 


o 

OO 
CN 

d 


O 
OO 
CN 
CN 


O 
O 

q 


o 

en 
en 


O 
CN 

en 

CN 


o 

CN 

d 


■o 
oo 

d 


CN 

O 

d 


c 

cd 

(D 


es 

en 


CN 
(N 

d 


CN 

en 


CN 

d 


o 

00 

d 


m 
en 

d 


P- 

P- 

q 
en 


o 

oo 


5 

un 


5 

un 

CN 


o 

CN 

d 


C3S 

d 


p- 

o 

d 


£ 


t> 


p- 


C'- 


p- 


r^ 


r~- 


p- 


P- 


^O 


\D 


p- 


un 


un 


-Si 

R 

<3 

-Si 

R 

a 

I 

■S 


00 


o 

<d- 

o 
ö 


o 
o 
d 


en 

CN 

O 

d 


CN 

O 
O 

d 


CN 
O 

d 


o 
o 
d 


oo 
en 

o 
d 


un 

■d- 

o 

d 


m 

CN 

O 

d 


un 

en 

o 
d 


un 

o 
o 

d 


en 

o 

O 

d 


O 

o 
d 


3 

S 


o 
en 


o 
r- 

CN 

d 


o 
oo 


o 
<d- 

d 


o 
o 
q 


o 
o 
■d- 

d 


o 

VC 

en 

m' 


o 
o 

CN 


o 
q 


o 
o 

CN 


o 
o 
en 

d 


P- 

CN 
CN 

d 


en 

m 

O 

d 




o 
o 
P-; 
cn 


o 
d 


o 
un 

q 


o 
o 

d 


o 
o 

00 

d 


o 
<d- 

cn 

d 


o 
un 
p- 

CN 


O 

un 
en 


o 
un 
en 


O 
O 
CN 
CN 


o 

CN 

d 


oo 
d 


en 

o 

d 


CD 


00 

cn 

m' 


o 

CN 

d 


<* 
en 


en 
CN 

d 


<d- 
p- 

oo 
d 


o 
en 

d 


VO 

oo 
en 


un 

m 


un 


P- 

'd- 

CN 


p^ 

CN 

d 


p- 

d 


o 
d 


£ 


O 


o 

ON 


o 

CN 


o 

CN 


o 

CN 


o 

CN 


o 

CN 


O 
CN 


o 

CN 


O 
CN 


p- 


o 


o 


•S 

§ 
1 

o 
a 

1 

R 

1 

8 

-R 

■S 

s 


w 

00 


m 

O 

d 


oo 
o 
o 
d 


d- 

o 
d 


en 

o 
o 
d 


O 

d 


un 

O 
O 

d 


un 

CN 

O 

d 


as 

O 

d 


P- 

O 

d 


CN 

O 

d 


en 

o 
o 

d 


CN 

O 
O 

d 


o 
o 
d 




o 

CN 

en 
en 


o 

CN 

en 
d 


o 

en 
en 


o 
d 


o 
o 
q 


o 
-d- 
en 

d 


o 

CN 

en 

en 


o 
oo 


o 
o 
q 


o 
un 
CN 


o 

oo 

CN 

d 


CN 

d 


en 
CN 

O 

d 




o 
o 
P-; 

CN 


O 

d 


o 
■d- 

q 


o 
o 

d 


o 
cn 
p- 

d 


o 
-d- 

CN 

d 


o 

00 
00 
CN 


o 
un 
un 


o 
o 
en 


O 
CN 


o 

CN 
CN 

d 


P- 

d 


o 
d 


(D 


m 
q 
en 


o 

CN 

CN 

d 


CN 


oo 

CN 

d 


■d- 

oo 

d 


es 
P- 

CN 

d 


m 
un 

q 
m' 


CN 


un 

•d; 


P- 

CN 

en 
CN 


en 
un 

CN 

d 


<d- 

d 


p- 

o 
d 


z 


m 

CM 


en 
es 


CN 
CN 


en 

CN 


en 
CN 


en 

CN 


m 

CN 


en 

CN 


CN 


en 

CN 


en 
es 


m 

CN 


en 

CN 


Ö 

o 

X 
cd 
H 


a> 

(S 

> 


> 


5 




g 




CQ 

m 


Q 


H 


PQ 


CU 


PQ 
Ph 


< 


< 



Nota lepid. 25 (4), published 2003: 251-263 



257 



Tab. 2. Summary statistics (means, standard errors (SE) and minimum (Min) and maximum (Max)) for 
genital and androconial ratios in three taxa of Pseudochazara butterflies (no units). N = number of 
specimens. See text for explanation. 



Taxon 


Pseudochazara anthelea acamanthis 


Pseudochazara anthelea anthelea 


Pseudochazara anthelea amalthea 


Variable 


Mean 


Min 


Max 


SE 


Mean 


Min 


Max 


SE 


Mean 


Min 


Max 


SE 


V 


14.21 


9.37 


19.00 


0.556 


15.94 


10.80 


21.00 


0.719 


15.75 


8.71 


24.08 


1.213 


u 


9.62 


6.50 


12.00 


0.272 


10.76 


8.75 


12.80 


0.222 


10.68 


8.33 


13.00 


0.392 


B 


3.12 


2.38 


3.85 


0.071 


2.95 


2.20 


3.57 


0.087 


2.65 


1.89 


3.43 


0.095 


T 


1.21 


1.10 


1.30 


0.012 


1.15 


0.91 


1.41 


0.032 


1.18 


0.98 


1.33 


0.023 


PI 


18.40 


14.38 


25.60 


0.503 


20.06 


16.92 


22.50 


0.395 


20.35 


16.67 


26.30 


0.657 


P2 


9.23 


8.00 


10.67 


0.152 


9.26 


8.21 


10.92 


0.139 


9.63 


8.78 


10.61 


0.144 


D 


1.01 


0.87 


1.09 


0.011 


0.98 


0.92 


1.03 


0.008 


0.96 


0.65 


1.11 


0.028 


A 


11.40 


8.13 


14.50 


0.313 


10.95 


5.88 


14.23 


0.437 


11.85 


8.68 


16.83 


0.564 



Pseudochazara anthelea acamanthis N= 23, Pseudochazara anthelea anthelea N = 20, Pseudochazara anthelea amalthea N = 17 



Tab. 3. One way analysis of variance (ANOVA) for genital and androconial measurements in three taxa 
of Pseudochazara butterflies. Significant effects (p<0.05) printed in bold face. 



One way ANOVA 


Variable 


SS effect 


df 
effect 


MS 
effect 


SS error 


df error 


MS error 


F 


P 


VL 


0.5698 


2 


0.2849 


2.0417 


57 


0.0358 


7.95 


0.0009 


VB 


0.0016 


2 


0.0008 


0.1145 


57 


0.0020 


0.41 


0.67 


UL 


0.1418 


2 


0.0709 


0.3695 


56 


0.0066 


10.74 


<0.0001 


UB 


0.0004 


2 


0.0002 


0.0109 


57 


0.0002 


0.95 


0.39 


BL 


0.0116 


2 


0.0058 


0.2089 


57 


0.0037 


1.58 


0.23 


BB 


0.0037 


2 


0.0019 


0.0087 


57 


0.0002 


12.25 


<0.0001 


DL 


0.2039 


2 


0.1019 


2.7122 


57 


0.0476 


2.14 


0.13 


TL 


0.0506 


2 


0.0253 


1.2594 


57 


0.022 1 


1.15 


0.33 


TB 


0.0815 


2 


0.0408 


0.4603 


56 


0.0082 


4.96 


0.0104 


PL 


0.4427 


2 


0.2213 


0.9436 


56 


0.0168 


13.14 


<0.0001 


PB 


0.0019 


2 


0.0010 


0.0136 


44 


0.0003 


3.11 


0.06 


AL 


0.0003 


2 


0.0001 


0.0080 


54 


0.0001 


0.88 


0.44 


AB 


0.0000 


2 


0.0000 


0.0006 


54 


().()()()() 


0.98 


0.38 



ences shown in all variables), but P. anthelea anthelea and P. anthelea amalthea are 
homogeneous (only log, () BB and B show a significant difference). 

In stepwise discriminant function analysis (DFA), only three of the variables {PI, 
log 10 BB and UL) are retained that provide significant discrimination between taxa when 
all three groups (P. anthelea acamanthis, P. anthelea anthelea and P. anthelea amalthea) 
are compared or when only two groups (P. anthelea acamanthis vs. P. anthelea anthelea 



258 


Wakeham-Dawson, Parker, John & Dennis 


Male genitalia and androconia of Pseudochazara 


Tab. 4. One way analysis of variance (ANOVA) for genital and androconial ratios in three taxa of 
Pseudochazara butterflies. Significant effects (p<0.05) printed in bold face. 


Variable 


SS effect 


df effect 


MS effect 


SS error 


df error 


MS error 


F 


P 


V 


38.24 


2 


19.12 


753.02 


57 


13.21 


.1.447 


0.244 


U 


17.40 


2 


8.70 


97.84 


57 


1.72 


5.068 


0.009 


B 


2.16 


2 


1.08 


7.94 


57 


0.14 


7.760 


0.001 


T 


0.03 


2 


0.02 


0.60 


57 


0.01 


1.626 


0.206 


PI 


46.34 


2 


23.17 


304.66 


57 


5.34 


4.335 


0.018 


P2 


1.74 


2 


0.87 


24.67 


57 


0.43 


2.015 


0.143 


D 


0.02 


2 


0.01 


0.29 


57 


0.01 


2.369 


0.103 


A 


7.56 


2 


3.78 


208.69 


57 


3.66 


1.032 


0.363 



and P. anthelea amalthea amalgamated) are compared. DFA of the three groups gives 
70% (18 individuals misclassified) correct classification (Wilks'À,= 0.42, F (6? 110) = 9.92, 
pO.0001). A plot of the first two roots shows that P. anthelea anthelea and P. anthelea 
amalthea almost completely overlap. However, P. anthelea acamanthis would fall 
outside these two groups if it were not for five of the P. anthelea anthelea specimens 
and the position of one P. anthelea acamanthis specimen (Fig. 5). DFA of the two 
groups gives 90% (6 individuals misclassified) correct classification (Wilks'A,=0.50, 
F (3 56) =18.95, pO.0001). This shows good separation, but not enough to avoid confu- 
sion in a blind trial. 

Two Euclidean non-metric multidimensional scaling (NMMS) plots based on all 
variables and just on ratios are virtually identical and show that there is considerable 
overlap between the P. anthelea acamanthis, P. anthelea anthelea and P. anthelea 
amalthea specimens (Fig. 6 for all variables). 



Discussion 

Comparison of genitalia and androconia morphology 
between populations. Analysis of variance shows that P. anthelea acamanthis 
specimens differ significantly from the two mainland taxa specimens (P. anthelea 
anthelea and P anthelea amalthea) in a number of variables. Similarly, P. anthelea 
acamanthis specimens are largely distinct from P anthelea anthelea and P anthelea 
amalthea in DFA axes. However, Euclidean plots show considerable overlap between 
the three taxa as represented by the specimens used in this study. The general similar- 
ity of the genitalia and androconia of these specimens supports Olivier 's (1996) syn- 
onymy of P. anthelea acamanthis with P. anthelea anthelea based on his study of wing 
pattern. Perhaps more surprising is the apparent similarity between i? anthelea anthelea 
and P anthelea amalthea. However, the similarity between these two taxa has been 
noted previously by Wakeham-Dawson & Dennis (2001), and although these taxa are 
treated as distinct species by many authors (e.g. Kudrna 2002), they may in fact be 
conspecific (i.e. capable of interbreeding to produce fertile offspring). The differences 



Nota lepid. 25 (4), published 2003: 251-263 



259 



3.0- 
















2.5 - 














2.0 - 
1.5 - 




■ 


+ 








1.0 - 
0.5 - 

CM 

I 0.0- 
-0.5 - 




D + 


■ 
+ + 

+ 

+ + 

+ + 

■ 

+ 








-1.0 - 




■ 

a 


++ * 








-1.5 - 


D 

D 


■ 

+ D 


■ 


+ 






-2.0 - 




a 








+ P. acamanthis 


-2.5 - 












■ P. anthelea 
□ P. amalthea 


% -3 


-2 -1 


1 2 


3 A 






Root 1 











Fig. 5. Plot of three Pseudochazara anthelea taxa in the first two roots (Root 1 vs. Root 2) of a discrimi- 
nant function analysis (DFA). 



2.0 



1.5 



1.0 



0.5 



CM 

cn 0.0 



-0.5 



1.0 



1.5 



-2.0 



i .... i .... i 



•■ 



<? V 



Alienation K = 0.11 
Kruskal stress S = 



■1.5 -1.0 -0.5 0.0 0.5 

Axis 1 



10 15 20 25 



+ P acamanthis 
■ P. anthelea 
a P. amalthea 



Fig. 6. Non-metric two-dimensional plot (Axis 1 vs. Axis 2) of three Pseudochazara anthelea taxa based 
on Euclidean distances for all genitalia and androconia variables. 



^°U Wakeham-Dawson, Parker, John & Dennis: Male genitalia and androconia of Pseudochazara 

between P. anthelea acamanthis and P. anthelea anthelea and P. anthelea amalthea, 
and the similarities between P anthelea anthelea and P. anthelea amalthea indicated 
by the current small-scale study suggest that a larger study including more specimens 
and use of molecular data could provide some revealing insights into the relationships 
between these nominal taxa. 

Gene flow between p o p u 1 a t i o n s . Geological evidence suggests that 
formation of the island of Cyprus began between 230 and 95 million years ago as it 
was forced up from the bed of the now Mediterranean Sea by movement of tectonic 
plates. 'A land area of some sort has existed on the present site of the island from 
Middle Miocene (about ten million years ago) times onwards' (Greensmith 1998, p. 6). 
As a result, the formation of the island almost certainly pre-dates the formation of the 
taxa we know as subspecies of P. anthelea. The population on Cyprus was probably 
established by individuals immigrating from the mainland in the last million or so 
years (although the actual age of these taxa can only be guessed at). The most suitable 
opportunities for migration would have been during the climate changes, lower sea 
levels and extended shorelines associated with ice-sheet formation between the Last 
Glacial Maximum and the early Holocene (Zonnerveld 1995; Lambeck & Bard 2000). 

As Cyprus is only 70 km from mainland Turkey, the island population has probably 
been sporadically augmented in the past with individuals from the mainland, and vice 
versa. However, P. anthelea acamanthis is nowadays the most sedentary of the Cyprus 
Satyrinae in terms of its vertical distribution. Hipparchia cypriensis (Holik, 1949) (an- 
other member of the Satyrinae present on Cyprus) has been observed engaging in 
seasonally reversed migration between sea level and 1900 m (John & Parker 2002). 
However, P. anthelea acamanthis does not show this type of behaviour. It is most 
frequently encountered above 1000 m (Makris in press; R. Parker & E. John, unpub- 
lished data) and although it does occur at intermediate elevations, only one specimen 
(an individual nectaring on Lantana) has been recorded from as low as 250 m (D. 
Haines, unpublished data). It is therefore hard to envisage specimens of the present 
day P. anthelea acamanthis dispersing in numbers from higher elevations. It is even 
harder to contemplate the species embarking on a crossing to the mainland or vice 
versa. 

This view is supported by an analysis of nearly 300 sightings of P. anthelea anthelea 
recorded in Hesselbarth et al. (1995). On the Turkish mainland, only three specimens 
(1% of sightings) are listed as being noted below an altitude of 250 m while, in sharp 
contrast, 282 (96%) were found above 500 m (including 237 records (81%) observed 
at 1000 m or higher). Changes in climate or agricultural practices may have influenced 
behaviour in recent centuries, confining the species to generally higher elevations. 
Although the population on Cyprus may have previously been in reproductive contact 
with mainland populations, it appears to be effectively isolated at present. 

As there are only slight differences between the genitalia and androconia morphol- 
ogy in the island (P. anthelea acamanthis) and Turkish mainland (P. anthelea anthelea) 
populations, it would appear that gene flow probably did occur in the past between the 
two populations. For similar reasons, it would also appear that there is or, until re- 
cently, has been regular gene flow between mainland Greece (P anthelea amalthea) 



Nota lepid. 25 (4), published 2003: 251-263 261 

and mainland Turkey (P. anthelea anthelea) populations. On the other hand, there may 
have been only limited evolutionary divergence between the various P. anthelea anthelea 
populations since they became isolated. If this is the case, limited differentiation may 
be a result of the similarity of the biotopes of the populations in Turkey, Greece and 
Cyprus (see below). It is worth noting that although P. anthelea amalthea and P. anthelea 
anthelea differ in wing colour (especially in the females) this probably does not indi- 
cate reproductive isolation between these nominal taxa, as wing colour appears not to 
be a reliable taxonomic character in the genus Pseudochazara (Wakeham-Dawson & 
Dennis 2001). 

Comparison of biotopes between p opulati on s . The biotopes 
of Pseudochazara anthelea populations, both on the Turkish mainland and in Cyprus, 
appear to be very similar, with favoured areas comprising open, rocky ground on steep, 
mainly south-facing, calcareous hillsides. On Cyprus, sparse vegetation (predominantly 
Cistus creticus, Arbutus andrachne and other evergreen sclerophyllous shrubs scat- 
tered among large rocks) completes the picture (Parker 1983, John 2000 and unpub- 
lished observations). Although we do not have biotope data for all the specimens meas- 
ured in the current study, some of the Turkish mainland (P. anthelea anthelea) speci- 
mens measured in our study were captured in surroundings that are similar to the areas 
where the Cyprus (P. anthelea acamanthis) specimens were found. For example, A. 
Koçak (personal communication) reported that the specimens (nos. 479-484; see Ap- 
pendix) he and his wife (M. Kemal) provided for this study were found at 1580 m in 
openings of Quercus woodland on calcareous slopes. The biotope occupied by P 
anthelea amalthea on mainland Greece is similar to that inhabited by the mainland 
Turkish and Cyprus populations with the species generally restricted to calcareous 
forested mountain areas above 1000 m (e.g. specimen nos. 73-75; see Appendix). 



Acknowledgements 

We thank Ulf Eitschberger, Muhabbet Kemal, Ahmet Koçak, Otakar Kudrna and Christodoulos Makris 
for assistance with the provision of Pseudochazara specimens for this investigation; and Jo Konopelko 
(Design Studio, The Natural History Museum, London) and Nick Greatorex-Davies (Monks Wood, Centre 
for Ecology and Hydrology) for assistance with preparation of the figures. An earlier version of this 
paper was improved by comments from an anonymous referee. 



References 

Greensmith, T. 1998. Southern Cyprus. Geologists' Association Guide No. 50, London. 146 pp. 
Gross, F. J. 1978. Beitrag zur Systematik von Pseudochazara- Arten (Lep., Satyridae). - Atalanta 9: 41-103. 
Higgins, L. G. 1975. The classification of European butterflies. - Collins, London. 320 pp. 
Hesselbarth, G, van Oorschot, H. & Wagener, S. 1995. Die Tagfalter der Türkei. S. Wagener, Bocholt. 

1354 pp., 847 pp. 
John, E. 2000. Butterflies of Cyprus 1998 (Records of a year's sightings). Bull. Amat. Ent. Soc, 

Pamphlet No. 15. 46 pp. 
John, E. & Parker, R. 2002. Dispersal of Hipparchia cypriensis (llolik, 1949)(Lepidoptera: Nymphalidae, 

Satyridae) in Cyprus, with notes on its ecology and life-history. - Ent. Gaz. 53: 3 1 8. 
Kudrna, O. 1977. A Revision of the Genus Hipparchia Fabricius. - E. W. Classey, Faringdon. 300 pp. 
Kudrna, O. 2002. The distribution atlas of European butterflies. Oedippus 20: 1-342. 
Lambeck, K. & Bard, E. 2000. Sea-level changes along the French Mediterranean coast for the past 



262 



Wakeham-Dawson, Parker, John & Dennis: Male genitalia and androconia of Pseudochazara 



30,000 years. - Earth Planetary Sei. Letts. 175: 203-222. 
Makris, C. 2002. Butterflies of Cyprus. - Bank of Cyprus Cultural Foundation, Nicosia, in press [in 

Greek; English translation planned for publication in 2003]. 
Olivier, A. 1996. Notes on the taxonomic status and supposed biogeographical affinity of the 

Pseudochazara anthelea (Hübner, [1924]) populations from Kipros (Cyprus) and from the Greek 

island of Kos (Lepidoptera: Nymphalidae, Satyrinae). - Phegea 24: 5-12. 
Parker, R. 1983. The butterflies of Cyprus. - Ent. Gaz. 34: 17-53. 
Sneath, P. H. A. & Sokal, R.R. 1973. Numerical taxonomy. The principles and practice of numerical 

classification. - W. H. Freeman, San Francisco. 573 pp. 
Statsoft. 1999. STATISTICA 5.5 for Windows. - StatSoft Inc., Tulsa, OK. 
Wakeham-Dawson, A. & Dennis, R. L. H. 2001. A quantitative description of the male genitalia of 23 

taxa of Pseudochazara butterflies (Lepidoptera: Nymphalidae, Satyrinae). - Ent. Gaz. 52: 227-250. 
Wakeham-Dawson, A. & Kudrna, O. 2000. A quantitative description of androconia from Staudinger's 

Pseudochazara de Lesse, 1951 (Lepidoptera: Nymphalidae, Satyrinae) type specimens in the 

Zoological Museum of Berlin. - Ent. Gaz. 51: 75-81. 
Zonnerveld, K. A. F. 1995. Palaeoclimatic and palaeo-ecological changes during the last déglaciation in 

the Eastern Mediterranean - implications for dinoflagellate ecology. - Rev. Palaeobot. Palynol. 84: 

221-253. 



Nota lepid. 25 (4), published 2003: 251-263 



263 



Appendix. Collection data of Pseudochazara butterfly specimens (23 P. anthelea acamanthis, 20 P. 
anthelea anthelea and 17 P. anthelea amalthed) measured in the current study. AWD - collection A. 
Wakeham-Dawson; EIT - collection U. Eitschberger (Marktleuthen, Germany); BM - Booth Museum, 
UK; RP - collection R. Parker, UK. 



Taxon 


no. 


Location 


acamanthis 


435 


Plâtres, Cyprus 


acamanthis 


436 


Almyrolivado, Cyprus 


acamanthis 


437 


Prodromos Dam, Cyprus 


acamanthis 


438 


Trooditissa, Cyprus 


acamanthis 


439 


Trooditissa, Cyprus 


acamanthis 


445 


Prodromos Dam, Cyprus 


acamanthis 


446 


Prodromos Dam, Cyprus 


acamanthis 


447 


Trooditissa, Cyprus 


acamanthis 


448 


Trooditissa, Cyprus 


acamanthis 


449 


Foini, Cyprus 


acamanthis 


450 


Prodromos Dam, Cyprus 


acamanthis 


451 


Prodromos Dam, Cyprus 


acamanthis 


452 


Prodromos Dam, Cyprus 


acamanthis 


453 


Madari, Cyprus 


acamanthis 


454 


Madari, Cyprus 


acamanthis 


455 


Trooditissa, Cyprus 


acamanthis 


456 


Trooditissa, Cyprus 


acamanthis 


457 


Trooditissa, Cyprus 


acamanthis 


458 


Trooditissa, Cyprus 


acamanthis 


459 


Trooditissa, Cyprus 


acamanthis 


460 


Trooditissa, Cyprus 


acamanthis 


461 


Trooditissa, Cyprus 


acamanthis 


471 


Trooditissa, Cyprus 


amalthea 


68 


Mt. Parnassus, Greece 


amalthea 


70 


Peloponnesus, Greece 


amalthea 


71 


Peloponnesus, Greece 


amalthea 


72 


Peloponnesus, Greece 


amalthea 


73 


Mt. Chelmos, Greece 


amalthea 


74 


Mt. Chelmos, Greece 


amalthea 


75 


Mt. Chelmos, Greece 


amalthea 


346 


Mt. Parnassus, Greece 


amalthea 


362 


Mt. Parnassus, Greece 


amalthea 


363 


Mt. Parnassus, Greece 


amalthea 


472 


Konitsa, Greece 


amalthea 


473 


Pirin, Bulgaria 


amalthea 


47* 


Konitsa, Greece 


amalthea 


475 


Topolka, Macedonia 


amalthea 


476 


Mt. Smolikas, Greece 


amalthea 


477 


Mt. Chelmos, Greece 


amalthea 


478 


Kalavrita, Greece 


anthelea 


192 


Dazkiri, Turkey 


anthelea 


345 


Dazkiri, Turkey 


anthelea 


358 


Elmadag, Turkey 


anthelea 


443 


Bayburt, Turkey 


anthelea 


444 


Bayburt, Turkey 


anthelea 


462 


Elazig, Turkey 


anthelea 


463 


Ankara, Turkey 


anthelea 


464 


Corum, Turkey 


anthelea 


465 


Ankara, Turkey 


anthelea 


466 


Elazig, Turkey 


anthelea 


467 


Erzurum, Turkej 


anthelea 


468 


Erzurum, Turkey 


anthelea 


469 


Erzurum, Turkey 


anthelea 


470 


Erzurum, Turkey 


anthelea 


479 


Kayseri, Turkey 


anthelea 


480 


Kayseri. Turkey 


anthelea 


481 


Kayseri, Turkey 


anthelea 


482 


Kayseri, Turkey 


anthelea 


483 


Kayseri, Turkey 


anthelea 


484 


Kayseri, Turkey 



Capture date 

.1975 

.1996 

.1996 

.1975 

.1975 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.2001 

.1975 

.1995 

? 

? 

? 

24.vii.1992 

26.vii.1992 

26.vii.1992 

14.vii.1978 

8.VÜ.1973 

23.vii.1973 

3.VÜ.1997 

3 l.v. 1983 

3.VÜ.1997 

5.vi.l984 

18.vii.1995 

10.vi.1992 

18.vi.1991 

26.vii.1980 

26.vii.1980 

15.vii.19S0 



25.vii 

7.vi: 

8.vii 

28.v 

23.vi 

14.V 

14.V 

13.V 

13.v 

lO.v 

14.v 

13.V 

13.v 

lO.v 

lO.v 

8.V 

8.v 

13.v 

13.v 

8.v 

8.v 

8.v 

23.vi 

12.vi 



13-14.vi. 

19-20.VÏ. 
05.YI11, 

I 9-20. vi. 
13.vi. 

6-1 J.vii, 

6-13.VÜ, 

6-13.VÜ. 

6-13.VÜ 
26.vi. 
26.vi 
26.vi. 
26.vi 
26.vi 
26.vi, 



1974 
1974 

1 976 
1974 
1974 
1 90S 
I 99 S 

[998 

I 99X 
2001 
2001 
2001 
20(11 
2001 
2001 



Altitude 

1120 m 

1600 m 

1400 m 

1380 m 

1380 m 

1450 m 

1450 m 

1380 m 

1380 m 

800 m 

1450 m 

1450 m 

1450 m 

1400 m 

1400 m 

1380 m 

1380 m 

1380 m 

1380 m 

1380 m 

1380 m 

1380 m 

1380 m 

1000 m 

? 

? 

? 

1000 m 

1000 m 

1000 m 

1000 m 

? 

7 

7 

7 

7 

7 

1700 m 

1200 m 

■) 

I 500 m 

1 500 m 

•> 

7 
7 
700 m 
1000 m 
1 1 00 m 
1000 ill 
1200 m 



7 

7 

1580 m 

I 5 SO m 

1580 m 

I SSO m 
15 SO m 
1580 m 



Collector 

R. Parker 

C. Makris 

C. Makris 

R. Parker 

R. Parker 

E. John 

E. John 

E. John 

E. John 

C. Makris 

E. John 

E. John 

E. John 

C. Makris 

C. Makris 

E. John 

E. John 

E. John 

E. John 

E. John 

E. John 

E. John 

R. Parker 

A . Wakeham- Dawson 

D. & S. Howell 

D. & S. Howell 

D. & S. Howell 

A. Wakeham-Dawson 

A. Wakeham-Dawson 

A. Wakeham-Dawson 

D. & S. Howell 

P.W. Cribb 

PW. Cribb 

A. Wakeham-Dawson 

ex Coll. T. Hacz 

A. Wakeham-Dawson 

Schaider 

Bin ter 

?, ex Coll. O. Kudrna 

V. Folk 

D. & S. Howell 

I). & S. Howell 

P.W. Cribb 

?, ex Coll. O. Kudrna 

'.'. ex Coll. O. Kudrna 

F.J. Gross 

F.J. Gross 

F.J. Gross 

F.J. ( MOSS 

F.J. (moss 

ex Coll. O. Kudrna 

ex Coll. O. Kudrna 

ex Coll. O. Kudrna 

ex ( loll. O. Kudrna 

M. Kemal A. Kocak 

M Kemal/A. Kocak 

M. Kemal/A. Kocak 

M. Kemal/A. Kocak 

M. Kemal/A. Kocak 

M. Kemal/A. Kocak 



Collection 

AWD 

AWD 

AWD 

RP 

RP 

AWD 

AWD 

AWD 

AWD 

AWD 

EIT 

EIT 

EIT 

EIT 

AWD 

AWD 

EIT 

EIT 

EIT 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

BM 

BM 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

BM 

AWD 

AWD 

EIT 

EIT 

EIT 

EIT 

EIT 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 

AWD 



264 



Book review 



Book Review 

Arenberger, E. 2002. Pterophoridae II. -In:R. Gaedike (ed.), Microlepidoptera Palaearctica 
11. - Goecke & Evers, Keltern. - 287 pp., incl. 80 b/w pis., 16 colour pis. ISBN3-93 1374-21-1. 
Price: 90 Euro (subscription: 72 Euro). [In German]. 

According countings by Heppner (1991), 3 15 species of Pterophoridae occur in the Palaearctic 
region, which is about one third of the entire world fauna of this group. Ernst Arenberger from 
Vienna is probably the best authority of this fauna, based on his profound life-time work. He 
previously published the first volume on Palaearctic Pterophoridae including 168 species, in 
the old and well known layout of the Microlepidoptera Palaearctica (Arenberger 1995). 
In 2002, the second volume on Palaearctic Pterophoridae has been published, treating 63 spe- 
cies of the subfamilies Deuterocopinae and Platyptilinae. The style of the main text remained 
the same and the user again find the impressive high-quality watercolours by Frantisek Gregor. 
It is a bit questionable for what purpose the separate figures of the hind-wings (pis. 70-80) are 
given. They seem to be pure magnifications in black and white made from Gregor 's watercol- 
ours and do not show additional details. The drawings of the genitalia are very simple and 
appear at a first glance like sketches. However, the user will realise that all necessary charac- 
ters are clearly given and sufficiently well illustrated for identification. In comparison to the 
first volume on Palaearctic Pterophoridae, the user will miss the distribution maps, which 
always immediately give an instructive impression about an species areal. This way, it is nec- 
essary to read through the sometimes long lists of geographic names given in the distribution 
paragraph. Altogether, the eleventh volume of this series is among those books that enable the 
user to identify the treated species sufficiently and that gives comprehensive information for 
further reading. 

Beside this, it must be criticised that some general scientific standards are not fulfilled. The 
differential diagnoses are missing for the species, examined material is not listed, references 
are missing for included life history data, and a summary is missing. It will be indispensable to 
develop the series accordingly, at least for the time it is printed with financial support from the 
German Research Foundation (Deutsche Forschungsgemeinschaft). Future volumes also may 
safe printing space by using a smaller script for lists of synonyms, geographic names and 
references as well as avoiding that much space is used for low-graded headings like 'Synonymie' 
and 'Literatur' or extended spaces between pairs of entries in the keys, the lists of synonyms 
and the list of references. 

Nevertheless, Ernst Arenberger provided again a comprehensive and profound contribution, 
and we are looking forward to see the Palaearctic Pterophoridae completed by its third volume. 
As the entire series, this book contributes much to the understanding of Microlepidoptera, not 
only to their identification. Summaries of life history data might be a starting point for ecologi- 
cal studies. The geographic coverage of Microlepidoptera Palaearctica allows to show the 
complete areal of a species and thus will support forthcoming biogeographical studies. I wish 
this book series a continued existence, though perhaps with improved standards. 

References 

Arenberger, E. 1995. Pterophoridae. - In: H. G. Amsel, F. Gregor & H. Reisser, Microlepidoptera 

Palaearctica 9 (1+2). G. Braun, Karlsruhe. 
Heppner, J. B. 1991. Faunal regions and the diversity of Lepidoptera. - Tropical Lepidoptera 1 Suppl. 1: 

85 pp. 

Matthias Nuss 



Nota lepid. 25 (4), published 2003: 265-266 265 

Short Communication 

Araschnia levana larvae (Nymphalidae) do not accept Humulus 
lupulus (Cannabaceae) as food plant 

Konrad Fiedler & Claudia Ruf 

Department of Animal Ecology I, University of Bayreuth, D-95440 Bayreuth, Germany 
e-mail: konrad.fiedler@uni-bayreuth.de 

The Palaearctic nymphalid genus Araschnia comprises about seven species, with highest 
diversity occurring in China. Life-histories of the transpalaearctic A. levana (Linnaeus, 
1758) and the East Asian A burejana Bremer, 1861 are relatively well known. Almost 
all published data (e.g. Ebert & Rennwald 1991, Fukuda et al 1 992, Tuzov et al 2000, 
Gorbunov 2001) indicate that both are restricted to host plants in the family Urticaceae 
{Urtica, Boehmeria, Laportea). Also in a comparative experimental approach Janz et 
al. (2001) failed to observe any food acceptance of European A. levana beyond its 
usual hostplant, stinging nettle Urtica dioica L. In their feeding trials, Janz etal. incor- 
porated exemplar species of all plant families known to be utilized as hosts among 
Nymphalini butterflies, including wild hop Humulus lupulus L. (Cannabaceae). The 
Cannabaceae are generally accepted as being closely related to the Urticaceae and 
Ulmaceae (APG 1998, Bhattacharyya & Johri 1998), two typical hostplant families of 
Nymphalini butterflies. Indeed, feeding on H. lupulus has been recorded rather widely 
in the Nymphalini genera Inachis, Aglais, Polygonia and Nymphalis (Janz et al. 200 1 ). 

In a Russian source (Korshunov & Gorbunov 1995) it is indicated that A. levana 
'rarely' feeds on H. lupulus, although no details are recorded there. Despite the nega- 
tive results obtained by Janz et al. (2001) this stimulated us to again test whether 
larvae of A. levana might accept that plant at least in captivity. In contrast to Janz et al. 
who tested each food plant in their study with only five first instar larvae, we at- 
tempted to obtain larger samples and confronted a wider range of larval stages in no- 
choice tests with cut young foliage of H. lupulus. The larvae used in the tests origi- 
nated from the offspring of a number of field-collected mated females of the summer 
generation that had been sampled in the vicinity of Bayreuth (Northern Bavaria, Ger- 
many). Larvae were maintained in closed plastic containers (volume 1000cm 3 ) lined 
with moist filter paper and kept at room temperature (22-25°C). 

In no case did we observe any signs of feeding on //. lupulus. This was true for first 
instars directly hatching from the egg with no prior feeding experience (N>100), as 
well as for first (N=30), second (N=15) and third instar larvae (N=15) that had been 
raised previously on U. dioica foliage. All larvae starved to death within 3-5 days. 
Frequently, the larvae were seen crawling around in the containers off the plant in 
search for suitable food. 

Our complete failure to induce feeding by A. levana larvae on //. lupulus indicates 
that in fact this plant species does not qualify as a food plant. It is at present impossible 

© Nota lepidopterologica, 16.06.2003. ISSN 0342-7536 



266 



Fiedler & Ruf: Araschnia levana 



to decide where the discrepancy to Korshunov & Gorbunov's record (1995) comes 
from. It might still be possible that certain Siberian populations of A. levana do have 
the capacity to feed on H. lupulus. However, it seems remarkable in this respect that in 
his recent book Gorbunov (2001) no longer mentions any relationship between A. 
levana and H. lupulus. Hence, for the time being and until any conclusive data can be 
presented to show the contrary, we suggest to delete Humulus from the hostplant list of 
Araschnia butterflies, which appear in fact to be family-monophagous on Urticaceae. 

References 

APG (= Angiosperm Phytogeny Group). 1998. An ordinal classification for the families of flowering 

plants. - Annls. Missouri Bot. Gard. 85: 531-553. 
Bhattacharyya, B. & B. M. John. 1998. Flowering plants - taxonomy and phylogeny. - Narosa Publ. 

House, New Delhi, xxi + 753 pp. 
Ebert, G. & E. Rennwald. 1991. Die Schmetterlinge Baden- Württembergs, vol. 1. - E. Ulmer, Stuttgart. 
Fukuda, H., E. Hama, T. Kuzuya, A. Takahashi, M. Takahashi, B. Tanaka, H. Tanaka, M. Wakabayashi & 

Y. Watanabe. 1992. The life histories of butterflies in Japan, vol. 3. 2nd ed. - Hoikusha Publishers, 

Osaka, xxii + 373 pp. 
Gorbunov, P. Y. 2001. The butterflies of Russia: classification, genitalia, keys for identification 

(Lepidoptera: Hesperioidea and Papilionoidea). - Thesis Publishers, Ekaterinburg. 320 pp. 
Janz, N., K. Nyblom & S. Nylin. 2001. Evolutionary dynamics of host-plant specialization: a case study 

of the tribe Nymphalini. - Evolution 55: 783-796. 
Korshunov, Y & P. Gorbunov. 1995. Dnevnye babochki aziatskoi chasti Rossii. Spravochnik. [Butter- 
flies of the Asian part of Russia. A handbook]. - Ural University Press, Ekaterinburg. 202 pp. [in 

Russian; English translation by O. Kosterin available at: http://pisum.bionet.nsc.ru/kosterin/korgor] 
Tuzov, V. K., P. V. Bogdanov, S. V. Churkin, A. V. Dantchenko, A. L. Devyatkin, V. S. Murzin, G. D. 

Samodurov & A ; B. Zhdanko. 2000. Guide to the butterflies of Russia and adjacent territories, vol. 2. 

- PenSoft Publishers, Sofia & Moscow. 580 pp. 



Nota lepid. 25 (4), published 2003: 267-279 267 

The butterfly assemblages of Onega Lake Area in Karelia, 
middle taiga of NW Russia (Hesperioidea, Papilionoidea) 

Vyacheslav V. Gorbach 1 & Kimmo Saarinen 2 * 

1 Petrozavodsk State University, Department of Zoology and Ecology, RUS- 185640 Petrozavodsk, 
Russia 

2 South Karelia Allergy and Environment Institute, Lääkäritie 15, FIN-55330 Tiuruniemi, Finland 
* corresponding author, e-mail: all.env@inst.inet.fi 



Summary. The species composition and abundance of butterflies were studied on the north-western 
coast of Lake Onega in four years (1992-1993, 1995-1996). A total of 50 species and 3,832 individuals 
were observed during 1,554 transect counts at 111 sites. The most abundant species were Callophrys 
rubi, Brenthis ino and Pieris napi. The abundance of the majority of species was rather similar compared 
to the adjacent provinces of Russian and Finnish Karelia. Clustering of the sites resulted in four groups 
of assemblages, i.e. those of peatlands, open environments, forest meadows and forests. The average 
number of species in the groups varied from 7 in peatlands to 1 3 in open environments, whereas the 
average density of individuals was highest in open environments and lowest in forests. The groups 
differed with respect to dominance, species diversity, and the number of species with a clear habitat 
preference. Peatland assemblages were the most homogenous ones. A principal component analysis 
(PC A) indicated three main trends in the variation of butterfly abundance: an affinity of species to either 
forest environments, open environments, or peatlands. Based on these trends and their habitat prefer- 
ences, the species were considered woodland, grassland and peatland species, respectively. A hypothesis 
about the historical formation of the present butterfly fauna in the study area is presented. 

Key words. Butterfly communities, boreal forest zone, habitat preferences, multivariate analysis. 



Introduction 

Butterflies are one of the best-known groups of Lepidoptera in the mid-taiga subzone 
of Russian Karelia. Studies have mainly been carried out, however, before the 1950s 
and have been reported in the form of simple species lists (e.g., Günther 1896; Möberg 
1925; Lahtivirta 1939; Kaisila 1944, 1945; Karvonen 1945). Only Kaisila (1947) and 
Kozhantshikov (1958) generalised from their data and considered the ecological as- 
pects of butterflies in detail. Recent lists, still few, have been annotated more precisely 
(Kozlov 1983; Kutenkova 1986, 1989). 

According to available data, a total of 85 butterfly species has been recorded in the 
region. The species composition of the fauna is fairly similar to the well-documented 
fauna of Finnish Karelia, comprising 89 species (Saarinen et al. 2002). However, with 
regard to Russian Karelia we have scant information about the distribution and abun- 
dance of individual species as well as about the composition and the structure of local 
assemblages. In addition, changes in the butterfly fauna during recent decades and the 
present status of many species are not known (Ivanter & Kuznetsov 1995; Kotiranta et 
al 1998). 

We investigated butterflies at two adjacent localities in the Onega Lake area in 
order to partly fill this gap in our knowledge. This biogeographical province offers two 
advantages for evaluating the present status of the butterfly fauna in the middle taiga 
of Russian Karelia. On the one hand, a relatively mild climate in the Lake Onega 

© Nota lepidopterologica. 16.06.2003. ISSN 0342-7536 



268 



Gorbach & Saarinen: Butterfly from Onega Lake Area in Karelia 



region allows some species to penetrate further north due to favourable conditions for 
reproduction. Hence, the butterfly fauna of the province is relatively rich in species. 
On the other hand, because of the strongly broken relief with its frequent alternation of 
ridges and valleys and the long-term traditional forest exploitation and agricultural 
practices, the landscape of the Onega Lake area is characterised by a high diversity of 
environments at a small spatial scale, including all major butterfly habitats in the mid- 
taiga subzone of Russian Karelia. 

Methods 

The study area was situated on the north-western coast of Lake Onega (Fig. 1). The 
landscape of the region is made up of forests (60% of the area, with a predominance of 
Scots pine (Pinus sylvestris) in the tree cover), lakes and rivers (20%), open and forested 
bogs and mires (15%) and cultivated fields, meadows and pastures (5%) (Volkov et al. 
1990; Gromtzev 1993). The annual mean temperature is +2.1 °C and the monthly 
means range from +16.8 °C in July to -10.9 °C in February (Romanov 1961). 

Butterfly assemblages were studied in two nearby localities, Konchezero (1992- 
1993) and Kivach (1995-1996). All accessible butterfly habitats in both areas were 
visited before the field studies commenced and a total of 1 1 1 sampling sites (Table 1) 
were selected randomly. Based on the plant associations, i.e. dominant and subdomi- 
nant species and relative abundance of indicators of humid and shady conditions, the 
sites were grouped according to the classification used by Ramenskaya (1958) and 
Yakovlev & Voronova (1959). The location of each site was also taken into considera- 
tion. The groups were as follows. Peat bogs and mires were oligo- and 
mesotrophic with semi-open or open vegetation. Tree cover was mostly dominated by 
Scots pine and the ground layer was comprised of oligotrophic shrubs {Ledum palustre, 
Chamaedaphne calyculata, Betula nana), sedges and herbs. Dry pine forests 
were dominated by Scots pine in the tree cover, and by Cladonia spp., Vaccinium vitis- 
idaea and Calluna vulgaris in the ground layer. Humid pine^ forests exhib- 
ited conditions varying from moderately dry to humid and the composition of the tree 




Fig. 1. The biogeographical provinces of Karelia (Ahti et al. 
1968) and the location of the study area (black dot). Middle 
taiga subzone: Ik = Isthmus karelicus, Ka = Karelia australis, 
Kl = K. ladogensis, Kb = K. borealis, Kol = K. olonetsensis, 
Kon = Karelia onegensis, Kton = K. transonegensis. North- 
ern taiga subzone: Kpor = K. pomorica orientalis, Kpoc = K. 
p. occidentalis, Kk = K. keretina. 



Nota lepid. 25 (4), published 2003: 267-279 269 

Tab. 1. The combined sampling data in ten site groups. Symbols are as follows: MIR= Peat bogs and 
mires, DPF= Dry pine forests, HPF= Humid pine forests, HBF= Humid birch forests, HAF= Humid 
aspen forests, SFM= Swampy forest meadows, HFM= Humid forest meadows, DFM= Dry forest 
meadows, DOM= Dry open meadows, RDS= Roadsides. For definition of vegetation types see Methods 
section. 



Groups 


Sites 


Number of transects 




Counts 




Number of 






total 


range 


mean 


SD 


(total) 


species 


individuals 


MIR 


16 


47 


1-12 


2.9 


2.6 


282 


21 


900 


DPF 


12 


33 


1-5 


3.3 


2.2 


198 


14 


93 


HPF 


16 


42 


1-4 


2.6 


1.1 


252 


41 


543 


HBF 


8 


19 


2-3 


2.4 


0.5 


114 


19 


89 


HAF 


5 


15 


2-5 


3.0 


1.2 


90 


16 


62 


SFM 


7 


16 


1-7 


2.3 


2.2 


96 


28 


355 


HFM 


12 


27 


1-6 


2.3 


1.7 


162 


32 


353 


DFM 


15 


21 


1-3 


1.4 


0.7 


126 


26 


347 


DOM 


14 


19 


1-3 


1.3 


0.6 


114 


30 


618 


RDS 


6 


20 


3-4 


3.3 


0.5 


120 


36 


472 



Total 111 259 1-12 2.6 0.9 1,554 50 3,832 

cover varied from pure pine forests to mixed forests with a high abundance of shrubs. 
The ground layer vegetation varied substantially, but mosses (Pleurozium spp., 
Hylocomnium spp.) and Vaccinium myrtillus constantly prevailed in the plant associa- 
tions. There were some meadow plants, but unlike the situation in forest meadows 
these species did not form typical associations. Humid birch forests were 
characterised by a predominance of birch (Betula spp.) and small numbers of Scots 
pine and spruce (Picea abies) in the tree cover, but aspen (Populus tremula) and sev- 
eral shrubs, such as Rhamnus frangula, Rosa spp. and Lonicera spp., were common in 
these sites. Vaccinium myrtillus, Calamagrostis arundinacea, Deschamps ia flexuosa 
and some forest herbs were abundant in the ground layer. Humid aspen for- 
ests had only a small number of trees other than aspen in the tree cover. The ground 
layer was similar to that of humid birch forests, but species adapted to shady condi- 
tions, such as Paris quadrifolia and Milium effusum, were more common. Swampy 
forest meadows were dominated by Carex nigra, and the ground layer included 
common species adapted to humid conditions, such as Agrostis canina, Carex canesccns, 
Cirsium palustre and Viola epipsila. Humid forest meadows were charac- 
terised by an unevenness of species composition and density of vegetation. The domi- 
nant species were Alchemilla spp., Trollius europaeus and Filipendula ulmaria. Typi- 
cal plant species of swampy and dry meadow associations were distributed in small 
fragments along the humidity gradient. Dry forest meadows were character- 
istically patchy in regard to the structure of their vegetation and dominated by Agrostis 
capillaris or Nardus stricta. The species adapted to dry conditions, such as Festuca 
ovina, Knautia arvensis and Hieracium umbellatum were commonest in plant associa- 
tions. Dry open meadows were similar to dry forest meadows, but were situ- 
ated in an open arable landscape. Sites were usually bordered by lines of bushes along 



^ '" Gorbach & Saarinen: Butterfly from Onega L ake Area in Karelia 

drainage ditch banks, and plant associations were spotted with ruderal and weed veg- 
etation. Roadsides represented both stable and open dry habitats with a predomi- 
nance of meadow plants, and overgrowing habitats with bushes and forest plants. 

Butterflies were studied using the transect count method (Pollard & Yates 1993). All 
transects were 150 m long and 3 m wide. The number of transects at each site, varying 
from 1 to 12, was determined by the size of the site and the heterogeneity of the vegeta- 
tion structure. In the forests, only semi-open areas, such as sparsely wooded or treeless 
glades and tracks, were censused as boreal butterflies avoid areas with closed canopy. 

Transects were studied over two seasons in each locality. The season was divided 
into three periods; the first was between late May and late June, the second in July, and 
the third one between mid-August and mid-September. Each transect was censused 
once in a period, and all butterflies seen within the boundaries of the route were counted. 
Counts were conducted between 10:00 and 15:00 local time if weather conditions 
were satisfactory. A transect was not censused if the temperature was lower than +18 
°C, or if sunshine prevailed for less than 70% of the time, or the wind speed exceeded 
level three (>5.4 m/s) on the 12-point Beaufort scale. 

A butterfly assemblage was defined as all species found in the site. Before any 
analyses were made, the data from Konchezero and Kivach were combined and the 
number of individuals per site was adjusted to individuals per ha. Since the species 
density data contained many zeros, Euclidean-based methods (e.g., &-means cluster- 
ing and PCA) could not be used without prior transformation of the data. We applied 
the Chord transformation to the species data (Legendre & Gallagher 2001). The as- 
semblages were first classified using &-means clustering and the resulting groups were 
compared by means of the species composition, the total density, the species richness 
and diversity, the dominance and the differences in the composition of assemblages 
and the number of species with a habitat preference. The species richness of butterfly 
assemblages was determined using rarefaction (Smith & van Belle 1984). Diversity 
and dominance were examined using Shannon and Berger-Parker indices (Magurran 
1988), whereas compositional differences between the assemblages were evaluated 
using Euclidean distance. Diversity, dominance and distance between the groups were 
compared using ANOVA. The habitat preference of each species was based on the 
hypothesis that a species has the highest abundance in the most favourable habitat. The 
G-test was used for the examination of two null-hypotheses: 1) Individuals of species 
A are distributed evenly across all habitats. The absence of significant differences 
between even and actual distribution (G-test, G<7.81, <#=3,/?>0.05) was interpreted as 
non-significant habitat preference. 2) The highest abundance of species A does not 
differ from abundances in the other habitats. The other habitats, where the number of 
individuals did not differ significantly from the highest (G-test, G<3.84, <#^l,/?>0.05), 
were also classified as preferred by the species. The species density table was not 
appropriate for the analysis, as the species with the highest density of less than 3 indi- 
viduals per hectare indicated an even distribution across the habitats. Thus, we used 
actual numbers of individuals, which were adjusted to equal the total square of the 
transects in all habitats. The proportion of sites occupied by the species indicated its 
degree of localisation. 



Nota lepid. 25 (4), published 2003: 267-279 271 

Trends of structural variation in the groups of butterfly assemblages were studied by 
principal component analysis (PCA). The factor loadings estimate the participation of 
each assemblage in the separation of species along the principal component. The 
eigenvalue is a measure of this separation. The participation of the principal compo- 
nents with eigenvalues <1 were equated to zero in the separation. Signs and values of 
the factor loadings were used for interpreting the ecological sense of the principal 
components. If the value of the factor loading was <0.7, it was not regarded as signifi- 
cant (Jeffers 1978). In accordance with the trends, the species were relegated to envi- 
ronment groups based on their habitat preference. 

Results 

The transect count data consisted of 3,832 individuals representing 50 species. The 
three most abundant species were Callophrys rubi, Brenthis ino and Pieris napi, which 
accounted for 24% of all individuals. In addition, 12 species were found outside the 
study sites: Carterocephalus palaemon, Papilio machaon, Pieris brass icae, Pontia 
daplidice, Colias hyale, Satyr iumpruni, Glaucopsyche alexis, Issoria lathonia, Vanessa 
atalanta, Vanessa cardui, Nymphalis io and Nymphalis antiopa (nomenclature after 
Kullberg et al. 2002). 

According to &-means clustering of butterfly assemblages the type of vegetation 
was not decisive for the structure of the assemblage, since assemblages in habitats 
with different plant associations could be similar and vice versa. The clustering indi- 
cated four large groups of assemblages (Table 2), after rejection of two mire assem- 
blages which formed independent clusters and were thus excluded from all further 
considerations. The groups were as follows: 1) The peatland group included 
assemblages of both bogs and mires and adjoining dry pine forests. 2) The open 
environment group included assemblages of dry open meadows, roadsides 
and forest habitats situated near open environments. 3) The forest meadow 
group included assemblages of forest meadows and treeless glades with rich veg- 
etation, located apart from open environments. 4) The forest group included 
assemblages of sparsely wooded glades, tracks and small overgrown forest meadows. 
Means of pairwise Euclidean distances within groups indicated that the peatland group 
was the most homogenous one (Table 3). The differences between groups were all 
significant (one-way ANOVA: F=39.75, df=3, 1485, /?<0.0001). 



Tab. 2. Clustering of the butterfly assemblages. Given are numbers of assemblages as represented in the 
four groups revealed by /r-means clustering. Two outlier assemblages at the MIK-sites were excluded 
from the analysis. 

MIR DPF HPK HBF HAF SFM HFM DFM DOM RDS total 



Peatlands 


14 


5 


_ 


_ 


_ 


_ 


_ 


_ 


_ 


_ 


19 


Open environments 


- 


1 


3 


- 


- 


- 


3 


7 


14 


5 


33 


Forest meadows 


- 


2 


4 


2 


- 


4 


8 


5 


- 


1 


26 


Forests 


- 


4 


9 


6 


5 


3 


1 


3 


- 


- 


31 



^ ' ^ Gorbach & Saarinen: Butterfly from Onega Lake Area in Karelia 

Tab. 3. The number of species, the density of individuals, and the similarity, species diversity and 
dominance in the four groups of butterfly assemblages. The differences between groups were significant 
in each category (one-way ANOVA, see Results section). * number of pairwise Euclidean distances to 
be compared. 







Open 


Forest 






Peatlands 


environments 


meadows 


Forests 




n=19 


n=33 


n=26 


n=31 




*n=171 


*n=528 


*n=325 


*n=465 


Number of species observed 










mean 


7.2 


12.9 


10.2 


7.5 


SD 


2.8 


3.9 


3.8 


3.4 


Individuals per hectare 










mean 


49.7 


88.2 


55.2 


34.8 


SD 


45.9 


37.5 


26.5 


28.7 


Euclidean distance* 


' 








mean 


0.128 


0.146 


0.155 


0.158 


SD 


0.029 


0.028 


0.035 


0.036 


Shannon index (H') 










mean 


1.72 


2.27 


1.99 


1.60 


SD 


0.30 


0.29 


0.39 


0.47 


Berger-Parker index (d) 










mean 


0.31 


0.22 


0.29 


0.42 


SD 


0.07 


0.06 


0.11 


0.19 



In the four groups the average number of species was highest in open environments 
and lowest in peatlands (one-way ANOVA: F=16.86, ^=3, 105,/?<0.0001). Accord- 
ing to rarefaction curves, the species richness was rather equally high in open environ- 
ments and forest meadows, and equally low in forests and peatlands (Fig. 2). The 
average density of individuals varied from 34.8 individuals ha" 1 in forests to 88.2 indi- 
viduals ha" 1 in open environments (one-way ANOVA: F=13.46, df=3, 105, p<0. 0001). 
Species diversity was highest in the assemblages of open environments and lowest in 
forest assemblages (one-way ANOVA: F= 19. 19, df=3, 105,/?<0.0001). 

Peatland assemblages were dominated by Boloria aquilonaris , Albulina optilete 
and Callophrys rubi; those of open environments by Pieris napi, Aphantopus hyper antus 
and Nymphalis urticae; those of forest meadows by Erebia ligea, Brenthis ino and 
Gonepteryx rhamni; and those of forests by Brenthis ino. The Berger-Parker index 
indicated the highest dominance in forest assemblages. The differences between groups 
were all significant (one-way ANOVA: F=7.89, df=3, 105,/?<0.0001). 

A total of 47 species exhibited a significant habitat preference as defined in the 
Methods section (Table 4). Five species were observed only in peatlands (Boloria 
eunomia, B. freija, Coenonympha tullia, Erebia embla, Oeneis jutta). Others were 
exclusive to open environments (Pieris rapae, Lycaena hippothoe, Coenonympha 
glycerion) or forest (Par arge aegeria, Erebia euryale). There were 30 species with a 
preference for a single habitat type. The number of species showing distinct habitat 
preferences varied from 7 in forests to 23 in open habitats. The highest localisation of 
the populations across the environments was recorded for Pyrgus malvae, P. alveus, 



Nota lepid. 25 (4), published 2003: 267-279 



273 





*+U " 


S 


Forest 

meadows 




30 




>^ ^^^^ Open 

>^ ^^ 0000 ^ environments 




20 








10 




' ^* Forests 

^^_ - Peatlands 









N 






^^^ 







25 50 75 100 



Fig. 2. Rarefaction curves for the four groups of butterfly assemblages. S - expected number of species, 
N - number of individuals (sample size). 



Aricia eumedon, Boloria freija, B. titania, Euphydryas maturna, Erebia euryale, 
Coenonympha glycerion, Pararge aegeria and Lasiommata petropolitana. 

PCA produced two significant components which together accounted for more than 
75% of the data variance (Table 5). The first component included significant factor 
loadings for assemblages of forests and forest meadows. Along the second axis, the 
butterfly assemblages of open habitats contrasted with those of peatlands. Thus, PCA 
results indicated three main trends in the variation of butterfly abundances: an affinity 
of species to forest environments, open environments, or peatlands (Fig. 3). 



Discussion 

A total of 62 species found in the two localities correspond to 71% of all species 
known from Russian Karelia. Only 12 species previously recorded from the Onega 
Lake area in Karelia were not observed. Of these, some have a more or less disjunct 
distribution in Russian Karelia {Pyrgus centaureae, Lycaena helle, Aricia nicias, 
Argynnis niobe, Boloria frigga, and Coenonympha pamphilus), while others are known 
from a few populations on the shores or islands of Lake Onega (Hesperia comma, 
Parnassius mnemosyne, Maniolajurtina, and Maniola lycaon) or as single finds in the 
area {Colias crocea, Lycaena phlaeas) (Kaisila 1947; Kozlov 1983; Kutenkova 1989). 
In general, only a few local or migrant species distinguish the provincial fauna from 
the faunas of adjacent areas (Peltonen 1947; Kozhantshikov 1958; Sotavalta 1987). 



274 



Gorbach & Saarinen: Butterfly from Onega Lake Area in Karelia 



Tab. 4. Butterfly species and the density of individuals ha" 1 in the four groups of assemblages (M= 
mean, SD= standard deviation). Ps indicates the proportion (%) of the sites in the group occupied by the 



species. The habitat preference of the species is indicated in bold type. 
Nomenclature follows the checklist of Kullberg et al. (2002). 



: no significant preference. 





Peatlands 


Open environments 


Forest meadows 


Forests 






M 


SD 


Ps 


M 


SD 


Ps 


M 


SD 


Ps 


M 


SD 


Ps 


Pyrgus malvae* 


0.1 


0.3 


5 


_ 


_ 


_ 


0.2 


0.6 


10 


_ 


_ 


_ 


P. alveus 


- 


- 


- 


0.5 


2.0 


12 


- 


- 


- 


0.1 


0.7 


3 


Carterocephalus silvicola 


- 


- 


- 


- 


- 


- 


0.2 


0.8 


6 


0.5 


1.5 


16 


Thymelicus lineola 


- 


- 


- 


5.4 


7.3 


70 


0.1 


0.7 


3 


0.1 


0.7 


6 


Ochlodes sylvanus 


- 


- 


- 


3.2 


4.4 


55 


0.3 


0.8 


13 


0.1 


0.5 


6 


Leptidea sinapis 


- 


- 


- 


1.6 


4.9 


24 


0.8 


1.3 


26 


3.2 


11.6 


23 


Anthocharis cardamines 


0.1 


0.3 


11 


1.0 


2.0 


24 


2.2 


2.4 


45 


1.2 


2.4 


35 


Aporia crataegi 


' - 


- 


- 


2.1 


3.9 


33 


0.5 


1.1 


23 


0.1 


0.3 


3 


Pieris rapae 


- 


- 


- 


1.2 


2.9 


21 


- 


- 


- 


- 


- 


- 


P. napi 


- 


- 


- 


10.9 


8.4 


97 


2.8 


4.1 


48 


2.1 


4.2 


42 


Colias palaeno 


3.3 


4.5 


74 


0.1 


0.6 


3 


0.1 


0.4 


6 


0.1 


0.2 


3 


Gonepteryx rhamni 


0.5 


0.9 


26 


5.6 


5.0 


85 


6.1 


6.1 


74 


1.1 


1.4 


52 


Callophrys rubi 


8.4 


11.4 


84 


0.3 


0.9 


12 


3.0 


4.8 


45 


3.2 


3.3 


81 


Lycaena virgaureae 


- 


- 


- 


1.9 


3.8 


36 


0.5 


2.5 


3 


- 


- 


- 


L. hippothoe 


- 


- 


- 


2.5 


8.6 


15 


- 


- 


- 


- 


- 


- 


Celastrina argiolus 


0.3 


0.6 


21 


0.2 


0.7 


12 


0.8 


1.8 


23 


0.8 


1.2 


39 


Aricia artaxerxes 


- 


- 


- 


1.4 


4.6 


18 


0.4 


1.3 


13 


0.1 


0.3 


3 


A. eumedon 


- 


- 


- 


0.6 


2.8 


6 


0.1 


0.7 


3 


0.1 


0.7 


6 


Plebeius argus 


2.6 


3.0 


58 


1.6 


4.3 


24 


0.6 


2.6 


6 


- 


- 


- 


P. Idas 


2.7 


3.2 


63 


0.2 


1.3 


3 


1.2 


3.8 


13 


0.3 


1.8 


3 


Albulina optilete 


9.1 


9.6 


100 


- 


- 


- 


0.2 


0.6 


6 


0.1 


0.2 


6 


Polyommatus semiargus 


- 


- 


- 


2.6 


3.9 


55 


0.5 


1.2 


16 


- 


- 


- 


P. amandus 


- 


- 


- 


3.3 


4.7 


61 


0.4 


1.1 


16 


0.1 


0.1 


3 


P. Icarus 


0.3 


0.9 


11 


4.3 


4.1 


76 . 


0.3 


1.0 


10 


0.1 


0.7 


3 


Argynnis paphia 


- 


- 


- 


2.1 


7.0 


15 


2.6 


8.4 


16 


0.9 


2.5 


19 


A. aglaja 


- 


- 


- 


2.2 


2.8 


52 


2.0 


2.8 


42 


1.3 


3.5 


23 


A. adippe 


- 


- 


- 


1.7 


2.5 


45 


1.0 


1.9 


23 


- 


- 


- 


Brenthis ino 


0.1 


0.1 


5 


2.6 


3.6 


52 


6.5 


7.9 


65 


6.3 


10.0 


84 


Boloria eunomia 


5.1 


8.7 


53 


- 


- 


- 


- 


- 


- 


- 


- 


- 


B. euphrosyne 


0.4 


1.3 


11 


0.1 


0.9 


3 


1.6 


4.4 


13 


0.2 


0.6 


13 


B. selene 


- 


- 


- 


3.6 


4.4 


64 


2.1 


2.9 


45 


1.1 


2.0 


32 


B. titania* 


- 


- 


- 


0.4 


2.6 


3 


0.1 


0.7 


3 


0.2 


0.8 


10 


B.freija 


1.0 


3.5 


11 


- 


- 


- 


- 


- 


- 


- 


- 


- 


B. aquilonaris 


10.7 


9.8 


84 


- 


- 


- 


- 


- 


- 


0.04 


0.2 


6 


Araschnia lev ana 


- 


- 


- 


0.5 


1.5 


18 


0.7 


2.2 


10 


2.0 


5.2 


29 


Nymphalis urticae 


0.3 


0.9 


16 


8.6 


6.1 


94 


2.9 


2.8 


61 


0.3 


0.9 


13 


N. c-album 


- 


- 


- 


1.6 


3.8 


30 


0.9 


1.7 


29 


0.2 


0.5 


13 


Euphydryas maturna 


0.1 


0.4 


5 


0.7 


3.2 


9 


- 


- 


- 


0.1 


0.7 


3 


Melitaea athalia 


— 


- 


- 


0.3 


1.1 


12 


0.6 


1.7 


10 


0.2 


0.9 


6 


Limenitis populi 


- 


- 


- 


0.1 


0.4 


9 


0.3 


1.5 


3 


2.4 


4.5 


35 


Pararge aegeria 


- 


- 


- 


- 


- 


- 


- 


- 


- 


0.6 


2.1 


10 


Lasiommata maera 


0.2 


0.6 


11 


1.2 


1.9 


36 


2.5 


4.1 


42 


0.6 


2.0 


16 


L. petropolitana 


- 


- 


- 


0.1 


0.3 


3 


1.4 


5.2 


10 


- 


- 


- 


Coenonympha tullia 


0.5 


1.4 


11 


- 


- 


- 


- 


- 


- 


- 


- 


- 


C. glycerion 


- 


- 


- 


2.5 


10.0 


12 


- 


- 


- 


- 


- 


- 


Aphantopus hyperantus 


0.1 


0.3 


5 


8.9 


9.1 


82 


0.9 


1.6 


26 


0.5 


1.0 


23 


Erebia ligea 


0.1 


0.3 


11 


0.2 


0.7 


12 


7.5 


9.3 


48 


4.3 


7.1 


68 


E. euryale* 


- 


- 


- 


- 


- 


- 


- 


- 


- 


0.3 


1.1 


10 


E. embla 


1.6 


4.1 


26 


- 


- 


- 


- 


- 


- 


- 


- 


- 


Oeneis jutta 


2.3 


5.3 


21 


- 


- 


- 


- 


- 


- 


- 


- 


- 



Nota lepid. 25 (4), published 2003: 267-279 



275 



Tab. 5. Eigenvalues of the principal components and the factor loadings (values >0.7 in bold) of the four 
groups of butterfly assemblages. 



Principal component 



PC-1 



PC-2 



Eigenvalue 

Cumulative % variance explained 



1.846 
46.2 



1.177 
75.6 



Peatlands 

Open environments 

Forest meadows 

Forests 



0.275 


1.000 


0.508 


-0.823 


1.000 


0.240 


0.924 


0.490 



2,5 



■2,5 







— -x 

rubi 






x— X 1 

opti aqui 


«►lige 












°ino 








idas 
X 


euno 
X 

pala 
X 






sina 

card 

♦ 


♦ P°P U argu 


Xjutt 






♦leva eu Ph argi X 

* silv aege 


X embl 
Xfrei 

x iull 

îatu 

/e 


<► rham 




paph^ a 9 la 
osele 


maer P etr ?tha^ eume 
c-alb atha artaOaT 
^.ChcratO O ai 
; adip oOvirg rapa 








semio o hi PP 










amari(5) gjyc 










O sylv 










icar 










lineo 






urti 

o 






♦ woodland species 


Onapi 


hype 




O grassland species 






O 




X peatland species 



-2,5 



0,0 



PC-1 



2,5 



Fig. 3. PCA ordination diagram of butterfly species (indicated as four-letter codes derived from species 
epithets) along the first two principal components. Seven species printed exactly upon the borders of the 
diagram are due to a reduction in the graphic area. Three groups (collapsing forests and forest meadows, 
see Table 5) were defined according to the highest densities of the species (Table 4), excluding three 
species with no preference for any of the environment groups as they emerged from a A-means clustering. 



The abundance of the majority of butterfly species in the study area was similar to that 
in the Onega Lake area in the 1940s (Kaisila 1947) as well as in SE Finland in the 
1 990s (Marttila et al. 200 1 ). The most abundant species included Pieris napi, Gonepteryx 
rhamni, Callophrys rubi, Brenthis ino, Nymphalis urticae, Aphantopus hyperantus and 
Erebia ligea. In contrast, Papilio machaon, Pieris brassicae, Nymphalis antiopa and 
Boloria euphrosyne had a surprisingly low abundance in the study area. Species with 
relatively discrete populations (e.g., Pyrgus alveus, Boloria titania, Boloria freija, Erebia 



^ 'Q Gorbach & Saarinen: Butterfly from Onega Lake Area in Karelia 

euryale and Pararge aegeria), in addition to other local species, are probably the most 
vulnerable in the provincial fauna, although some had rather high abundances in par- 
ticular sites. 

Butterflies in the Onega Lake area are concentrated in more or less open habitats 
within forests, including peat bogs and mires, and non-cultivated areas in arable land- 
scapes. The average density of butterflies was rather similar in comparison to other 
studies carried out in the middle and southern taiga. In a pine bog in SE Finland, 
Väisänen (1992) reported 58 individuals ha" 1 . In arable landscapes in Finnish and Rus- 
sian Karelia, 45 to 101 individuals ha" 1 were recorded on field boundaries (Saarinen & 
Jantunen 2002). In addition, the lists of dominant and common species commonly 
coincided. Some differences may be due to the fluctuation of butterfly populations 
between the years. In addition, the number of species and the total density in the as- 
semblages varied substantially. The phenomenon is a consequence of two reasons. 
Firstly, the assemblages with varying number of species and total density were united 
into a few groups according to their similarity of structure. For example, the highest 
variation in total density was recorded in the peatland group, which was an amalgama- 
tion of more abundant assemblages of peat bogs and mires and less abundant assem- 
blages of dry pine forests. Differences in their structure, however, were the lowest 
among the four groups of assemblages. Secondly, the quality of the environment for 
species may differ even between similar habitats. This effect, however, is impossible 
to assess without detailed investigation of many factors. No doubt the most important 
ones are the presence of a sufficient number of food plants for larvae and adults, and a 
favourable meso- and microclimate (e.g., Holl 1995; Dover et al. 1997). It is also 
necessary to take into consideration the position of a habitat in the surrounding land- 
scape matrix and its degree of isolation. Some species are mobile and counts may 
reflect the attraction of individuals to nectar sources (Pollard 1977). For example, the 
flowering of Potentilla palustris resulted in a high density of Boloria aquilonaris, 
while the concentration of another abundant species, Callophrys rubi, was a conse- 
quence of the flowering of Chamaedaphne calyculata and Ledum palustre. Hence the 
presence and the density of butterfly species may strongly depend on the abundance of 
these plants in the habitat. In the majority of cases, however, the number of species and 
the high density of individuals did not result from trophic migration of adult butter- 
flies, but seems to indicate the most favourable habitats. Butterfly movements are 
commonly short (e.g., Scott 1975; Ehrlich 1984; Thomas 1984) and the migration of 
individuals to suitable habitats is in most species not a mass phenomenon (e.g., Demp- 
ster 1991; Shreeve 1992; Hanski & Kuussaari 1995). The intensity of migration may 
depend on distance and the availability of natural barriers between habitats. The effect 
of a possible concentration of butterflies in small areas within the boundaries of one 
site was reduced by using several transects spread evenly across each site. 

The structure of the assemblages was characterised by indices of species diversity 
and dominance, which are inversely correlated with each other; the higher the diver- 
sity, the lower the dominance. Low species diversity and higher dominance in the 
peatland assemblages may be explained by extreme levels of humidity and specific 
plant associations, while forest assemblages were impoverished by the most shady 



Nota lepid. 25 (4), published 2003: 267-279 277 

conditions and the poverty of ground layer vegetation. Consequently, these habitats 
were unsuitable for most species, and those observed usually appeared in small num- 
bers. In contrast, higher species diversity and low dominance in the assemblages of 
open environments indicated that habitats are suitable for the majority of species in the 
study area. 

The most important differences between the assemblages are due to a great extent 
to the habitat-specific species. In general, our results further endorsed previous knowl- 
edge of the habitat preferences of butterflies in the boreal zone (Marttila et al. 2000). 

Based on the analyses of the structural variation we conclude that the peatland 
group is distinct from the rest. This fauna is mainly composed of tyrphobiont and 
tyrphophilous species. Due to their close association with peatlands, the ability of the 
latter in regard to transition to other habitats is extremely limited (Mikkola & Spitzer 
1983). Most butterfly species, however, are able to utilize different habitats, even though 
in different abundances. Thus, the assemblages from forest and open environments did 
not differ significantly with respect to species composition, but abundances of the 
species varied substantially. In general, the separation of the fauna into woodland and 
grassland species is a result of the anthropogenic transformation of a once continuous 
coniferous forest cover. Prior to human alteration of pristine landscapes, species pre- 
ferring open habitats apparently existed as small populations in forest openings, such 
as glades and unforested bedrock, as well as on shore meadows. Later on, these spe- 
cies moved into anthropogenic meadows and due to increasing numbers of individu- 
als, they have become noticeable elements of the fauna. The assemblages of forest 
meadows can be considered as a transitional stage to open meadow assemblages. This 
standpoint conforms to Nitzenko's (1969) hypothesis about the origin of meadow plant 
associations in the middle taiga. Due to the trophic specialisation of butterflies, we 
may suppose that butterfly species followed their host plants on to the meadows. The 
increase in numbers of individuals was probably caused by a gradual increase of food 
resources, with many herbs finding more favourable conditions in open habitats. In 
addition, some butterflies might penetrate from southerly areas and so form resident 
populations in suitable sites. The formation of a butterfly assemblage in meadows was 
accompanied by an increase in species diversity, as numerous grassland species ap- 
peared in addition to abundant and common woodland species. The overgrowing of 
meadows leads to the impoverishment of the species composition and a reduction in 
total abundance in the butterfly assemblage. This is illustrated in deciduous forests in 
the taiga zone, which according to Ramenskaya (1958) are a result of the overgrowth 
of meadows due to lack of management. We predict that the structure of any local 
fauna in the middle taiga is defined by the proportion of peatland, forest and open 
environments in the area and the heterogeneity of the habitats available in the land- 
scape matrix. 



Acknowledgements 

The authors gratefully acknowledge Ernest V. [vanter, Sergei D. Uzenbaev, Andrei V. Korosov and 
Nadezhda N. Kutenkova for their support and help in the study. We are also indebted to Leigh Plester 
and two anonymous referees for valuable comments on the manuscript. 



^ ' ö Gorbach & Saarinen: Butterfly from Onega Lake Area in Karelia 

References 

Ahti, T., Harriet- Ahti, L. & Jalas, J. 1968. Vegetation zones and their sections in northwestern Europe. - 

Ann. Bot. Fen. 5: 169-211. 
Dempster, J. P. 1991. Fragmentation, isolation and mobility of insect populations. Pp. 143-153 in: N. M. 

Collins & J. A. Thomas (eds.), The conservation of insects and their habitats. -Academic Press, San 

Diego, CA. 
Dover, J. W., Sparks, T. H. & Greatorex-Davies, J. N. 1997. The importance of shelter for butterflies in 

open landscapes. - J. Insect Conserv. 1: 89-97. 
Ehrlich, P. R. 1984. The structure and dynamics of butterfly populations. Pp. 25-40. In: R.I. Vane- 
Wright & PR. Ackery (eds.), The biology of butterflies. -Academic Press, London, UK. 
Gromtzev, A. N. 1993. [Landscape conformities to natural laws of structure and dynamics of mid-taiga 

pine forests in Russia]. - Karelian Res. Cent. Rus. Sei. Acad., Petrozavodsk. 160 pp. [russ.]. 
Günther, A. K. 1896. [List of Lepidoptera found in Olonets province]. - Izv. St. Petersb. Biol. lab. 1: 21- 

33. [russ.]. 
Hanski, I. & Kuussaari, M. 1995. Butterfly metapopulation dynamics. Pp. 149-171. In: N. Cappuccino 

& P.W. Price (eds.), Population dynamics: New approaches and synthesis. - Academic Press, San 

Diego, CA. 
Holl, K. D. 1995. Nectar resources and their influence on butterfly communities on reclaimed coal 

surface mines. - Restoration Ecol. 3: 76-85. 
Ivanter, E. V & Kuznetsov, O. L. (eds.) 1995. [Red data book of Karelia]. - Karelia, Petrozavodsk. 286 

pp. [in Russian]. 
Jeffers, J. N. R. 1978. An introduction to systems analysis: with ecological applications. -Arnold, London. 

198 pp. 
Kaisila, J. 1944. Züge aus der Schmetterlingsfauna der Umgebung von Karhumäki in Ostkarelien. - 

Ann. Ent. Fen. 10: 104-122. 
Kaisila, J. 1945. Züge aus der Schmetterlingsfauna der Umgebung von Karhumäki in Ostkarelien. - 

Ann. Ent. Fen. 11: 113-117. 
Kaisila, J. 1947. Die Macrolepidopteren Fauna des Aunus-Gebietes. -Acta Ent. Fen. 1: 4-112. 
Karvonen, V J. 1945. Beobachtungen über die Insektenfauna in den Gegend von Vaaseni am mittleren 

Lauf der Suwari (Swir). -Ann. Ent. Fen. 11: 39-54. 
Kotiranta, H., Uotila, P, Sulkava, S. & Peltonen, S.-L. (eds.) 1998. Red data book of East Fennoscandia. 

- Ministry of the Environment, Finnish Environment Institute and Botanical Museum, Finnish Mu- 
seum of Natural History, Helsinki. 351 pp. 
Kozhantshikov, I. V 1958. [New facts in the study of fauna and ecology of the Lepidoptera of Karelian 

Isthmus]. - Proc. Zool. Inst. Acad. Sei. USSR 24: 3-88. [in Russian]. 
Kozlov, M. V 1983. .[Materials on fauna of Lepidoptera, Rhopalocera of Nature Reserve Kivach (Karelian 

ASSR)]. - Pp. 1-10, Leningrad, [russ., manuscript deposited in the All-Union Institute of Science 

and Technical Information, St. Petersburg] . 
Kullberg, J., Albrecht, A., Kaila, L. & Varis, V 2002. Checklist of Finnish Lepidoptera - Suomen perhosten 

luettelo. - Sahlbergia 6: 45-190. 
Kutenkova, N. N. 1986. [Lepidoptera of Nature Reserve Kivach]. Pp. 123-158 in: E. B. Yakovlev & S. 

D. Uzenbaev (eds.), [Fauna and ecology of arthropods in Karelia]. -Acad. Sei. USSR, Petrozavodsk: 

Karelian Centre of the USSR Academy of Sciences. [In Russian]. 
Kutenkova, N. N. 1989. [Lepidoptera of Nature Reserve Kivach. Flora and Fauna of Nature Reserves of 

the USSR]. - Moscow. 59 pp. [In Russian]. 
Lahtivirta, K. 1939. Havaintoja Terijoen pitäjän Kuokkalan alueen suurperhosfaunasta. -Ann. Ent. Fen. 

5: 125-140. 
Legendre, P. & Gallagher, E.D. 2001. Ecologically meaningful transformations for ordination of species 

data. - Oecologia 129: 271-280. 
Magurran, A. E. 1988. Ecological diversity and its measurement. - Princeton University Press, Princeton, 

NJ. 179 pp. 
Marttila, O., Saarinen, K., Aarnio, H., Haahtela, T. & Ojalainen, P. 2000. Päiväperhosopas. Suomi ja 

lähialueet. - Tammi, Helsinki. 232 pp. 



Nota lepid. 25 (4), published 2003: 267-279 279 

Marttila, O., Saarinen, K. & Lahti, T. 2001. Valtakunnallinen päiväperhosseuranta - Ensimmäisen 10- 

vuotisjakson (1991-2000) tulokset. - Baptria 26: 29-65. 
Mikkola, K. & Spitzer, K. 1983. Lepidoptera associated with peatlands in central and northern Europe: 

a synthesis. - Nota lepid. 6: 216-229. 
Möberg, K. 1925. Beiträge zur Kenntnis der Lepidopterenfauna des Leningrad Gouvernements. -Ann. 

Zool. Mus. Acad. Sei. USSR 24: 277-328. 
Nitzenko, A.A. 1969. [A contribution to the history of formation of recent types of parvifoliate forests in 

the north-west of the European part of the USSR]. - Botan. J. 54: 3-12. [in Russian]. 
Peltonen, O. 1947. Vienan perhosfaunasta. -Ann. Ent. Fen. 13: 131-144. 
Pollard, E. 1977. A method of assessing changes in the abundance of butterflies. - Biol. Conserv. 12: 

115-134. 
Pollard, E. & Yates, T. J. 1993. Monitoring butterflies for ecology and conservation. The British butterfly 

monitoring scheme. - Chapman & Hall, London. 274 pp. 
Ramenskaya, M. L. 1958. [Meadow vegetation in Karelia]. - Gosizdat KASSR, Petrozavodsk. 400 pp. 

[in Russian]. 
Romanov, A. A. 1961. [About climate of Karelia].- Gosizdat KASSR, Petrozavodsk. 140 pp. [in Russian]. 
Saarinen, K. & Jantunen, J. 2002. A comparison of butterfly fauna of agricultural habitats under diffe- 
rent management history in Finnish and Russian Karelia. -Ann. Zool. Fen. 39: 173-181. 
Saarinen, K., Jantunen, J. & Gorbach, V. V. 2002. Päiväperhoset Suomen ja Venäjän Karjalan 

maatalousympäristöissä. - Baptria 27: 69-74. 
Scott, J. A. 1975. Flight patterns among eleven species of diurnal Lepidoptera. - Ecology 56: 1367- 

1377. 
Shreeve, T. G 1992. Monitoring butterfly movements. Pp. 120-128. In: R. L. H. Dennis (ed.), The 

ecology of butterflies in Britain. - Oxford University Press, Oxford. 
Smith, E. P. & van Belle, G 1984. Nonparametric estimation of species richness. - Biometrics 40: 119- 

129. 
Sotavalta, O. 1987. Provincial distribution of Finnish Macrolepidoptera. - Notulae Entomol. 67: 187— 

205. 
Thomas, J.A. 1984. The conservation of butterflies in temperate countries: past efforts and lessons for 

the future. Pp. 333-353. In: R. I. Vane- Wright & P. R. Ackery (eds.), The biology of butterflies. - 

Academic Press, London, UK. 
Volkov, A. D., Gromtsev, A. N. & Erukov, G V. 1990. [Ecosystems of landscapes of west middle taiga]. 

- Karelia, Petrozavodsk. 284 pp. [in Russian]. 
Väisänen, R. 1 992. Distribution and abundance of diurnal Lepidoptera on a raised bog in southern Finland. 

-Ann. Zool. Fen. 29: 75-92. 
Yakovlev, F. S. & Voronova, V. S. 1959. [Types of forests in Karelia]. - Karelia, Petrozavodsk. 190 pp. 

[in Russian]. 



^"^ Book revie w 

Book Review 

Kudrna, O., 2002. The Distribution Atlas of European Butterflies. - Oedippus 20: 1-342. 
Naturschutzbund Deutschland e.V. & Gesellschaft für Schmetterlingsschutz e.V. in coopera- 
tion with Apollo Books, Stenstrup, Denmark. - ISBN 87-88757-56-0. Price: € 50.00. 

This book embodies the first tangible result of a very ambitious undertaking, the ongoing project Map- 
ping European Butterflies (MEB). Conceived and headed with remarkable energy and determination by 
the well-known lepidopterist Dr. Otakar Kudrna, this project has been made possible by the selfless 
participation of as many as 254 contributors. It has only taken about six years to get this far - not a small 
feat considering the multitude of bureaucratic, logistical, methodological and financial obstacles that 
have plagued MEB from the beginning. These preliminary statistics are impressive and this book will 
surely attract considerable interest. 

Kudrna's views on butterfly taxonomy and conservation present many points of interest. The check- 
list of species makes fascinating reading for those with a penchant for taxonomy and nomenclature of 
European butterflies, whether they agree with Kudrna's opinions or not. His views on the often bureau- 
cratic approach to butterfly study and conservation in Europe are doubtlessly going to find a sympathetic 
audience. On the taxonomic side, I personally applaud the decision to 'lump' many traditionally recog- 
nized genera (e.g. Brintesia, Kanetisa, Chazara, Pseudochazara, Neohipparchia, Pseudotergumia, 
Parahipparchia, Arethusana, Satyrus and Minois are all rolled into Hipparchid) which I see as a step in 
the right direction - away, that is, from the splitter-dominated mentality of the past several decades. The 
species list likewise presents numerous points of interest to the taxonomist, and will stir up a storm of 
conflicting opinions depending on one's side on the splitter/lumper barricade. I found myself in agree- 
ment with e.g. the treatment of Pieris balcana, Coenonympha darwiniana, C. elbana, Polyommatus 
sagratrox and P. abdon as belonging to P. napi, C. gardetta, C. Corinna, P. golgus and P. icarus respec- 
tively. On the other hand, treating e.g. Colias werdandi, Coenonympha iphioides, Erebia arvenensis 
[recte arvernensis], E. serotina, Hipparchia amymone, H. tisiphone, Polyommatus exuberans and P. 
violetae as bona species seems poorly if at all justified. The taxon Callophrys butlerovi is not a synonym 
of C. rubi (Kudrna 1996) but of C. suaveola (Gorbunov 2001). Polyommatus fulgens is not a synonym of 
P. ripartii as it belongs to a species group with blue, not brown males. Polyommatus menelaos, endemic 
to Mt. Taygetos (S Greece), is not even mentioned as a synonym under either P. eros or P. eroides. Two 
other recently described Polyommatus are also omitted without explanation: P. slovacus, a bivoltine 
relative of the univoltine P. coridon, and P. andronicus, a univoltine montane taxon endemic to the 
Balkans and closely related to the ubiquitous plurivoltine P. icarus. However, Kudrna's book is not 
intended as a comprehensive taxonomic revision of the European butterfly fauna and certainly should 
not be regarded as such. So let us concentrate on its main point: the distribution of the European butter- 
flies. 

The 45 1 maps look good though their typographical quality could be better. Records are mapped by 
means of three symbols according to date. Because of the controversial status of some taxa, or the 
inability of all recorders to differentiate between similar species, in many cases several such taxa had to 
be united and plotted on a single map. 

The geographical scope is probably one of the main selling points of the book. In a most welcome 
departure from the annoying tradition of 'European' butterfly guides, it includes the eastern part of the 
continent up to its natural eastern border with Asia (the Urals), while North Africa is rightly excluded. 
However, the choice of an arbitrary south-eastern border for Europe - across the foothills and plains 
north of the Caucasus - is poor judgement. The border between Europe and Asia in the area between the 
Caspian and Black Seas lies unambiguously along the main ridge of the Great Caucasus, just as the main 
ridge of Ural Mts. forms the eastern border between these two continents. Excluding the northern Great 
Caucasus from Kudrna's 'Europe' is unfortunate, as this is a region very rich in butterfly species (at least 
196), no fewer than 21 of which occur nowhere else in Europe (Gorbunov 2001). There are a few false or 
doubtful identities. The records of "Colias hyale" from the southern Balkans are, in my opinion, suspect 
and most probably refer to misidentified specimens of the similar C alfacariensis; true hyale has so far 



Book review 



281 



been found in the northern and central Balkans only. The records of "Spialia sertorius" from the south- 
ern part of the Balkan Peninsula actually refer to S. orbifer, while those of "Plebejus pylaon" from 
Greece and Crimea belong to P. sephirus. The closely related and probably conspecific taxa Aricia 
artaxerxes and A. montensis are shown in two separate maps, according to which both taxa occur in the 
Iberian Peninsula (moreover, the dots are exactly the same on both maps): a clear error, as only montensis 
occurs there (Tolman & Lewington 1997). The records of"Polyommatus eros" from polar Ural belong 
to P. kamtshadalis (Gorbunov 2001). The dot marking the occurrence of "Hipparchia cingovskii" in NW 
Greece is attributable to "H. [mniczechii] tisiphone"; cingovskii is endemic to the Republic of Macedo- 
nia (Tolman & Lewington 1997). But all these are trivial points. The most serious problem of MEB is the 
project's very core, the Reference Locality System (RLS) for data mapping. To put it simply, it does not 
work, and below I am going to show why this is so. 

Kudrna argues that existing mapping systems and particularly the popular UTM (Universal Trans- 
verse Mercator) grid system are unsuitable for the purposes of MEB. He writes (p. 9): "[The UTM grid] 
would be a wonderful universal system if the Earth were flat, which it is not. Because the Earth is round 
compensating triangles are necessary to counterbalance the squares. This means that the ideally shaped 
square, the only true reason for using this system, is not generally available on the map." This puzzling 
statement shows that Kudrna has missed the idea of UTM by a very wide margin indeed, which is 
remarkable considering how simple it is: to identify each point on the Earth's surface by means of a 
unique 'map address', i.e. full UTM coordinates measured east and north from two perpendicular refer- 
ence baselines. Which the UTM does quite well, hence its popularity. Besides, an increasingly important 
practical reason to use UTM in mapping distributions of living organisms is that the use of GPS receiv- 
ers in the field is rapidly becoming a popular way for determining the precise coordinates of localities, 
and most GPS receivers offer UTM as a coordinate system option. Kudrna deems working directly with 
latitude/longitude data equally unsuited for MEB as the use of co-ordinates "would have made the data 
subject to many errors and their input very awkward, and certainly subject to further errors" (p. 10). This 
statement is ironic since the author's own system can - and does - produce errors of unsurpassed mag- 
nitude. The subsequent claim that "it is much easier to check any record under the name of a reference 
locality [see the definition below] than under the impersonal geographical co-ordinates" (p. 10) is sim- 
ply ludicrous. All these introductory remarks on the subject of mapping do nothing to boost one's belief 
in the author's competence and ability to design a functioning mapping system. For, having decided that 
no existing system lives up to MEB, this is exactly what he has done. The prototype is an obsolete 
invention from Communist Czechoslovakia (Kudrna is Czech-born) where until 1989 the general use of 
detailed topographical maps was forbidden. Under these conditions "a useful system of pre-selected 
localities referring to map 'squares'" has been designed. Not deterred by the fact that the socio-political 
environment in which this system had been conceived is long since extinct, the author applies it, under 
the name Reference Locality System (RLS), to the whole of Europe. This is supported with the argument 
that apart from the Czech Republic "a similar system is also being used in Norway and possibly [my 
italics] in other European countries" (p. 10). At the same time, the rejection of UTM is backed with the 
claim that "the UTM grid is not a standard European system" (p. 9). This may be so - but RLS does not 
come even close. The examples of comprehensive projects using UTM for mapping the distributions of 
various groups of organisms, including butterflies, are just too numerous to be listed here. But let us 
judge RLS on its own merits. 

The basic idea of the RLS is to convert coordinates of real localities into coordinates of "reference 
localities" (RLs), meaning human settlements or, exceptionally, prominent landmarks (such as mountain 
summits) rather arbitrarily picked out of the Times Atlas. 1 hcsc arc then plotted into a 60' * 30' (called 
by Kudrna "30 1 x 60"') grid by a computer program specially written lor MEB. Theoretically this proce- 
dure might work quite well for a densely populated territory (such as the ( !zech Republic) where one can 
hope to find a convenient RL for most if not all actual localities. But huge territories in northern Europe 
are much more sparsely populated. There is a tacit admission of this 'inconvenience' since tens of locali- 
ties not found in the Times Atlas map have been added in the case of Russia. Even so, the map on p. 32 
shows that eastern Europe has many 60' * 30' grid units not covered by a single RL. Finally, the density 
of RLs varies immensely between countries, and one wonders how Kudrna has decided what is a suffi- 
cient number of RLs for a given country: witness the disparity between Bulgaria (111 000 km 2 , 110 RLs) 



282 



Book 



and its southern neighbour Greece (132000 km 2 , 372 RLs), or between Italy (301000 km 2 , 797 RLs) and 
Finland (338000 km 2 , 230 RLs)! This means an extremely uneven RL/km 2 coverage, which in turn 
means that the distance between a random locality and the nearest RL will vary greatly. While it should 
be obvious to anyone that such factors should never be allowed to bias the performance of any mapping 
system, they are unfortunately by no means the worst flaws of MEB's RLS. 

The handbook for recorders (Kudrna 1996) details the procedure for compiling records in RLS- 
compatible form. Each recorder is provided with 1) a species list, 2) a list of RLs for the respective 
country, 3) detailed instructions for filling in the forms, down to the type of pen and colour of ink to use, 
and 4) a photocopy of the relevant country map from the Times Atlas. For each actual locality the 
recorder is to 1) determine the nearest pre-approved RL from the map, and either 2a) fill in the name of 
that RL in the appropriate field, or 2b) if there is "good reason" to use a RL which is on the Times Atlas 
map but not on the list, its coordinates must be written down as given in the Times Atlas. With these clear 
instructions, can anything possibly go wrong? Oh yes. 

RLS might have actually worked had Kudrna taken the extra step of sending the recorders, together 
with the copy of the map, the -actual grid in which the dots will finally appear. This would have been vital 
considering the way RLS works, which shall be demonstrated with the aid of the following hypothetical 
situation (Fig. la). A, B and C are legitimate RLs and the black dot marks the site X of a butterfly record. 
Following Kudrna's instructions there is no difficulty in converting X to the clearly nearest RL, C. The 
recorder's job is done and the computer's job begins. It should be remembered at this point that the 
mapping software will plot the co-ordinates of the RL in 60' x 30' grid. Let us also keep in mind that we 
have no idea what this grid is nor is there anything in the detailed instructions to suggest to us that it is of 
any significance. The grid has therefore not influenced our choice, but it does influence that of the 
computer. So the program, using the pre-programmed (hypothetical) grid (Fig. lb), plots the dot (Fig. 
lc). Well, this is just what one expects of a properly working mapping system: the dot and the actual 
locality are in the same grid unit. But in fact this is a matter of pure chance in the case of RLS, as in 
exactly the same situation (Fig. 2a) the grid might as well be something like in Fig. 2b . . . 




Now this is not what one expects of a properly working system. And this is why Kudrna's RLS is not 
one. Had the grid been available to recorders together with instructions to choose not the nearest RL but 
one in the same grid unit as the actual locality, the system would have worked, though clumsily. But no. 
RLS can therefore only work for localities situated either inside or in the immediate vicinity of the pre- 
approved RLs. One may object that in the densely populated regions of western and central Europe there 
is a good chance that a random actual locality and the nearest RL will happen to be situated in the same 
grid unit. This may indeed be so, but what practical value does this system have if, looking at the maps, 
one can never be sure whether a given dot is in the same grid unit as the locality represented by that dot? 
Moreover, it is easy to see that the probability of error increases dramatically with the increase of dis- 
tances between RLs, as in northern or eastern Europe. There our example may well look like Fig. 3. In 
fact, in very sparsely populated regions the probability that a random locality and the nearest RL (mean- 
ing the final dot) will happen to be in the same grid unit becomes very slim. 



x . izzzxzzfzzzx 

c» c» I S 



? 







Book review 



283 



The above example is purely hypothetical but the point it makes is only too real. No great effort is 
needed to detect such errors on the maps in the book. As an example let us take the distribution of the 
following 17 species in the Pyrenees: Boloria napaea, B. pales, Colias phicomone, Erebia arvenensis 
[sic], E. epiphron, E. gorge, E. gorgone, E. hispania, E. lefebvrei, E. manto, E. oeme, E. pronoe, E. 
sthennyo, Pieris callidice, Polyommatus eros, Pyrgus andromedae and P. cacaliae. These all have a dot 
(marked with an arrow) in the grid containing the city of Toulouse, as exemplified by the distribution of 
Erebia sthennyo and E. pronoe (Fig. 4b). However these species are found in the subalpine and alpine 
zone of the Pyrenees, generally above 1500 m (Tolman & Lewington 1997), while the area inside the 
grid in question does not exceed 500 m altitude (Fig. 4a) - in fact most of it is even below 200 m. The 
'presence' of such a species-rich, specialized high-mountain butterfly fauna in the lowlands covered by 
this grid unit is clearly an artifact of MEB's system. 

In conclusion, this book fails to deliver what the back cover so exuberantly promises: that "for the 
first time Europe will be the first continent ever to have all its butterfly species plotted on precise and 
comprehensive distribution maps". While one might put up with the fact that many of these maps are far 
from being comprehensive (which is only natural), or that not all European species are included (which 
could be corrected in subsequent editions), the fact that the maps are inherently imprecise can neither be 
overlooked nor downplayed. The points appealing to me personally, such as some of Kudrna's bold and 
unorthodox views on butterfly taxonomy and conservation, are side issues in a work purporting to be 
above all a distribution atlas. In this light I consider € 50 an exorbitant price for a volume that, in 
addition to being of little if any practical use, has soft cover and less-than-excellent print on rough, 
cheap-looking paper. 

Yet all of the above pales next to the staggering realization that the most valuable asset of MEB, the 
huge and in other circumstances priceless database which has taken countless hours of enthusiastic 
labour to compile, has been 'polluted' beyond repair due to flawed methodology. As this database con- 
tains no actual latitude/longitude data, there is no way to convert the records back into a meaningful 
form. Unfortunately, Kudrna's system can neither be mended nor improved: it can only be scrapped. The 
only way forward is then to start from square one. And preferably a UTM one at that. 



References 

Gorbunov, P. Y., 2001. The butterflies of Russia: classification, genitalia, keys for identification 
(Lepidoptera: Hesperioidea and Papilionoidea). - Thesis, Ekaterinburg. 320 pp. 

Kudrna, O., 1996. Mapping European Butterflies: Handbook for Recorders. - Oedippus 12: 1-60. 

Tolman, T W. & Lewington, R. 1997. Butterflies of Britain and Europe. - Collins Field Guide Series, 
Harper Collins Publishers, 320 pp., 104 pis. 



Zdravko Kolf.v 



Nota lepidopterologica 

Ajournai devoted to the study of Lepidoptera 
Published by the Societas Europaea Lepidopterologica e. V. 

Editor in chief: Prof. Dr. Konrad Fiedler, Lehrstuhl für Tierökologie I, Universität Bayreuth, 

D-95440 Bayreuth, Germany; e-mail: konrad. fiedler^uni-bayreuth. de 

Managing Editor. Dr. Matthias Nuß, Staatliches Museum für Tierkunde, Königsbrücker Landstr. 159, 

D-01109 Dresden, Germany; e-mail: matthias.nuss^snsd.smwk.sachsen.de 

Assistant Editors: Dr. Enrique Garcia-Barros (Madrid, E), Dr. Roger L. H. Dennis (Wilmslow, UK), 

Dr. Peter Huemer (Innsbruck, A), Ole Karsholt (Kobenhavn, DK), Dr. Yuri P. Nekrutenko (Kiev, 

UA), Dr. Erik J. van Nieukerken (Leiden, NL), Dr. Wolfgang Speidel (Bonn) 



Contents • Inhalt • Sommaire 
Volume 25 Halle / Saale, 16. 06. 2003 ISSN 0342-7536 

Baran, T.: Elachista nolckeni Sulcs, 1992: morphology and bionomics of 

immature stages (Gelechioidea: Elachistidae) 97 

Belik, A. G. & D. G. Zamolodchikov: Notes on systematics of the Erebia 
dabanensis species complex, with special consideration of the 
dabanensis-youngi and anyuica-occulta pairs of sibling species 
(Nymphalidae: Satyrinae) 61 

Elsner, G & J. Jaros: A new species of Ceratoxanthis Razowski, and 
distribution records for two species of Aethes Billberg from the Balkan 
Peninsula (Tortricidae: Cochylini) 221 

Freese, A. & K. Fiedler: Experimental evidence for specific distinctness 
of the two wood white butterfly taxa, Leptidea sinapis and L. reali 
(Pieridae) 39 

Fiedler, K. & C. Ruf: Araschnia levana larvae (Nymphalidae) do not 

accept Humulus lupulus (Cannabaceae) as food plant 265 

Garcïa-Barros, E.: Taxonomic patterns in the egg to body size allometry 

of butterflies and skippers (Papilionoidea & Hesperiidae) 161 

Gorbach, V. V. & K. Saarinhn: The butterfly assemblages of Onega Lake 

Area in Karelia, middle taiga of NW Russia (Hesperioidea, Papilionoidea) 267 

Huemer, P. & O. Karsholt: A review of the genus Acompsia Hübner, 

1825 with description of new species (Gelechiidae) 109 



Rallies, A. & K. Spatenka: Four species of Brachodidae new to the 

fauna of Europe (Sesioidea) 155 

Karsholt, O. & A. Kun: A new species of Ethmia Hübner, 1819 from 

the Greek island of Rhodes (Ethmiidae) \ 207 

Kolev, Z.: The species of Maculinea van Eecke, 1915 in Bulgaria: 

distribution, state of knowledge and conservation status (Lycaenidae) 177 

Lvovsky, A. L.: Check-list of the broad- winged moths (Oecophoridae s. I) 

of Russia and adjacent countries 213 

Nieukerken, E. J. v. & A. Lastoûvka: Ectoedemia (Etainia) obtusa 
(Puplesis & Diskus, 1996) new for Europe: taxonomy, distribution 
and biology (Nepticulidae) 87 

Ringwood, Z., T. Gardiner, A. Steiner & J. Hill: Comparison of factors 
influencing the habitat characteristics of Gortyna borelii (Noctuidae) 
and its larval foodplant Peucedanum officinale in England and Germany 23 

Rougerie, R. : Re-capture of Sinobirma malaisei in China: description of 
the female genitalia and comments on the systematic position of the 
genus in the tribe Urotini (Saturniidae) 227 

Sarto i Monteys, V.: The discovery, description and taxonomy of 
Paysandisid archon (Burmeister, 1880), a castniid species recently 
found in southwestern Europe (Castniidae) 3 

Sielezniew, M., A. Stankiewicz & C. Bystrowski: First observation of 

one Maculinea avion pupa in a Myrmica lobicornis nest in Poland 249 

Sommerer, M. D.: Opinion. To agree or not to agree - the question of 
gender agreement in the International Code of Zoological 
Nomenclature 191 

Speidel, W. & L. Aarvik: Synonyms of European Tortricidae and Noctuidae, 

with special reference to the publications of Hübner, Geyer and Frölich 17 

Wagener, S.: Chazara persephone (Hübner, [1805]) or Chazara anthe 

(Hoffmansegg, 1806) - what is the valid name? (Nymphalidae, Satyrinae) 81 

Wakeham-Dawson, A., R. Parker, E. John & R. L. H. Dennis: Comparison of 
the male genitalia and androconia of Pseudochazara anthelea acamanthis 
(Rebel, 1916) from Cyprus, Pseudochazara anthelea anthelea (Hübner, 
1924) from mainland Turkey and Pseudochazara anthelea amalthea 
(Frivaldsky, 1845) from mainland Greece (Nymphalidae, Satyrinae) 251 



WiLCOCKSON, A. & T. G. Shreeve: The subspecific status of Pieris napi 

(Pieridae) within the British Isles 235 

Book Reviews 16, 22, 60, 79, 108, 152, 176, 226, 234, 248, 264, 280-283 

Erratum 2 



SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e. V. 



Nota lepidopterologica wird den Mitgliedern der SEL zugesandt. Die Mitgliedschaft bei SEL steht 
Einzelpersonen und Vereinen nach Maßgabe der Satzung offen. Der Aufnahmeantrag ist an den Mit- 
gliedersekretär Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgien; e-mail: 
Willy.Deprins@village.uunet.be zu richten. Das Antragsformular ist im Internet auf der Homepage 
der SEL unter http://www.zmuc.dk/EntoWeb/SEL/SEL.htm erhältlich. 

Der Mitgliedsbeitrag ist jährlich am Jahresanfang zu entrichten. Er beträgt für Einzelpersonen € 35,00 
bzw. für Vereine € 45,00. Die Aufnahmegebühr beträgt € 2,50. Die Zahlung wird auf das SEL-Konto 
1956 50 507 bei der Postbank Köln (BLZ 370 100 50) erbeten. Mitteilungen in Beitragsangelegenheiten 
sind an den Schatzmeister Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail: 
Sommerer.Manfred@t-online.de zu richten. 

Der Verkauf von Einzelheften und älteren Jahrgängen von Nota lepidopterologica sowie der Verkauf der 
Zeitschrift an Nichtmitglieder erfolgt durch Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Däne- 
mark; e-mail: apollobooks@vip.cybercity.dk. 
Adressenänderungen bitte sofort dem Mitgliedersekretär oder dem Schatzmeister mitteilen! 

Nota lepidopterologica is sent to the members of SEL. The membership is open to individuals and 

associations as provided for by the statutes of SEL. Applications for membership are to be addressed to 

the membership secretary Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgium; e-mail: 

Willy.Deprins@village.uunet.be. The application form will be found on the SEL Homepage http:// 

www.zmuc.dk/EntoWeb/SEL/SEL.htm. 

The annual subscription is to be paid at the beginning of the year. It is € 35.00 for individuals or € 45.00 

for associations. The admission fee is € 2.50. Payments requested to SEL account no. 1956 50 507 at 

Postbank Köln [Cologne] (bank code 370 100 50). In matters concerning the subscription or payments, 

please contact the treasurer Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail: 

Sommerer.Manfred@t-online.de . 

Back numbers of Nota lepidopterologica may be obtained from, and orders of Nota lepidopterologica 

from non-members are serviced by Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Denmark; e- 

mail: apollobooks@vip.cybercity.dk. 

Changes of address should be immediately communicated to the Membership Secretary or the Treasurer. 

Nota lepidopterologica est envoyé aux membres de la SEL. L'affiliation est possible, pour les personnes 
individuelles aussi bien que pour les associations, en accord avec les statuts de la SEL. Les demandes 
d'affiliation doivent être adressées au Secrétaire des Membres Willy O. De Prins. Nieuwe Donk 50, B- 
2100 Antwerpen, Belgique; e-mail: willy.deprins@village.uunet.be. 

Le formulaire d'affiliation est disponible par le biais de la SEL homepage http://www.zmuc.dk/EntoWeb/ 
SEL/SEL. htm. La contribution annuelle est payable au début de l'année. I Ile est tie (.' 35.00 pour les 
personnes individuelles et de € 45,00 pour les associations. Les frais d'admission s'élèvent à € 2,50. 
Les payements doivent être effectués sur le compte SEL n° 1956 50 5() 7 auprès de la Postbank Köln 
[Cologne] (code bancaire 370 1 00 50). Pour toutes questions en rapport a la souscription OU aux payements, 
veuillez contacter le Trésorier Manfred Sommerer. Volpinistr. 72, D-80638 München; e-mail: 
Sommerer.Manfredfet-online.de. Les anciens volumes de Nota lepidopterologica peuvent être obtenus 
et les commandes concernant cette revue de la pari de non-membres effectuées auprès tie Apollo Books, 
Kirkeby Sand 19, DK-5771 Stenstrup, Danemark; e-mail: apollobooks@vip.cybercity.dk. 
Tous changements d'adresse doivent être communiqués immédiatement soit auprès du Secretaire des 
Membres, soit auprès du Trésorier. 



641 






NOTA 
LEPIDOPTEROLOGICA 

A Journal devoted to the study of Lep id op ter a 

Published by Soeietas Europaea Lepid opter o logic a (SEL) 




Vol. 26 No. 1/2 2003 



SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e.V. 



http : //www. soceurlep . org 



Honorary Members 

Pamela Gilbert (GB), Barry Goater (GB), Prof. Dr Lâszlô Gozmâny (H), Prof. Dr 
Vladimir Kuznetzov (RU), Prof. Dr Clas M. Naumann (D), Dr P. Sigbert Wagener (D) 



Council 

President: 

Vice-President: 

General Secretary: 

Treasurer: 

Membership Secretary: 

Ordinary Council Members: 

Editor: 



Prof. Dr Niels P. Kristensen (DK) 

Dr David Agassiz (UK) 

Dr Christoph Häuser (D) 

Manfred Sommerer (D) 

Will O. de Prins (B) 

Dr Bernard Landry (CH), Dr Elisenda Olivella (E), 
Dr Lâszlô Ronkay (H), Dr Gerhard Tarmann (A), 
Dr Alberto Zilli (I), 

Dr Matthias Nuss (D) 



© Societas Europaea Lepidopterologica (SEL) 
ISSN 0342-7536 

Type setting: Markward Fischer (Dresden) 

Printed by Lausitzer Druck- und Verlagshaus GmbH, Bautzen 

All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or 

mechanical including photocopying, recording or any other information storage and retrieval system, without written 

permission from the publisher. Authors are responsible for the contents of their papers. 



Nota lepidopterologica 

Ajournai devoted to the study of Lepidoptera 
Published by the Societas Europaea Lepidopterologica e.V 

Volume 26 No. 1/2 Dresden, 30.10.2003 ISSN 0342-7536 



Editor ^•^^n'HSÛAi^ 

Dr Matthias Nuss, Staatliches Museum flier Tierkunde Dresden, 
Koenigsbruecker Landstr. 159, D-01109 Dresden; 
e-mail: matthias.nuss@snsd.smwk.sachsen.de 



Utü 3 2003 



Editorial Board N^on A r\ \ *~ 

Dr Enrique Garcia-Barros (Madrid, E), Dr Roger L. H. Dennis (Wilmslow, UK), 
Dr Peter Huemer (Innsbruck, A), Ole Karsholt (Copenhagen, DK), Dr Bernard Landry (Genève, CH), 
Dr Yuri P. Nekrutenko (Kiev, UA), Dr Erik van Nieukerken (Leiden, NL), 
Dr Wolfgang Speidel (Bonn, D) 



Contents 

Editorial 2 

Petrû, M. & J. Liska 

Postsolenobia nanosella sp. n. (Psychidae) from Slovenia 3 

HÄTTENSCHWILER, P. 

Phalacropterix fritschi, eine neue Psychide aus der Portugiesischen 

Algarve (Psychidae) 9 

HÄTTENSCHWILER, P & S. SCALERCIO 

Systematik, Morphologie und Verbreitung von Taleporia defoliella 

Constant, 1895 comb, rev (Psychidae) 19 

Nuss, M. & A. Stübner 

Coleophora variicornis Toll, 1952 stat. rev is a distinct species occurring 

in Central Europe (Coleophoridae) 27 

Rallies, A. 

Synanthedon pamphyla sp. n. from southern Turkey with a comparative 

analysis of mitochondrial DNA of related species (Sesiidae) 35 

Wang, X., H. Li & S. Wang 

Study on the genus Clepsis Guenée, 1845 from China (Tortricidae) 47 



Sons, M. A. 

Pyraloidea specimens labelled as Rebel types from Egypt at the National 
Museum of Natural History, Smithsonian Institution, Washington, D.C 59 

LUKHTANOV, V A., M. WlEMERS & K. MEUSEMANN 

Description of a new species of the "brown" Agrodiaetus complex 

from South-East Turkey (Lycaenidae) 65 

Vieira, V 

Records of Macrolepidoptera from Corvo island, Azores 73 

Book reviews 26, 79 

Instructions for Authors 81 



Editorial 

Konrad Fiedler and I took over the editorship of Nota lepidopterologica during the 
12th Congress of Lepidopterology in Bialowieza (Poland), in 2000. Subsequently, we 
tried to increase its scientific standard by introducing a referee system and changing 
its layout. The readership may decide how much we succeeded in that, but in one main 
task we were certainly not successful: that Nota lepidopterologica becomes published 
regularly. There are reasons for that, especially that not enough acceptable manu- 
scripts were submitted to complete the issues in time. It is regrettable that Konrad 
stepped down from his position as Editor of Nota lepidopterologica in June 2003. 
Without any doubt, he contributed much to increase the standard and the style of the 
journal, not only as editor, but also as author of several articles. I herewith heartily 
express my deepest gratitude to Konrad for all his work during his two years of edi- 
torship. I appreciated very much to collaborate with him. 

The SEL council decided during its meeting in South Tyrol in June 2003 that I should 
take over the editorship of Nota lepidopterologica. The Council also decided that we 
should publish only two double issues in 2003 in order to be able to get back to a reg- 
ular schedule of publication from 2004 onwards. I ask all members of the SEL to con- 
tribute themselves by submitting papers to be published in Nota lepidopterologica. 
During the past, editors almost completely rewrote several papers in order to achieve 
a good standard of publication. It is our experience that many authors simply ignore 
the Instructions for Authors, a fact which should normally result in rejection of 
papers. Based on our experience, the Instructions for Authors were adapted and are 
printed at the end of this issue. They should serve not only as a guide for authors, but 
also for the editorial board and referees. Lets make Nota lepidopterologica a fine and 
regularly published journal! 

Matthias Nuß 



Notalepid. 26 (1/2): 3-8 



Postsolenobia nanosella sp. n. (Psychidae) from Slovenia 

MiLOSLAV Petrû* & Jan Liska** 

* Revolucni 25, CZ 1 10 00 Praha 1, e-mail: mirek.petru@megafyt.cz 
** Strnady 138, CZ 156 04 Praha 5, e-mail: liska@vulhm.cz 

Abstract. A new psychid species Postsolenobia nanosella sp. n. is described from south-western 
Slovenia (Nanos Mountains). The systematic position of this species in Postsolenobia Meier, 1958 as 
well as the differences between similar species of this genus are discussed. The new species is charac- 
terized by its very small size, reduction of some veins, grey colour of the head, pure white forewings with 
a dark-brown pattern and dark-grey hindwings. The cases were collected on rocks on sunny slopes with 
xerothermic vegetation. 

Key words. Lepidoptera, Psychidae, Postsolenobia, sp. n., Nanos Mountains, Slovenia. 



Introduction 

During several excursions to Slovenia in 2000-2002 a series of specimens of the tribe 
Dahlicini was collected in the Nanos Mountains. These specimens do not belong to 
any of the species hitherto known within the tribe. This species, described below as 
new, is apparently a member of the genus Postsolenobia Meier, 1958. Morphological 
features of the species correspond with characters defining Postsolenobia, i.e.: 
absence of epiphysis on foretibia, five veins from the discal cell of the hindwing, 
wingspan less than 10 mm, and cloaking scales of forewing falling into class 5 of 
Sauter (1956). Postsolenobia was later synonymized with Dahlica Enderlein, 1912 
by Arnscheid (1988), but again treated as a valid genus in recent works involving 
taxonomic revisions and keys for the genera of the family Psychidae (Sauter & 
Hättenschwiler 1991, 1999). 



Postsolenobia nanosella sp. n. 

Material. Holotype cf Slovenia, Nanos Mts., Rebrnice 750 m, 3.V.2002 pupa (emerged 18.V.2002), Liska 
leg. Paratypes: Ç Slovenia, Nanos Mts., Rebrnice 750 m, 19.V.2001 pupa (emerged 30.V.2001), Petra leg.; 
9cf same data, but 28.V.2000, 26.V.2001, 1 cf 26.V.2001 pupa (emerged 30.V.2001), 2 c? 3.V.2002 pupa 
(emerged 13.V.2002 and 18.V.2002), 10 3.V.2002 pupa (emerged 18.V.2002), Liska leg.; 2cf 25., 
28.V.2001, 19 28.V.2001 pupa (emerged 2. vi. 2001), Skyva leg.; 1 cf 3.V.2002 pupa (emerged lO.v.2002), 
Sumpich leg. 

The holotype and a female paratype are deposited in the Slovenian Museum of Natural I listqry Ljubljana 
(Prirodoslovni muzcj Slovcnijc); other paratypes are in coll. J. Liska, M. Petrû, J. Skyva, J. Sumpich, the 
National Museum Prague (Nârodni museum Praha), and the Zoological State Collection Munich (Zoolo- 
gische Staatssammlung München). 

Further material (not revised by the authors): 10c? Slovenia, Nanos Mts., 800 m, 25.V.1993 (ex pupa). 
30d\ 8Ç same data, but 1. 5.vi.2002 (ex pupa), Lasan leg. et coll.; 2cf same data, but 14., 17.V.2002 (ex 
pupa), Gomboc leg. ct coll.; 5cf same data, but 700 m, 25.V.2000, 14.V.2002, Deutsch leg. el coll. 

Male (Figs. 1-/, 1-2). Wingspan of the type scries S.l 9.0 mm, 8.5 mm on ave- 
rage (n=15), and 8.3 mm in the holotype. Head covered with grey hairlike scales, 
partly mixed with white. Labial palpi reduced, stump-shaped, covered with grey 
scales. Antennae with 24-26 segments (including scape and pedicel), ca 2/3 of 
forewing length. Distance between eyes twice their diameter. Ocelli absent. Thorax 

© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536 



Petrû & Liska: Postsolenobia nanosella from Slovenia 




Fig. 1. Males of Postsolenobia. 1 - P. nanosella sp. n., holotype, Slovenia, Nanos Mts., Rebrnice, 750 
m, 3.V.2002 pupa, emerged 18.V.2002. 2 - P. nanosella sp. n., paratype, same data as holotype. 3 - P. 
juliella (Rebel, 1919), Italy, Interneppo, 4.V.2002 pupa, emerged 6. v.2002. 4- P. thomanni (Rebel, 1936), 
Switzerland, Brusio, Puschlav, 12.iv.1942, ex pupa. 



and tegulae covered with a mixture of grey and white hairlike scales, the same colour 
as the head. Length of forewing 3.5 times the width. After removing the scales, the 
apex of the forewing is shown to be pointed. Hindwing slightly narrower than 
forewing. Legs striped white and brown-grey, in darker specimens the white colour is 
almost absent. Forewing fringe white with some grey. The dark cilia line is well 
marked. The ground colour of the forewing is pure white with a moderately dark- 
brown pattern, with no yellowish colour. The extent of the white and brown colour 
varies between specimens and white scales are sometimes mixed with grey ones. 
Cloaking scales covering the forewing fall into class 5 of Sauter (1956). Hindwing 
densely covered with dark grey scales. Forewing venation (Fig. 2) with 9 veins from 
the discal cell. M2 and M3 usually stalked. Accessory and intercalary cells sometimes 
present on forewing. Accessory cell (present/examined) 3/6, intercalary cell 1/6. The 
presence of additional cells was also mentioned recently in descriptions of similar 
small species from the tribe Dahlicini from eastern Europe (Herrmann & Weidlich 
1999; Rutjan 2000). Hindwing venation (Fig. 3) without additional cells, only 5 veins 
from the discal cell. M2 and M3 almost completely merged, sometimes with a long 
stalk (5/14). Foretibia without epiphysis, midtibia with 1 pair and hindtibia with 
2 pairs of spurs. Abdomen scaled dark grey to black. Genitalia are typical of Dahlicini 
(cf. Cäpuse 1964). Genital index is approximately 1.05-1.16 (n = 3). The valva is 
3.5 times longer than the width in the middle. 



Nota lepid. 26 (1/2): 3- 




Figs. 2-5. Postsolenobia nanosella sp. n., paratypes. 2. cf, forewing venation. 3. cf, hindwing venation. 
4. 9, pupal skin. 5. 9, dorsal field thorns. 



Female. 16 antennal segments. Body length about 3.5 mm; head, thorax, and 
abdomen whitish dorsally, greyish laterally and ventrally, hairlike scales on whitish- 
grey,. Foretibia without epiphysis. Pupal skin (cf. Hättenschwiler 1977) and dorsal 
field thorns illustrated on Figs. 4-5. 

Cases. The cases are 4.2-5.8 mm long (n=20), 5.3 mm on average and 5.5 mm in 
the holotype, straight, composed of small pale greyish-brown particles of limestone and soil. 

Type locality. Slovenia, Nanos Mountains, Rebrnice, 750 m a.s.l., 45°48'N, 
14°00'E (Fig. 6). The locality lies outside the Alps, in the Slovenian Karst in a very 
moderate calcareous country. The territory of the Slovenian Karst is known for its 
high biological diversity and relatively high rate of endemism. 

Habitat and life hi story. Cases were collected on sunny, south-west facing 
calcareous rocky slopes with xerothermic vegetation {Que reus pubescens, Fraxinus 
ornus, etc.). The altitude is 700-800 m. Cases with larvae were observed from early 
spring (March) until mid May. Most probably the larvae feed on lichens. The adults 
were collected from the second half of May to the first days of June. The maximum 
occurrence is at the end of May. Dahlica triquetrella forma parthenogenetica was the 
only other species of the tribe Dahlicini found in the vicinity of the locality. 



Petrû & Liska: Postsolenobia nanosella from Slovenia 











- - 






UÉita». 




? 




x M1 _ jm St' • jéaBBÊ 


!-. :; :^ -.,, 


^' 








**-*. ^ 




48 



Fig. 6. The type locality of Postsolenobia nanosella sp. n. 

Distribution. At present Postsolenobia nanosella is known only from the 
type locality. It can also be expected to be found in the neighbouring mountains 
(e.g. Tarnovski Gozd Mts.). 

Remarks. The type locality of P. juliella (Rebel, 1919) is given as Monte 
Matajur in northern Italy (Rebel 1919; Arnscheid 1988). In the original description of 
that species, two paratypes were reported from Reifenberg (Görz), now called Branik, 
southwest of Ajdovscina in Slovenia. In the authors' opinion, the population from the 
latter locality may belong to the newly described species. Unfortunately, the types 
specimens could not be traced at the Naturhistorisches Museum in Vienna. 

Derivatio nominis. The name of the species is derived from that of the type 
locality of the new species, the Nanos Mts. 



Discussion 

The new species Postsolenobia nanosella appears to be most closely related to 
P juliella (Rebel, 1919) and P. thomanni (Rebel, 1936). Postsolenobia juliella has a 
yellowish white head in contrast to its darker thorax (Fig. 1, 3). Postsolenobia thomanni 
has brown hairlike scales on the head (Fig. 1, 4). The head of P. nanosella has grey 
hairs, partly mixed with white, especially in pale specimens. At first sight the 
forewing is grey- white, in contrast to the two other species. The ground colour of the 
forewing is pure white, occasionally with a mixture of single grey scales, mainly in 
the costal sector. The dark-brown markings are of high contrast. The hindwing is grey 
and markedly darker compared to the forewing. Furthermore, P. nanosella is smaller 
and its wings are shorter than in P juliella. The ratio between the length of the aedeagus 
and valva (genital index) is between 1.05-1.16, which is somewhat more than in the 
two other species. The remaining species of this genus, P banatica (M. Hering, 1922) 
can be distinguished by the absence of marked spots on the wings and by a larger 
genital index. All characters are summarised in Table 1 . 



Notalepid. 26 (1/2): 3-8 



Tab. 1. Specific characters of Postsolenobia thomanni, Rjuliella, P. nanosella, and P. banatica. Data are 
taken from Cäpuse (1964), Hättenschwiler (1997), Hering (1922), Meier (1957), Rebel (1936) and from 
the following material: Postsolenobia thomann i: c? Switzerland, Brusio, Puschlav, case 12. iv. 1942, 
Weber leg., Petrû coll. - Postsolenobia iuliell a: 4c? Italy, Gemona, 23., 24., 26., 28.iv.1952, Sieder leg., 
Petrû coll.; cf Italy, Dolomiten, Piano Fugazze, 1300 m, 3. vi. 1960, Meier leg., Petrû coll.; cf Italy, 
Matajur, 1 100m, 1 l.v.1961, Sieder leg., Petrû coll.; cf Italy sup., Friaul, Mt. Matajur, 1200 m, 16.V.1961, 
Meier leg., Petrû coll.; 2Ç Italy, Monte Festa, 23. v. 1968, e.p., Schätz leg., Petrû coll.; cf Italy, Monte 
Festa, 24.V.1968, e.p., Schätz leg., Petrû coll.; cf Italy, Monte Festa, 14.V.1969, e.o., P. Hättenschwiler 
leg., Petrû coll.; 4cf, 1Ç, Italy, Matajur, 4.V.2002, e.p., Liska & Petrû leg. et coll; lcf, 1Ç, Italy, Gemona- 
Interneppo, 4.V.2002, e.p., Liska & Petrû leg. et coll. - Postsolenobia banatica : cf Romania, Domogled, 
18.iv.1964, Cäpu§e leg.; cf Baile Herculaneae, 15.V.1965, Capus,e leg., Petrû coll. 



Males 


P. thomanni 


P. juliella 


P. nanosella 


P. banatica 


Wingspan (mm) 


8-10 


9-10 


8-9 


10 


Cloaking scales (Sauter 1956) 


5-6 


5 


5 


5 


Colour of head 


brown 


yellowish 


grey 


pale yellow 


Genital index 


0.84-1.08 


0.85-0.95 


1.05-1.16 


1.33-1.39 



Acknowledgements 

We are grateful to our colleagues for their kind help during the preparation of the manuscript: G. Eisner 
(photography of adults), R. J. Heckford (linguistic revision), P. Kapitola (translation to English), 
Z. Lastuvka (text revision), J. Skyva and J. Sumpich (part of type material). Financial support came 
from the Biotop foundation Prague. 



Literature 

Arnscheid, W 1988. Ein Beitrag zur Systematik der europäischen Arten der Gattungen Postsolenobia 

Meier, Brevantennia Sieder und Siederia Meier (Lepidoptera, Psychidae, Taleporiinae). - 

Nachrichten des entomologischen Vereins Apollo, N.F 8 (1987) 3^: 1 13-144. 
Cäpu$e, I. 1964. Über Solenobia banatica Hering, eine bisher nur aus der rumänischen Volksrepublik 

bekannte Psychide. - Zeitschrift der wiener entomologischen Gesellschaft 49: 104-1 1 1 . 
Hättenschwiler, P 1977. Neue Merkmale als Bestimmungshilfe bei Psychiden und Beschreibung von 

drei neuen Solenobia Dup. -Arten. - Mitteilungen der entomologischen Gesellschaft Basel 27 (2): 

33-60. 
Hättenschwiler, P 1997. Psychidae-Sackträger. S. 165 308. ///: Pro Natura (Hrsg.). Schmetterlinge und 

ihre Lebensräume 2. Fotorotar, Egg. 
Hering, M. 1922. Solenobia banatica m., eine neue palacarktische Psychide. Deutsche entomologische 

Zeitschrift Iris 36: 93 94. 
Herrmann, R. & M. Weidlich 1999. Psychidenbeobachtungen in Westrumänien Teil 2. Beschreibung 

von Siederia transsilvanica sp. n. (Psychidae). Nota lepidopterologica 22 ( 1 ): 10 16. 
Meier, H. 1957. Ein neues Subgenus und neue Arten aus der Gattung Solenobia Dup. (I.ep. Psych.). 

Nachrichtenblatt bayerischer Entomologen 6: 55 61. 
Meier, H. 1958. Der taxonomische Wert der Hinterflügel-Aderung bei den Arten der Gattungen 

Brevantennia Sieder und Solenobia Duponchcl (I.ep.. Psych.). Mitteilungen naturwis- 
senschaftlicher Verein Steiermark SS: 178 192. 
Rebel, H. 1919. Zur Kenntnis palaearktischcr Talaeporiiden. Deutsche entomologische Zeitschrift Ins 

32(3-4): 95 112, Taf. 1. 
Rebel, Fl. 1936. Drei neue Mikrolepidopteren aus der Schweiz. Zeitschrift des österreichischen 

Entomologenvereins 21: II 13. 
Rutjan, E. V 2000. A new bagworm species of the genus Dahlica (Psychidae) from southeastern I Ikraine. 

- Nota lepidopterologica 23 ( 1 ): 26 39. 
Sauter, W. 1956. Morphologie und Systematik der schweizerischen Solenobia-Aiten (lepidoptera, 

Psychidae). - Revue Suisse de Zoologie 63 (3): 45 I 550. 



Petrû & Liska: Postsolenobia nanosella from Slovenia 



Sauter, W. & P. Hättenschwiler 1991. Zum System der palaearktischen Psychiden (Lepidoptera, 
Psychidae). 1. Teil: Liste der palearktischen Arten. -Nota lepidopterologica 14 (1): 69-89. 

Sauter, W. & P. Hättenschwiler 1999. Zum System der palaearktischen Psychiden (Lepidoptera, 
Psychidae). 2. Teil: Bestimmungschüssel für die Gattungen. - Nota lepidopterologica 22 (4): 
262-295. 



Nota lepid. 26 (1/2): 9-1! 



Phalacropterix fritschi, eine neue Psychide aus der 
Portugiesischen Algarve (Psychidae) 

Peter Hättenschwiler 

Seeblickstrasse 4, CH-8610 Uster, Schweiz 

Abstract. The genus Phalacropterix is revised, a key to the species provided and P. fritschi sp. n. 
described. The taxonomic status of P. calberlae (Heylaerts, 1890) and P. apiformis f. siculella (Bruand, 
1852) is discussed. It is suggested to consider siculella as a colour form of P. apiformis. 

Zusammenfassung. Die Gattung Phalacropterix wird revidiert, Ein Bestimmungsschlüssel zu den Arten 
gegeben und P. fritschi sp. n. beschrieben. Der taxonomische Status von P calberlae (Heylaerts, 1890) 
und P apiformis f. siculella (Bruand, 1852) wird diskutiert. Es wird empfohlen, siculella als Farbvariante 
von P apiformis zu betrachten. 

Résumé. Le genre Phalacropterix est révisé. Un clef pour les espèces est donné et P. fritschi sp. n. est 
décrit, le statue taxonomique de P. calberlae (Heylaerts, 1890) et P. apiformis f. siculella (Bruand, 1852) 
est discuté. Il est recommandé de considérer siculella comme forme de coloration de P apiformis. 

Key words. Lepidoptera, Psychidae, Algarve, Phalacropterix fritschi. 



Einleitung 

Im Winter 1998/1999 bereiste Herr Dieter Fritsch die südliche portugiesische Provinz 
Algarve. Als erfahrener Entomologe besuchte er auch in der kalten Jahreszeit alle 
möglichen Orte, an denen sich Insekten aufhalten könnten. So fand er im Februar in 
einem Sandheidegebiet an Stechginster (Ulex spec.) angesponnene Psychidensäcke. 
Von diesen Säcken brachte er einige mit nach Hause und überließ uns 14 davon. Aus 
einem Teil der Säcke ragten noch die leeren männlichen Puppenhüllen, zwei der 
Raupen waren erst etwa halb erwachsen. Vom 5.-9.3.1999 verließen vier männliche 
Schlupfwespen die Säcke {Itoplectis viduata (Gravenhorst), det. Peter Schmid, 
Leutkirch, coli. Schmid & Hättenschwiler). Am 23., 26., 30.3. und 2.4.1999 schlüpf- 
ten die jungen Raupen, die wohl als Eier im Muttersack überwintert hatten. 
Offensichtlich fand der Paarungsflug noch vor dem Februar statt, denn aus keinem der 
vom 22.-25.2.1999 von Herrn Fritsch gesammelten Säcken schlüpften noch Falter. 

Mit den geschlüpften jungen Raupen begannen wir die Nachzucht. Diese Zuchten 
konnten wir über zwei Generationen weiter führen, erhielten aber jeweils nur wenige 
adulte Tiere. Der Sommer im Fundgebiet ist sehr heiß und der Winter mild. Der 
Sommer bei uns in Uster auf 475 m über dem Meeresspiegel ist für diese Art 
möglicherweise nicht warm genug. Vielleicht waren auch im lutter nicht alle 
notwendigen Substanzen ausreichend vorhanden. Wir verwendeten eine Vielzahl von 
Pflanzen, von denen Vogelknöterich {Polygonum aviculare F.). Einjähriges Rispen- 
gras (Poa annua L.) und Heidekraut (Calluna vulgaris L.) bevorzugt wurden. Die 
Entwicklung war hier langsamer und dauerte bis /um April des folgenden Jahres, die 
Überwinterung fand als etwa halb erwachsene Raupe statt. Von der zweiten 
Generation brauchten etwa 1/3 der Raupen zwei Jahre für che Fntwicklung. Trotz der 
großen Mortalität standen uns für die Untersuchungen 27 Männchen, 29 Weibchen 
sowie 6 Raupen zur Verfügung. 

© Nota lepidopterologica. 30.10.2003. ISSN 0342-7536 



*" Hättenschwiler: Phalacropterix fritschi sp. n. from the Algarve 

Aufgrund der Säcke war sogleich klar, daß es sich um eine Phalacropterix- Art 
handeln muß. Jedoch ergab die Untersuchung der adulten Tiere aus der Nachzucht 
Abweichungen gegenüber allen bekannten Arten. Es erwies sich als notwendig, alle 
Arten der Gattung gründlich zu prüfen und möglichst viele Unterscheidungsmerk- 
male zu vergleichen. In der Gattung Phalacropterix sind die folgenden Arten zusam- 
mengefaßt: 

Hauptverbreitungsgebiet Bemerkungen 

P. apiformis (Rossi, 1790) Italien, Südliches Frankreich Gattungstypus 

f. siculella (Bruand, 1852) Italien (siehe Text) 

P. graminifera (Geoffroy, 1785) Südliches Frankreich 

P. praecellens (Staudinger, 1 870) Mitteleuropa, nördlich und südlich der Alpen 

P calberlae (Heylaerts, 1 890) Tirol / Pyrenäen (siehe Text) 

P graslinella (Boisduval, 1852) Mitteleuropa, nördlich der Alpen 

P bruandi (Lederer, 1855) Türkei 

P. fritschi sp. n. Südliches Portugal, Algarve (siehe Text) 

Es ist oft nicht einfach, die verschiedenen Arten zu unterscheiden, obwohl teilweise 
auffällige Unterschiede vorhanden scheinen, denn die Merkmale sind meist großen 
Streuungen unterworfen. 

Abkürzungen 

Ant - Antenne, DZ - Discoidalzelle, Hfl - Hinterflügel, KZ - Kammzähne, rr - Radialramus im Hfl, sc 
- Subcostalader, Vfl - Vorderflügel 



Bemerkungen zu einzelnen Arten 

P. apiformis f. siculella wurde von Bruand (1852) als Art aufgrund eines 
Männchens aus Sizilien beschrieben. Er erwähnt, daß die Art selten sei und kenne nur 
das eine Exemplar von Boisduval. Seitz (1913: 363) fuhrt siculella unter P apiformis 
mit der Anmerkung: „Kommt in Sicilien zusammen mit der Hauptform vor und zeich- 
net sich durch schwarzen Thorax und Abdomen aus". In Dalla Torre & Strand (1929: 
108) wird siculella als „Var" unter P apiformis geführt. Kozhantshikov (1956: 432) 
erwähnt siculella am Anfang der Beschreibung von P apiformis neben Synonymen, 
ohne jedoch etwas über den Status von siculella auszusagen. 

Offenbar wurde dieser Name damals als Art, Unterart oder Variation verwendet. 
Gestützt auf diese frühen, nicht in allen Fällen sehr klaren Beschreibungen, betrach- 
teten wir damals siculella als Unterart von P apiformis (Sauter & Hättenschwiler 1991). 
Nun, nachdem wir eigene Erfahrungen mit mehreren Zuchten haben, betrachten wir 
die Sache etwas anders. Bei den heute als siculella betrachteten Faltern handelt es sich 
um eine Form von apiformis, bei der die haarförmige, orange-gelbe oder orange-rote 
Körperbeschuppung ganz oder teilweise durch schwarze haarförmige Schuppen erset- 
zt ist. In einigen Populationen treten solch dunkle Männchen auf. Wir haben beispiels- 
weise aus gezüchteten Raupen, die mit der Ausnahme von „Macerata" jeweils aus 



Notalepid. 26 (1/2): 9-18 



11 



einem Gelege stammten, die folgenden Verhältnisse ermittelt: 23 c? Marche, Macerata 
1970, leg. A. Teobaldelli (davon nur 2c? als verdunkelte Zwischenstufe). 12c? Romagna, 
Forli 1987, leg. F. Gabriele (davon 3c? schwarz). 14c? Romagna, Rocandello 1994, 
leg. L. Bertaccini (davon 2c? schwarz, lc? Zwischenstufe). 17c? Liguria, Savona 2002, 
leg. D. Fritsch (davon keine schwarz oder Zwischenstufe). Dieser Farbverlust tritt in 
den verschiedenen Populationen in unterschiedlicher Häufigkeit auf. Beide Formen 
können bei Männchen aus dem gleichen Gelege auftreten. Nach unseren Beobach- 
tungen in den verschiedenen Zuchten scheint es sich hier also nur um eine Form zu 
handeln. 

P calberlae (Heylaerts, 1890) wurde nach einem Weibchen, einer Raupe von 
Cauterets, Hautes Pyrénées, Frankreich leg. R. Oberthür sowie eines Männchens, das 
mehrere Jahre später E. Pokorny, ebenfalls als Raupen mit Säcken, in „Teriolis mer., 
Condino" im südlichen Tirol gesammelt hatte beschrieben. Durch Kauf gelangte 
dieses Männchen und die Säcke in die Sammlung Calberla in Dresden. Ein Holotypus 
wurde nicht festgelegt, es handelt sich somit um Syntypen. Von den bekannten Arten 
hat nur P praecellens eine Verbreitung, die diejenige von P. calberlae einschließt. Die 
Beschreibung enthält einige meß- und vergleichbare Angaben, die jedoch oft auch für 
andere Arten der Gattung zutreffen. Sämtliche Angaben liegen jedoch im Streu- 
bereich von P praecellens. Wir haben somit starke Vermutungen, daß P calberlae als 
Synonym von P praecellens betrachtet werden muß. 

Von den Belegen, die Heylaerts in der Beschreibung erwähnt hat ist das getrock- 
nete Weibchen, die geblasene Raupe und drei Säcke im Naturhistorischen Museum in 
Leiden (Holland) aufbewahrt. In liebenswürdiger Weise hat uns Herr Dr. E. J. van 
Nieukerken Bilder übermittelt und die Belege so kommentiert: „When looking at the 
bags of praecellens they look indeed very much the same" Das übermittelte Foto 
eines Männchens von „Carniolia, Wippach, Mitte 4.00 (= April 1900), Wagner", von 
Heylaerts als P calberlae bestimmt ist im Geäder, der Flügelbeschuppung und den 
Fühlern auch mit P praecellens übereinstimmend. 

Die Sammlung von Herrn Calberla ist im Museum für Tierkunde in Dresden 
(Deutschland). Herr Dr. Matthias Nuß hat in freundlicher Weise die Sammlung durch- 
gesehen und fand wohl die in der Beschreibung erwähnten Säcke, nicht aber das 
fragliche Männchen. So gelang es uns nicht den Fall zu klären und wir müssen das 
Männchen momentan als verschollen betrachten. Wir sind der Ansicht, daß P. calber- 
lae ein Synonym zu P praecellens ist. Da wir es vorziehen würden, das Männchen als 
Lectotypus festzulegen, möchten wir die Sache noch nicht abschließen und hoffen, 
daß es noch gefunden wird. 



Phalacropterix fritsch i sp. n. 

Material. Holotypus CT Portugal. Algarve, 2 4 km NW von Saures. 75 m. leg. I ritsch, erste 
Nachzucht ex. ovo 27.4.2000, cult. Hättenschwiler, coli. Naturmuseum I u/cm. Paratypen: l3Cf, 14c, 
6 Larven gleiche Daten, erste Nachzucht ex. ovo 16. 29.4.2000; lief. 12c 21.4 30.5.2001 (/weite 
Nachzucht, erste Überwinterung), 2CT, 39 25. 3. 4.4.2002 (/weite Nachzucht, zweite Oberwinterung); 
14 Säcke beider Geschlechter, 22. 25.2.1999 leg. Fritsch; 20 Säcke aus Zuchten, in denen die erwach- 
senen Raupen oder die Puppen abgestorben sind; coli. Erwin Häuser. Peter (V Ruth I lättensehwilcr, 
Hans Hendcrickx, Rene Herrmann. Willi Sauter, \ationaal NatUUrhistorisch Museum Leiden, Natur- 
museum Luzern, Museum für Tierkunde Dresden. 



12 



Hättenschwiler: Phalacropterix fritschi sp. n. from the Algarve 







\%X^ 



Abb. 1. Flügeladerung von a: P fritschi sp. n., Exemplar mit 10 Adern aus der Discoidalzelle im 

Vorderflügel, b: P. fritschi sp. n., Exemplar mit nur 9 Adern sowie c: P. praecellens. 

Abb. 2. Männliche Genitalapparate: a: P. apiformis, b: P fritschi sp. n, c: P praecellens, d: P graslinel- 

la, jeweils rechts der Aedeagus. 

Abb. 3. Links Weibchen, rechts Raupe von P fritschi sp. n. 



Beschreibung cf. Flügel- Spannweite 15-19 mm, Vorderflügel Costalkante 
nach innen gebogen, mit 10 Adern aus der Discoidalzelle (Abb. la), seltener 9 Adern, 
dann fehlt r5 (Abb. lb). Braun-schwarze, stumpfe Schuppen der Klasse 1-2 (cf. Sauter 
1956) außen und helle, gelblich-braune Schuppen der Klasse 1 im Wurzelfeld der 



Nota lepid. 26 (1/2): 9-1: 



13 



Flügelfläche. Hinterflügel mit 6 Adern aus der Zelle, Färbung und Beschuppung wie 
im Vorderflügel, rr+sc im Basisdrittel sehr nahe oder verschmolzen, dann getrennt. 
Fühler doppelkammzähnig mit 23-30 Gliedern, Kammzähne dunkel, schwärzlich 
beschuppt, nur selten sind einzelne helle Schuppen zu erkennen. Ocellen fehlen, 
Augen klein, hochoval, in den langen, schwarzen Schuppen versteckt, Augenabstand 
groß, 2,2-2.8 mal Augenhöhe. Labialpalpen stark rückgebildet. Beine normal 
entwickelt, mit 5 Tarsengliedern, ohne Epiphyse an der Vordertibia, Mittel- und 
Hinter-beine ohne Sporne, höchstens kurze Enddornen. Genital (Abb. 2b) mit leicht 
abgesetztem Saccus, Aedeagus schwach gebogen, fast die Länge des gesamten 
Genitales erreichend. Sacculus mit kräftigen Dornen, Valve etwa bis zum Ende des 
Tegumens reichend. 

Ç. Ungeflügelt, 8-10 mm lang bei 3.5 mm Durchmesser, zylindrisch, 
blaßgelb-weißlich, weichhäutig, ohne Zeichnungen, nur der Kopf und die drei Brust- 
segmente sind leicht skierotisiert. Ocellen fehlen, Labialpalpen kaum noch erkennbar, 
Fühler fehlen, Augen als kleine dunkle Punkte vorhanden, Beine etwa 0.5 mm lange 
Stummel. Die Legeröhre ist fleischig weich, sehr kurz, viel kürzer als deren 
Durchmesser. Auf dem 8. Abdominalsegment ein bräunlicher Kranz von Afterwolle, 
schwache, hellere Haarkränze befinden sich auf einigen weiteren Segmenten 
(Abb. 3 links). 

Eier. Hell gelb-grünlich, leicht oval, ohne Strukturen. Während der Entwicklung 
werden sie dunkler. Ein Weibchen kann etwa 100 Eier ablegen. 

Raupen. Ausgewachsen werden sie 15-18 mm lang bei einem Durchmesser von 
2.5-3.5 mm. Kopf und Brustsegmente sind hart skierotisiert, dunkel mit unregelmäßi- 
gen, hellen Flecken. Abdominalsegmente dorsal dunkel graubraun, ventral schmutzig 
hellbraun (Abb. 3 rechts). 

Säcke. Bei beiden Geschlechtern 16-20 mm lang, birnenförmig, mit feinen 
Ästchen oder Grashalmen quer belegt und mit einem unvollständigen, lockeren 
Gespinst überzogen. Bei den Männchen-Säcken ist der belegte Teil etwas kürzer und 
das hintere Ende in eine weißliche, unbelegte 1-2 mm lange Endröhre ausgebaut, die 
beim Weibchen-Sack fehlt. Das Weibchen verläßt den Sack nie. Es spinnt bei der 
Verpuppung im hinteren Sackende eine Reuse, durch die später das Männchen bei der 
Begattung sein Abdomen in den Sack bohren und so das Weibchen erreichen kann. 
Bei den Säcken beider Geschlechter liegen die quer angesponnenen Pflanzenteile 
nicht alle parallel und sind in der Länge etwas unterschiedlich. Dadurch entsteht ein 
„struppiges", unregelmäßiges Aussehen. Sackdurchmesser bei den Männchen 6 8 mm, 
bei den Weibchen 8-10 mm (Abb. 4a). 

Puppe. Männchen vor dem Schlüpfen dunkelbraun, Exuvie hellbraun. Kopf- 
Brustplatte mit allen Scheiden normal entwickelt. Kopfplatte mit 4 Borstenpaaren. 
Weibchen dunkelbraun bis schwarz, an beiden Enden rotbraun gefärbt, /ylindrisch, 
8-10 mm lang und 3-3.5 mm im Durchmesser. Kopf-Brust Platte sehr stark reduziert, 
die einzelnen Scheiden sind verwachsen und kaum noch erkennbar. 

Lebensweise. Die Männchen schlüpfen um die Mittagszeit, sind schon nach 
kurzer Zeit flugbereit und suchen in stürmischem Flug ein Weibchen, das im Sack 
wartet und ihren Duftstoff durch die Sackwände ausströmen läßt. Die Paarung dauert 



14 



Hättenschwiler: Phalacropterix fritschi sp. n. from the Algarve 



M 








*\ Kurze 

Endröhre ^p 




10 mm 





Abb. 4. Säcke im Puppenstadium jeweils links Männchen-, rechts Weibchensäcke, a: P. fritschi, die nack- 
te Endröhre beim Männchensack ist kurz, b: P. praecellens, die nackte Endröhre ist deutlich länger. 



1-3 Minuten. Das Männchen kann 2 bis 3 Mal kopulieren und stirbt in der Regel noch 
am gleichen Tag. Die Weibchen können während mehrerer Tage um die Mittagszeit 
wiederholt locken, bis eine Paarung statt findet. Dann werden sogleich alle Eier in die 
Puppenhülle abgelegt; dabei wird die Afterwolle abgestreift und zwischen den Eiern 
abgelagert. Das Weibchen bleibt als kleines Häufchen Haut in der Puppenöfrhung liegen 
und stirbt langsam ab. Nach etwa drei bis vier Wochen schlüpfen die jungen Raupen, 
verlassen den mütterlichen Sack, bauen sogleich ihr eigenes Säcklein und beginnen 
erst dann zu fressen. Aufgrund der in ihrer Heimat schon im Februar schlüpfenden 
Jungraupen muß angenommen werden, daß die Flugzeit im Klima der Algarve im 
Herbst oder spätestens im Dezember- Januar stattfinden muß. Die Entwicklung dauert 
in der Freiheit ein Jahr, mit wenigen Ausnahmen, bei denen die Raupen etwa halb 
erwachsen überwintern und erst zusammen mit den Nachkommen ihrer Geschwister 
erwachsen sind. Zur Verpuppung werden die Säcke meist oben in der Futterpflanze 
festgesponnen, was den Nachkommen das Suchen des Futters erleichtert. Nach dem 
Festspinnen des Sackes wird bei den Männchen die Endröhre mit der Schlüpföffnung 
vorbereitet. Anschließend kehrt die Raupe sich im Sack um und häutet sich zur 
Vorpuppe, die Raupenhaut wird durch die Schlüpföffnung aus dem Sack geschoben 
und bleibt dort oft als schwarzes Klümpchen hängen. Nun kehrt sich die Raupe 
nochmals im Sack und häutet sich zur Puppe, mit dem Kopf zur Schlüpföffnung 
gerichtet, wodurch die abgestreifte Haut im Inneren des Sackes bleibt. Die Entwick- 
lung zur Imago dauert etwa 3 Wochen. Auch bei den Weibchen wird die Begattungs- 
öffnung des Sackes sorgfältig vorbereitet und dann erst häutet sich die Raupe, den 
Kopf gegen die Schlüpföffnung gerichtet, zur Puppe ohne die Zwischenstufe der 
Vorpuppe. Die Puppe braucht zur Entwicklung nur etwa 2 Wochen, die Raupen spinnen 
ihre Säcke entsprechend später zur Verpuppung fest. 



Notalepid. 26 (1/2): 9-1: 



15 




apiformis 

(15-19 mm) 




praecellens 

(15-20 mm) 




apiformis f. siculella 

(15-19 mm) 





graminifera 

(15-23 mm) 




graslinella 

(17-22 mm) 




bruandi 

(13-15 mm) 



x_:i._^u! 



16 



Hättenschwiler: Phalacropterix fritschi sp. n. from the Algarve 




Abb. 6. Männliche Genitalapparate, links P graminifera, rechts P. bruandi (Maßstab: 0,5 mm). 

Abb. 7. Flügeladerung bei P. apiformis, im Hinterflügel entspringen rr+sc nahe zusammen, verschmelzen 

etwa bei der DZ-Mitte und bleiben bis zum Zellende verschmolzen. 

Abb. 8. Verteilung der dunklen- und hellen Schuppen auf den Flügeln, links P praecellens, rechts P 

graslinella. 



Verbreitung. Die neue Art ist zur Zeit nur aus der Algarve bekannt, wo sie 
etwa 75 m über dem Meeresspiegel unweit der Atlantikküste gefunden wurde. 

Derivatio nominis. Wir widmen die neue Art als Dank dem Finder Herrn 
Dieter Fritsch und nennen sie Phalacropterix fritschi sp. n. 

Diagnose. Die neue Art steht der R praecellens nahe, läßt sich jedoch unter- 
scheiden durch den Verlauf der Adern rr+sc im Hinterflügel, die bei praecellens über 
die ganze Länge getrennt verlaufen, bei fritschi sp. n. jedoch im Basisdrittel anasto- 
mos oder approximal. Die Fühlerkammzähne tragen bei praecellens helle Schuppen, 
bei fritschi sp. n. fast ausschließlich dunkle Schuppen. Der Männchen-Sack hat bei 
praecellens eine nackte Endröhre von 6-9 mm Länge, die bei fritschi sp. n. nur 1-2 
mm lang ist. Weitere Hinweise finden sich in der Tabelle und im nachfolgenden 
Schlüssel zu den Arten. 



Notalepid. 26 (1/2): 9-18 



17 



Schlüssel zu den Arten der Gattung Phalacropterix 

1) Thorax und Abdomen mit orangegelben, haarförmigen Schuppen, Vfl meist mit 9 DZ-Adern, nur 
m2+m3 gestielt, Hfl rr+sc entspringen nahe beisammen, verschmelzen etwa in der DZ-Mitte und 
trennen sich wieder beim DZ-Ende (Abb. 7). Ant KZ gelblich, fast goldglänzend beschuppt. 

apiformis 
(Körperbehaarung mehrheitlich oder ganz schwarz = f. siculella) 

- Thorax und Abdomen mit dunklen haarförmigen Schuppen, oft mit helleren Schuppen durchmengt. 
Vfl meist 10 DZ-Adern, r3+r4 sowie m2+m3 gestielt. Hfl rr+sc anders verlaufend. 2 

2) Alle Flügel im Wurzelfeld und in DZ mit hellen Schuppen von gelb-brauner Farbe, Klasse 1, gegen 
die Flügelspitze dunkle, grauschwarze, stumpfe Schuppen Klassen 2-3. 3 

- Flügel einfarbig schwärzlich, im Wurzelfeld nicht oder nur unwesentlich heller (Abb. 5). graminifera 

3) Kleiner, Flügelspannweite 13-16 mm, dorsale KZ sehr stark mit langen Schuppen besetzt, so daß sie 
wie verklebt erscheinen, während diese Beschuppung an der ventralen Zahnreihe weitgehend fehlt 
und die einzelnen KZ gut sichtbar sind. KZ dunkel bis schwarz beschuppt, selten einzelne, heller 
glänzende Schuppen, Wimpern kaum erkennbar. Cf Sack mit kurzer Endröhre von nur 1-2 mm 
Länge. Saccus im männlichen Genital vom Vinculum nicht oder kaum abgesetzt (wie Abb. 6 rechts). 
Hfl rr+sc meist auf der ganzen Länge weit getrennt. buandi 

- Größer, Flügelspannweite 15-22 mm, Beschuppung der KZ beider Reihen schütter und anliegend, 
Wimpern gut sichtbar. 4 

4) Beschuppung der KZ dunkel bis schwarz, selten einzelne heller glänzende Schuppen. Cf Genital, 
Saccus durch starke Verengung deutlich vom Vinculum abgesetzt (Abb. 2b). Hfl rr+sc im Basisdrittel 
sehr genähert verlaufend oder verschmolzen, nachher getrennt (Abb. la+lb). Cf Sack mit kurzer 
Endröhre von 1-2 mm Länge. fritschi sp. n. 

- Beschuppung der KZ ganz oder teilweise hell, silberweiß. C? Sack mit langer Endröhre. 5 

5) Wurzelteil aller Flügel hell bräunlich beschuppt, DZ im Vfl transparent (Abb. 8 links). KZ stark hell, 
silberweiß glänzend beschuppt. Sack schwach umsponnen. praecellens 

- Basale Hälfte beider Flügel hell, braungelb beschuppt. Die DZ ist im äußeren Teil verdunkelt, wenig 
auffallend (Abb. 8 rechts). KZ dunkel (bräunlich) aber glänzend beschuppt. Der Glanz kann, ab- 
hängig von der Beleuchtung, die Schuppen hell erscheinen lassen. Ab und zu mit einzelnen silber- 
weißen Schuppen. Sack meist stark umsponnen. graslinella 



Tab. Übersicht über morphologische Merkmale in der Gattung Phalacropterix. Fett hervorgehoben 
sind jene Merkmale, die sich von der Mehrheit der Arten in der Gattung unterscheiden. 





apiformis 


graminifera 


praecellens 


graslinella 


bruandi 


fritschi 


Flügel Spannweite in mm 


15-19 


15-23 


15 20 


17-22 


13-15 


15-19 


Vorderfiügel, Adern aus DZ 


9(10) 


10 (9) 


10(9) 


10(9) 


10(9) 


10(9) 


Hinterflügel, Adern aus DZ 


6 


6 


6 


6 


5(6) 


6 


Aderung Hintcrflügel rr + sc 


Basis bis Ende DZ 
verschmolzen, außen 
frei 


getrennt mit 
Querader 


getrennt mit 
Querader 


getrennt mit 
Queradei 


getrennt mit 

Queradei 


Basisdrittel 
nahe oder 
verschmolzen 
aullen frei 


P lüget färbung, Vfl 1 Uli 


Flügelbasis gelb- 
braun 


ganze Fläche 
schwarz-grau 


Flügelbasis 
gelb-braun 


Flügelbasis 

gelb-braun 


Flügelbasis 

gelb-braun 


i lügelbasis 

gelb-braun 


Anzahl Fühlerglieder 


29 32 


27 32 


27 36 


31-38 


29 32 


23-30 


Farbe der Fühlcr-Kammzahn- 
Beschuppung 


hell 


hell 


hell 


hell 


dunkel 


dunkel 


Männchen Sack, Länge der 
nackten Endröhre in mm 


1-2 


5 6 


6 9 


4 8 


12 


1-2 


Männliches Genital, Übergang 
Vinculum Saccus 


Übergang undeutlich 


deutlich 

abgesetzt 


deutlich 

abgesetzt 


deutlich 

abgesetzt 


i bergang 

undeutlich 


deutlich 
abgesetzt 


Weibchen Puppe, Färbung 


hellbraun mit 5 
dunklen Ringen 


dunkel mit 
braun-roten 

Enden 


dunkel mit 
braun-roten 
Enden 


dunkel mit 
braun-roten 
Hndcn 




dunkel mit 
braun-roten 
Enden 



1 8 

1 ° Hättenschwiler: Phalacropterix fritschi sp. n. from the Algarve 

Danksagungen 

Auch bei dieser Arbeit durfte ich wieder die große Hilfe von verschiedener Seite in Anspruch nehmen. 
Herzlichen Dank geht an Herrn Dieter Fritsch, der die Säcke mit den Eiern der neuen Art gefunden und 
uns geschenkt hat; ihm verdanke ich auch die Angaben zu Klima und Flora am Fundort. Meinem lieben 
Freund, Herrn Prof. Dr. Willi Sauter danke ich fur die stete Beratung und umfangreiche Hilfe bei den 
Untersuchungen sowie für die Durchsicht des Manuskriptes. Vielen Dank geht auch an Herrn Dr. Erwin 
Hauser für die Aufnahme der Fotos, Herrn Dr. E. J. van Nieukerken im Museum Leiden für die Hilfe und 
Übermittlung der Bilder und Kommentare zu dem Typusmaterial von P calberlae, Herrn Dr. Matthias 
Nuß im Museum für Tierkunde Dresden für die Suche nach dem verschollenen Männchen sowie Herrn 
Peter Schmid für die Bestimmung der Schlupfwespen. Besonderen Dank schulde ich meiner lieben Frau 
Ruth und Tochter Sereina Parpan, sie haben alle Zuchten erfolgreich über die Jahre betreut. Ganz herz- 
lichen Dank allen Beteiligten, ohne die ich diese Arbeit nicht hätte zu Ende führen können. 



Literatur 

Bruand, M. T. 1852. Essai Monographique sur la tribu des Psychides. - Memoirs de la Société Libre 

d'Emulation de Doubs (ser. 2) 3: 60. 
Dalla Torre, K. W. & E. Strand 1929. Psychidae. - In: F. Bryk (Hrsg.), Lepidopterorum Catalogus 34. - 

W. Junk, Berlin, 211 S. 
Häuser, E. 1998. Morphologie der Männchen von Phalacropterix bruandi (Lederer, 1855). - Zeitschrift 

der Arbeitsgemeinschaft österreichischer Entomologen 50: 21-28. 
Heylaerts, F.-J.-M. 1890. Notes Psychidologiques. -Annales de la Société Entomologique de Belgique 

34, comptes-rendus: 131. 
Kozhantshikov, I. V 1956. Fauna of the U.S.S.R., Lepidoptera, Psychidae. - Zoological Institute of the 

Academy of Sciences of the USSR, N. S. 62: 432 S. 
Pro Natura 1997. Schmetterlinge und ihre Lebensräume 2. Basel, I-XII, 1-679. 
Sauter, W. 1956. Morphologie und Systematik der schweizerischen Solenobia-Arten. - Revue Suisse de 

Zoologie 63 (27): 451-550. 
Sauter, W. &. P. Hättenschwiler 1991. Zum System der palaearktischen Psychiden, 1. Teil: Liste der 

palaearktischen Arten. -Nota lepidopterologica 14 (1): 69-89. 
Seitz, A. 1913. Die Gross-Schmetterlinge des Palaearktischen Faunagebietes 2. 363 S. - In: A. Seitz 

(Hrsg.), Die Gross- Schmetterlinge der Erde. - Alfred Kernen, Stuttgart. 



Nota lepid. 26 (1/2): 19-25 



19 



Systematik, Morphologie und Verbreitung von Taleporia 
defoliella Constant, 1895 comb. rev. (Psychidae) 

Peter Hättenschwiler 1 & Stefano Scalercio 2 

Seeblickstrasse 4, CH-8610 Uster, Switzerland; peter.haettenschwiler@swissonline.ch 

Università degli Studi de] 

sscalercio@hotmail.com 



2 Università degli Studi della Calabria, Ddip.di Ecologia, 1-87036 Arcavacata di Rende-Cosenza; 



Abstract. Taleporia defoliella Constant, 1 895 comb. rev. has been known formerly only by males and 
only from the Alpes Maritimes. This species is now recorded for the first time from Italy (Calabria and 
Piémont). Reared from ex ovo, males and females of the same species are now recognised. Immature 
stages, females and males are described and based on the morphological characters, defoliella is trans- 
ferred from Bankesia Tutt, 1899 back to Taleporia Hübner, [1825]. The life history of the species is 
described. Cases found in nature were parasitised by Xanthellum transsylvanicum Erdös & Novicky, 
1951, which is herewith also recorded for the first time from Italy. 

Zusammenfassung. Taleporia defoliella Constant, 1895 comb. rev. war bislang nur von Männchen und 
nur vom Typenfundort in den Alpes Maritimes bekannt. Diese Art wird erstmalig für Italien (Kalabrien 
und Piémont) nachgewiesen. Anhand einer ex ovo Zucht können Männchen und Weibchen derselben Art 
erkannt werden. Die ersten Stände, die Weibchen sowie die Männchen werden beschrieben und anhand 
der morphologischen Befunde wird defoliella aus der Gattung Bankesia Tutt, 1899 zurück in die Gattung 
Taleporia Hübner, [1825] transferiert. Die Lebensweise der Art wird beschrieben. Im Freiland gefundene 
Säcke waren von Xanthellum transsylvanicum Erdös & Novicky, 1951 parasitiert, die damit ebenfalls 
erstmalig für Italien nachgewiesen wird. 

Riassunto. Taleporia defoliella Constant, 1 895 comb. rev. e stata originariamente descritta su un mas- 
chio raccolto sulle Alpi Marittime. Questa specie è nuova per la fauna italiana (Calabria e Piemonte). 
L'allevamento di alcune uova ha permesso di descrivere anche gli stadi preimmaginali e la femmina, 
finora ignoti. I nuovi caratteri morfologici raccolti hanno permesso il ritorno di defoliella da Bankesia 
Tutt, 1899 Taleporia Hübner, [1825]. Inoltre, viene descritta l'ecologia della specie. Alcuni astucci rac- 
colti in natura erano parassitizzati da. Xanthellum transsylvanicum Erdös & Novicky, 1951, anche esso 
nuovo per la fauna italiana. 

Key words. Lepidoptera, Psychidae, Taleporiinae, Taleporiini, Taleporia, Bankesia, defoliella, 
Chalcidoidea, Xanthellum, transsylvanicum. 



Einleitung 

Im Herbst 2001 hat eine Gruppe Entomologen der Università degli studi della Cala- 
bria, dipartimento di Ecologica unter der Leitung von Dr. Stefano Scalercio bei der 
Feldarbeit im Gebiet des Passo della Crocetta auf etwa 900 Meter über dem Meeres- 
spiegel eine Anzahl kleiner Psychidensäcke gesammelt. Diese waren oft an den 
Leitplanken entlang der Straße bis in etwa 20 cm über dem Boden festgesponnen. Im 
Labor schlüpften dann einige ungeflügelte Weibchen, jedoch keine Männchen. Eine 
spätere Nachsuche an denselben Leitplanken erbrachte Männchen, die sich von allen 
im Gebiet bekannten Arten unterscheiden. Es war aber nicht sicher, ob diese 
Männchen und die zuvor gezogenen Weibchen zur gleichen Art gehörten. Wir durften 
jedoch annehmen, dass sich in den Säcken der im Freiland geschlüpften Weibchen 
befruchtete Eier befinden. Mit diesem Material wurde eine Nachzucht in Uster 
(Schweiz) auf 475 m über dem Meeresspiegel durchgeführt, weil dort die geeigneten 
Zuchteinrichtungen und Erfahrung mit Psychiden-Zuchtcn zur Verfügung stehen. 

Zur Zucht verwendeten wir einen Kasten, in dem das Biotop des Fundortes der 
Säcke möglichst gut nachgebildet war. In diesen Kasten legten wir am 3 1 . 1 . und nochmals 

© Nota lepidopterologica. 30.10.2003, ISSN 0342-7536 



20 



Hättenschwiler & ScALERCio: Taleporia defoliella from Italy 




Abb. 1-6. Merkmale der Imagines von Taleporia defoliella Constant, 1895. 1: Flügelform und -aderung. 
2: Vorderbeine, links c? , vergrößert Epiphyse und Tarsus; rechts 9, vergrößert Tarsus. 3: Antennen, A - (S , 
oben gesamte Länge, unten vergrößerter Ausschnitt, B - Ç (stärker vergrößert). 4: cf Genitalapparat. 5: 
9 in Seitenansicht. 6: 9 Postabdomen. 



am 21.3.2002 einige Weibchen- Säcke auf Moos, Rinden- und Aststücke sowie auf 
Steine, die mit Flechten und Algen besetzt waren. Von nun an war nichts mehr zu 
sehen bis zum 8.8.2002 als zwei erwachsene Raupen mit ihren Säcken an der Gaze 
des Kastens empor kletterten und sich oben angesponnen haben. Die ganze Entwick- 
lung hat im Verborgenen im Moos und unter den Rinden- und Holzstücken stattge- 
funden. Zur Verpuppung suchten die meisten Weibchen einen erhöhten Ort, während 
alle Männchen sich versteckt, tief im Moos oder in der Erde verpuppten, so dass nur 
die Schlupföffnung aus dem Boden ragte. Erst durch diese Zucht konnten wir die bei- 
den Geschlechter sicher derselben Art zuordnen: Bankesia defoliella (Constant, 
1 895). Sie wurde ursprünglich anhand von 6 Männchen aus den französischen West- 
und Seealpen (Alpes Maritimes) beschrieben und war bislang auch nur aus dieser 
Region bekannt. Im folgenden geben wir eine Beschreibung der Männchen sowie der 
bislang unbekannten Präimaginalstadien, der Säcke, der Weibchen sowie der Lebens- 



Nota lepid. 26 (1/2): 19-25 21 



weise und zeigen anhand der morphologischen Befunde, dass diese Art nicht zur 
Gattung Bankesia Tutt, 1899, sondern wieder zur Gattung Taleporia Hübner, [1825] 
gestellt werden muß, in der sie ursprünglich beschrieben wurde. 

Taleporia defoliella Constant, 1 895 comb. rev. 

Talaeporia [sie] defoliella Constant, 1895: 51. 
Bankesia defoliella (Constant, 1895) (Tutt 1899: 191). 

Typenfundort: France, 'Collines de l'Estérel' [Alpes Maritimes, in einem Pinienwald 
(Constant 1899)]. 

Material. -509 ( ex larva/ ex pupa), ~30 Freilandtiere sowie 32c? , 23 9 (ex. ovo), Italien, Kalabrien, 
Passo della Crocetta, 900 m, Mitte September bis Anfang Oktober; weitere Belege von verschiedenen 
Fundorten in Kalabrien; coll. Universitâ della Calabria Dipartimento di Eccologia Arcavacata di Rende- 
Cosenza, Naturmuseum Luzern, Museum für Tierkunde Dresden, Sammlung R. und P. Hättenschwiler 
und weitere. 2c? Piemonte, Region Asti, Boschi di Valmanera, 25.9.1975; lef Piemonte, Riserva Natur 
Valle Andona, 21.9.2000; lcf Piemonte, Sassello, 29.9.1969, alle Tagfang und Baldizzone leg., coli. 
Baldizzone et Hättenschwiler. 

Beschreibung ö . Flügelspannweite 8,5-10 mm; alle Flügel schmal; Hinter- 
flügel mit langen Fransen, deren Länge nahezu die Flügelbreite erreicht. Vorderflügel 
mit 10 Adern aus der Discoidalzelle, mit Anhangzelle, Deckschuppen Klasse 5-6 
(Sauter 1956), gelb-goldiger Grundfarbe mit vielen braunen Flecken, am äußeren 
Zellende meist ein größerer dunkler Fleck. Hinterflügel mit 6 Adern aus der Discoidal- 
zelle (Abb. 1), Deckschuppen Klasse 3-4, einfarbig hellgrau. Kopf mit Ocellen; 
Komplexaugen groß, Abstand etwa 1,2-1,6 x Augenhöhe; Labialpalpen lang, 3-glied- 
rig, mit haarförmigen Schuppen; Kopf anterior dunkelbraun, dorsal braungelb mit 
haarförmigen Schuppen besetzt. Fühler fadenförmig, etwa 28 Glieder, dorsal be- 
schuppt, anteroventral auf jedem Glied zwei unregelmäßig geformte Wärzchen mit 
mehreren büschelartig angeordneten Borsten (Abb. 2-A). Vorderbeine mit Epiphyse 
(Abb. 3), Mittelbeine mit 1 Paar Tibialsporne, Hinterbeine mit 2 Paaren. Genital mit 
Tegumen eingekerbt; Saccus breit, kurz, gerundet; Aedeagus gebogen (Abb. 4). 

Ç. Ungeflügelt; Körper 3,5-4 mm lang (ohne Legeröhre), zylindrisch, 0,7-0,9 mm 
im Durchmesser; blassgelb; dorsal auf Kopf-, Brust- und Abdominalsegmenten hell- 
braune, skierotisierte Platten; ventral auf jedem Segment zwei gegeneinander 
gerichtete hellbraune skierotisierte, dreieckige Platten, die auch verbunden sein können. 
Ocellen fehlen; Augen klein, schwarz, rückgebildet; Labialpalpen rückgebildet, kaum 
noch erkennbar (Abb. 5); Antennen kurz, 6-9 Glieder (Abb. 2-B). Beine reduziert, 
geeignet zum Festklammern am Sack, jedoch nur schlecht brauchbar zur Fortbewe- 
gung; alle Tarsen mit 5 Gliedern. Genitalöffnung auf dem Segment VIII umgeben von 
langen, schmalen Dornen (Abb. 6); Afterwolle dunkel rotbraun, nicht geknöpft 
(Sauter 1956); Legeröhre lang ausstreckbar (zum Ablegen der Eier in den Sack). 

Ei . bei der Ablage blaßgelb, leicht oval, ohne Strukturen; verfärbt sich später und 
wird vor dem Schlüpfen bräunlich. 



Talaeporia Agassiz, 1847 is an unjustified emendation and Talaeporia Zeller. 1838 an incorrect subse- 
quent spelling, both of Taleporia Hübner, [1825]) (cf. Nye & Fletcher 1991). 



22 



Hättenschwiler & ScALERCio: Taleporia defoliella from Italy 





vordere Öffnung 



hintere 
Öffnung 




ca.1 mm t . 



8 




Abb. 7-9. Merkmale der Präimäginalstadien von Taleporia defoliella Constant, 1895. 7: Raupen 
(Seitenansicht, alle gleicher Maßstab). A — \. Stadium, frisch aus dem Ei geschlüpft, B - Raupe im 
2. Stadium, C- Raupe vor der Verpuppung. 8: Der Sack beider Geschlechter. A - Rückenseite, B - schräg- 
seitlich, C - Frontalansicht mit Schlupföffnung. 9: 9 Puppe, Kopf in Frontalansicht. 



Raupe (Abb. 7). vor der Verpuppung etwa 3 mm lang, 0,6 mm Durchmesser. 
Kopf und Brustsegmente hellbraun, hart skierotisiert. Abdominalsegmente blaß 
weißlich mit meist fünf leicht erhöhten Feldern, je 2 lateral und ein Feld dorsal. 

Sack. Beider Geschlechter im Querschnitt dreieckig, 6,5-7,0 mm lang, Seiten 1 
mm breit (Abb. 8), aus Seide, ohne Einbezug anderer Materialien (nur vereinzelt sind 
um die vordere Öffnung Pflanzenfragmente, Sandkörnchen oder Chitinteile angespon- 
nen); hinteres Ende, durch das der Kot ausgestoßen und das Weibchen schlüpfen wird, 
durch drei Lappen verschlossen (diese Lappen werden im Inneren durch gespannte 
Fäden zusammengehalten und können dadurch von Aussen kaum geöffnet werden). 

Puppe. Vor dem Schlüpfen dunkelbraun, da Imago durchscheint, Exuvie hell- 
braun, cf Puppen mit deutlich erkennbaren Scheiden für alle Körperteile. Kopfplatte der 
9 Puppe stark reduziert, die einzelnen Teile oft nicht unterscheidbar; kurze 
Fühlerscheiden jedoch länger als Kopfplatte, diese mit zwei Borstenpaaren (Abb. 9). 
Abdominalseg-mente dorsal bedornt; ein nach hinten gerichtetes Dornenfeld hilft der 
Puppe sich beim Schlüpfen teilweise aus dem Sack zu schieben. 

Lebensweise. Flugzeit von September bis erste Oktoberhälfte. Die Männchen 
schlüpfen am Abend und warten dann an Moosen, Gräsern oder Steinen sitzend bis 
bei Tagesanbruch die Weibchen schlüpfen und zu locken anfangen. Dazu sitzen sie 
am Sack, Kopf nach oben gerichtet, die Legeröhre weit nach oben ausgestreckt. Die 
wartenden Männchen reagieren sogleich auf den Lockduft der Weibchen und fliegen 



Nota lepid. 26 (1/2): 19-25 23 

zu ihnen. Die Kopula dauert 1-2 Minuten, dann fliegt das Männchen weiter und sucht 
weitere Weibchen. Wir konnten 3 Paarungen eines einzelnen Männchens beobachten. 
Das Geschlechtsverhältnis ist etwa 1:1. Sofort nach der Paarung beginnt das Weibchen 
seine Eier in den Sack zu legen, dazu schiebt es die lang ausgestoßene Legeröhre 
zwischen der Sackwand und der noch im Sack steckenden Puppenhülle in den Sack. 
Die Ablage der etwa 18-26 Eier (n = 30) dauert 2-2,5 Stunden, dann wird die Lege- 
röhre aus dem Sack gezogen und das Weibchen klettert weg oder fällt zu Boden und 
stirbt bald. Beim Ablegen der Eier werden die Afterschuppen abgerieben und kommen 
zwischen den Eiern zu liegen, wo sie als Polsterung und Schutz dienen. Wenn keine 
Paarung stattgefunden hat, klettert das Weibchen um die Mittagszeit vom Sack weg 
und stirbt. Beide Geschlechter erleben den nächsten Tag nicht. 

Die Raupen der Weibchen klettern ab etwa Mitte August in die Höhe und spinnen 
ihren Sack an festen Gegenständen wie Steine, Holz, Leitplanken der Straßen usw. 
fest. Die Puppenruhe dauert etwa 3 Wochen, etwas abhängig vom Wetter, besonders 
der Temperatur. 

Die Raupen der Männchen bleiben ihr ganzes Leben in der Bodenstreu, zwischen 
Moosen und Steinchen versteckt. Zur Verpuppung werden die Säcke im Moos, in 
Ritzen und Bodenstreu festgesponnen oder in die Erde so tief eingegraben, dass nur 
noch die hintere Öffnung die Oberfläche erreicht. 

Die ganze Entwicklung findet im Verborgenen statt, sogar bei Zuchten ist das 
Beobachten in den Zuchtkästen sehr schwierig bis unmöglich. Die jungen Raupen 
schlüpfen sehr unterschiedlich, im Zimmer sind die ersten schon Anfang Dezember 
geschlüpft, im Freien waren die letzten Beobachtungen im März. Die Eientwicklung 
scheint somit sehr von der Umgebungstemperatur beeinflußt zu sein. Die frisch 
geschlüpften Raupen (Abb. 7-A) bauen sogleich einen kleinen Sack, wozu sie die von 
der Mutter unter die Eier gemischten, seidigen, langen Abdominalschuppen mit ver- 
wenden. Kaum einen Tag alt findet die erste Häutung statt. Als Futter kommen Algen, 
Flechten und verwesende Pflanzenteile in Frage. 

Den Ausbau den Sackes konnten wir bei der verborgenen Lebensweise der Raupen 
nicht beobachten. Es ist aufgrund der Sackkonstruktion jedoch anzunehmen, daß der 
Ausbau ähnlich wie bei Taleporia tubulosa Retzius, 1783 stattfindet (Hättcnschwiler 
1997:214-219). 

Aus den Freiland-Säcken wurden einige Exemplare des Parasitoids Xanthellum 
transsylvanicum Erdös & Novicky, 1951 gezogen (det. Prof. Dr. (i. Viggiani, Neapel); 
der Befall liegt bei etwa 1.5 %. Diese Art ist neu für Italien. 

Systematische Stellung. Durch die späte Flugzeit im September bis 
Oktober unterscheidet sich T. defoliella von den meisten anderen Arten der 
Taleporiinae, die in den Monaten März bis Mai fliegen. Im Herbst fliegen lediglich 
Taleporia autumnella Rebel, 1919 aus Pisino in Istrien (sie soll helle lehmgelbe haar- 
förmige Schuppen auf dem Kopf sowie Fühler mit kürzerer Bewimperung haben) und 
Bankesia deplatsella Nel, 1999 aus Süd Frankreich, Bouches-du-Rhone (sie hat 9 mm 
Flügelspannweite und feine Unterschiede in der Form der Valven im männlichen 
Genital). Beide Arten konnten wir nicht selber vergleichen, die Angaben haben wir 
den Beschreibungen entnommen. 



24 



Hättenschwiler & ScALERCio: Taleporia defoliella from Italy 



Tab. 1. Merkmale zur Unterscheidung der drei Gattungen Taleporia, Pseudobankesia, Bankesia. Die 
jeweils gattungstypischen Merkmale sind kursiv gedruckt. * Präparation und Einbettung des Genitales 
oder der Betrachtungswinkel kann dieses Verhältnis stark beeinflussen. 





Taleporia 


Pseudobankesia 


Bankesia 


cf Antenne 


2 Borstenbündel / Segment 


2 Borstenbündel / Segment 


1 Halb-Kranz / Segment 


tf Genital 


Saccus breit 


Saccus schmal 


Saccus breit 


& Valvenlänge * 


überragen Tegumen wenig 


überragen Tegumen kaum 


überragen Tegumen deutlich 


cf Tegumen 


ohne Stab 
ohne Spitzen 


ohne Stab 
mit Spitzen 


mit Stab 
ohne Spitzen 


Sack 

Länge : Breite 


lang, hart, ohne Belag 
4:1-8:1 


kurz, weich, mit Belag 
1,4:1-3.5:1 


kurz, weich, mit Belag 
2:1-3:1 


9 alle Beine 


5 Tarsenglieder 


5 Tarsenglieder 


meist 3 Tarsenglieder 




Stab im Tegumen 




Abb. 10.-11. Gattungsmerkmale von Taleporia Hübner, 1825, Pseudobankesia Meier, 1963 und 
Bankesia Tutt, 1899. - 10: Antennen (unterschiedliche Vergrößerungen), A: Taleporia, B: 
Pseudobankesia, C: Bankesia. - 11: Männliche Genitalien, A: T tubulosa (Retzius, 1783), B: P 
alpestrella (Heinemann, 1870), C: B. conspurcatella (Zeller, 1850). 



Nota lepid. 26 (1/2): 19-25 



25 



Die vorliegende Studie vieler Exemplare beider Geschlechter, der Säcke und der 
Lebensweise zeigt, daß defoliella wieder zurück in die Gattung Taleporia gesetzt wer- 
den muß. In Tabelle 1 werden die gattungstypischen Merkmale (kursiv) der sich inner- 
halb der Taleporiini besonders ähnlichen Gattungen Taleporia, Pseudobankesia 
Meier, 1963 und Bankesia zusammengefaßt. 



Danksagung 

Wir danken allen die mit geholfen haben, diese Arbeit durchzuführen, im besonderen Prof. Dr. Pietro 
Brandmayr, Université degli Studi della Calabria, Dip. di Ecologia (Arcavacata di Rende-Cosenza) für 
die finanzielle Unterstützung der Arbeiten in Kalabrien. Vielen Dank auch den beiden Damen Emilia 
Pugliese und Manuela Russo (Arcavacata di Rende-Cosenza), die durch ihre Arbeiten im Feld viel zur 
Kenntnis der weitgehend unbekannten Art beigetragen haben. Auch danken wir Prof. Dr. G. Viggiani, 
Université degli Studi di Napoli „Federico II" fur das Bestimmen der Parasitoide. Prof. Dr. Willi Sauter 
(Illnau) danken wir für die Beratung und Ruth Hättenschwiler und Sereina Parpan (Uster) fur die 
Durchführung der Zuchten in Uster. 



Literatur 

Burks, R. A. 2002. Key to the Nearctic genera of Eulophidae, subfamilies: Entedoninae, Euderinae, and 

Eulophinae (Hymenoptera: Chalcidoidea). - http://cache.ucr.edu/heraty/Eulophidae/ Xanthellum_ 

page.html. 
Constant, A. 1895. Microlépidoptères nouveaux de la faune française. - Bulletin Société Entomologique 

de France: 50-55. 
Constant, A. 1899. Description of a new Taleporid species: Taleporia vernella, n. sp. with a further des- 
cription of T. defoliella Cnst. - Entomologist's Record and Journal of Variation 11: 256. 
Hättenschwiler, P. 1997. Psychidae-Sackträger. S. 165-308. -In: Pro Natura (Hrsg.), Schmetterlinge und 

ihre Lebensräume 2. Fotorotar, Egg. 
Meier, H. 1963. Zur Kenntnis der Gattungen Pseudobankesia gen. nov. und Bankesia. - Mitteilungen der 

Münchner Entomologischen Gesellschaft 53: 1-23 
Nel, J. 1999. Espèces nouvelles ou rarement signalées de microlépidoptères de France. - Bulletin de la 

Société entomologique de France 104 (4): 347-355 
Nye, I. W. B. & D. S. Fletcher 1991. The generic names of moths of the world 6. Microlepidoptera. - 

Natural History Museum, London, i-xxx, 1-368. 
Rebel, H. 1919. Zur Kenntnis palaearktischer Taleporiiden. - Deutsche Entomologische Zeitschrift Iris 

32 (1918) 3-^: 95-1 12. 
Sauter, W. 1956. Morphologie und Systematik der schweizerischen Solenobia-Arten. - Revue Suisse de 

Zoologie 63 (27): 451-550. 
Tutt J. W. 1899. New genera in the Micro-Psychids. - Entomologist's Record and Journal of Variation 1 1 

(7): 191. 



26 



Book review 



Book Review 



Horak, M. & R. B. Halliday (eds.) 2003. Lepidoptera Systematics and Biology. A 
tribute to Ebbe S. Nielsen. - Invertebrate Systematics 17 (1). ISSN 1445-5226. 
Price: Au$ 75.00. 

This special issue of Invertebrate Systematics is dedicated to the memory of Ebbe 
Schmidt Nielsen (7.6.1950-6.3.2001). Ebbe's tremendous beneficial influence on 
lepidopterology can hardly be described just by a few lines. Niels Peder Kristensen 
(2001, Nota lepidopterologica 24 (3): 3-9) already reminded of him as a European 
lepidopterist, as one of the founders of the Societas Europaea Lepidopterologica, and 
as a leader of Australian lepidopterology. Invertebrate Systematics, ajournai whose 
Advisory Committee he chaired for several years, now commemorates his life and 
contributions to science. Contributions were invited from friends and colleagues of 
Ebbe, who had worked and collaborated with him during his career. J. L. Edwards, R. 
B. Halliday, M. J. Scoble, and M. Whitten write about Ebbe's leading activities in 
lepidopterology, his achievements in terms of the management for the Australian 
National Insect Collection, his bioinformatics legacy and compiled a bibliography of 
Ebbe. A number of scientific papers were collected and edited by Marianne Horak 
and Bruce Halliday in order to honour Ebbe and thus his broad impact on lepidop- 
teran systematics, which reaches well beyond the groups that he worked on himself. 
Just to give examples, the issue includes the description of the new monotrysian moth 
family Andesianidae from South America (by D. R. Davis & P. Gentili), descriptions 
of the new genera Plesiozela (Heliozelidae) by O. Karsholt & N. P. Kristensen, 
Xanadoses (Cecidosidae) by R. J. B. Hoare & J. S. Dugdale, and Ebbepterote 
(Eupterotidae) by R. G. Oberprieler, W. A. Nässig & E. D. Edwards. Several new 
species are described from Guam, Argentinia, New Zealand, Tasmania, mainland 
Australia, Japan, Papua New Guinea, and Sulawesi. Studies of host-plant relation- 
ships of several lepidopteran groups, a reassessment of the pyralid Anerastiini, and a 
test of the Gondwanan ancestry of Australian butterflies are given. The entire issue 
includes information about so many lepidopteran families from around the world that 
it will be an important addition to the libraries of Lepidoptera biologists worldwide. 
All papers included in the journal are of good standard and layout, as a tribute to Ebbe 
should be. Congratulations to all authors and especially the two editors, Marianne 
Horak and Bruce Halliday for this fine contribution! 

The issue is for sale as a stand-alone title from CSIRO Publishing 
(http://www.publish.csiro.au/index.cfm). 

Matthias Nuss 



Nota lepid. 26 (1/2): 27-34 



27 



Coleophora variicornis Toll, 1952 stat. rev. is a distinct species 
occurring in Central Europe (Coleophoridae) 

Matthias Nuss 1 & Andreas Stübner 2 

1 Museum für Tierkunde, Königsbrücker Landstr. 159, D-01 109 Dresden, 
e-mail: matthias.nuss@snsd.smwk.sachsen.de 

2 Schulstr. 14a, D-03197 Jänschwalde-Ost 

Abstract. Coleophora variicornis Toll, 1952 formerly treated as a synonym of C. hieronella Zeller, 1849 
is recognised as a distinct species after investigation of the type specimens. Diagnoses are given to distin- 
guish these two species from the other members of the Coleophora trifolii species group and to distinguish 
C. variicornis from C. hieronella. Their external and genitalia features are described and figured. 
According to our investigations, C. variicornis is known by specimens from Albania, Bulgaria, Croatia, 
Germany, Italy, Macedonia, Turkey, and Turkmenistan. Coleophora variicornis is recorded for the first 
time from Central Europe by specimens collected in historical and recent times from the German state of 
Brandenburg. Coleophora hieronella is so far known from Spain, France, Italy (Sicily), and Croatia. 

Key words. Coleophora trifolii species group, variicornis, hieronella, taxonomy, nomenclature. 



Introduction 

Vives-Moreno (1988) listed about 1000 species for the genus Coleophora Hübner, 
1822 world wide, of which 174 species occur in Germany (Gaedike & Heinicke 1999). 
When we revised the faunistic inventory of the species of Coleophora Hübner, 1 822 
from eastern Germany we found altogether six species distinguished by their metallic 
green coloured forewings. However, until that time only five species with this character 
had been known from Germany (Gaedike & Heinicke 1999). These are C.fiischella 
(Linnaeus, 1758), C. mayrella (Hübner, [1813]), C. alcyonipennella (Kollar, 1832), 
C. trifolii (Curtis, 1832), and C deauratella Lienig & Zeller, 1846 for which Emmet 
et al. (1996) proposed the C. trifolii species group (which excludes C alcyonipennella 
which is not known from the British Isles, but includes the Mediterranean C. fusci- 
cornis Zeller, 1847 which is recorded from North Essex in Great Britain). So far as 
known, the larvae of these species feed on the seeds of legume species of the genera 
Melilotus, Trifolium, and Vicia (Emmet et al. 1996). 

We checked the literature for other species related to this species group (e.g. 
Baldizzone 1986, 1990a, b; Vives-Moreno 1988; Ncl 1993; Emmet et al 1996) and 
traced about 30 names (including synonyms) available for metallic-green Coleophora 
species. However, we could not identify our German specimens with the available lit- 
erature and started to check the type specimens. During this process, we found that C. 
variicornis Toll, 1952 which has been treated as a synonym of C. hieronella Zeller, 
1849 (Toll 1961; Baldizzone 1986; Vives-Moreno 1988) is a distinct species conspc- 
cific with specimens from Germany. In the following, we redescribc the two species, 
figure their genitalia and give a list of the examined material. 



1 According to Gaedike & Heinicke ( 1999), there is another metallic-green Coleophora species known 
from Germany, C. paripennella Zeller, L839. However, this species does not belong to the C. trifolii 

species group due to different morphological features o\' the genitalia and a different life history (cf. 
Emmet et al. 1996: 300-301, figs. 52b, 78d, pi. 15 fig. 28). 

© Nota lepidopterologica. 30.10.2003, ISSN 0342-7536 



28 



Nuss & Stübner: Coleophora variicornis stat. rev. in Central Europe 




Fig. 1. Coleophora variicornis, adult from Germany, Brandenburg, Jänschwalde/ Ost, 23 .vi. 2002, 
Stübner leg. Note the flagellum which is thickened along the basal third, chequered black and white along 
the distal two thirds. 



Abbreviations. DEI - Deutsches Entomologisches Institut, Eberswalde; BMNH - The Natural History 
Museum London; GU - Genitaluntersuchung (genitalia slide); MNHU - Museum fur Naturkunde der 
Humboldt-Universität zu Berlin; MTD - Staatliches Museum für Tierkunde, Dresden; ISEZ - Polish 
Academy of Sciences, Institute of Systematics and Evolution of Animals, Department of Invertebrate 
Zoology, Krakow; ZSM - Zoologische Staatssammlung, München. 



Results 

Externally, C. variicornis (Fig. 1) and C. hieronella present the same morpholo- 
gical features and can not be distinguished from each other. The forewing length 
(measured from the base of the wing to the tip of the apical fringe) is 4-5.5 mm in 
C. variicornis and 5.5 mm in the holotype of C. hieronella. Head vertex and fronto- 
clypeus covered with metallic olive-green scales, shining metallic copper to bronze; 
compound eye black-brown, shining metallic violet, not distinctly edged; labial pal- 
pus metallic olive-green, basio-ventrally creamy- white; proboscis basally scaled 
creamy-white. Antenna about three quarter as long as forewing; scape flat and 
enlarged, covered with elongated metallic violet-brown scales projecting ventrally; 
first third to first half of flagellum thickened by dark metallic brown to violet 
coloured scales, remaining distal part entirely chequered black and white. Thorax dor- 
sally and ventrally covered with metallic olive-green scales; legs metallic olive-green 



Nota lepid. 26 (1/2): 27-34 29 

to brown, shining orange to violet; dorsal surface of forewing basally scaled metallic 
olive-green, changing to metallic brown and violet distally, ventral surface shining 
silver (changing to brown in older collection specimens); hindwing lanceolate, greyish- 
brown, not metallic. Abdomen metallic silver, ventrally with some olive shine. 

Though C. variicornis and C. hieronella can not be distinguished externally from 
each other, they differ by their characteristic scaling of the antennae from all other 
metallic-green Coleophora species we examined. Some species of the C. trifolii- 
group have a basally slender flagellum without elongated scales (C. alcyonipennella, 
C. frischella, C. fuscicornis, C. trifolii, C. etrusca Baldizzone, 1 990) while the fla- 
gellum of the remaining species of the C. trifolii group is basally thickened by elon- 
gated scales (C. deauratella, C. hieronella, C. mayrella, C. paramayrella Nel, 1993, 
C. variicornis). Among the five species with a basally thickened flagellum, the remai- 
ning part of the flagellum is black with a white tip (C. deauratella), chequered black 
and white with a white tip (C. mayrella, C. paramayrella), or entirely chequered black 
and white (C. variicornis, C. hieronella). However, we also found C. mayrella speci- 
mens which have the antennae entirely chequered black and white up to the tip. Those 
specimens need to be identified by their genitalia. For the identification of C. mayrella 
(= Porrectaria spissicornis Haworth, 1828), we here refer to Baldizzone (1986) and 
Emmet etal (1996). 

Coleophora variicornis Toll, 1952: 28, fig. 21, stat. rev. (Figs. 1-3, 6, 7) 

Material. Holotype cf with labels: "Typus" (red paper, printed in black); "Holotypus" (red paper, 
printed in black); fabriciella \ AmasicT (handwritten with pencil on light green paper"; "Präparat | 
No. 39 | Gr. v. Toll" (on white paper handwritten and printed in black); "Coleophora | variicornis Toll \ 
Typus. | Gr. v. Toll det." (handwritten and printed in black ink), MNHU. Paratypus: cf same data as holo- 
type, ISEZ. cf Albania^ Borschi, south ofVlora, 14— 27.v. 1961 ; cf Albania, Uji Ftohte, south ofTepelena, 
200 m, 29-3 1 .v. 1 96 1 ; 4cf , Albania, west of Poliçan, Tomor, 500 m, 2-1 2.vi. 1 96 1 ; 4cf Albania, Iba below 
Krraba, 400 m, 17-22.vi. 1961 ; 3c? Albania, Daiti, Shkall Prisk, 850 m, 27.vi.-2.vii.1961; all specimens 
at light, Albania expedition DEI, coll. DEI. cf Croatia, Dalmatia mer., environment of Gravosa, 
15-31.V.1939, Klimesch leg., ZSM. cf Macedonia, Matka, Treska valley, 19-29.V.1955, Klimesch leg., 
ZSM. cf Italy, Lucania, Vulture Va! d'Ofanto, 20-30.iv.1966, Klimesch leg., ZSM. ç Bulgaria, Pirin 
mts., Liljanovo, 800 m, 26.v.-21.vi.l981, leg. Eichler, coll. DEI. 25d», 9 Germany, Brandenburg 
Jänschwalde/Ost, 2.viii.l996, 26.vi.1998, 16., 28.vi., I3.vii.1999, ll.vi., l.vii., l.viii.2000, 29.vi., 1,1 
23.vii.2001, 13, 17, 23.vi.2002, 14. vi., 7., 14.vii.2003; 4cf Jänschwalde, power station, 15. 16. 
22.vi.2002, all specimens A. Stiibner leg., coll. Stübner, MTD. cf Potsdam-Wilhelmshorst, l().vii.[19]43, 
coll. Ernst, MTD. lcf Greece, Delphi, Parnass, 500 m, 28-30.iv.1980, Cox leg., coll. van der Wolf. 
3cf Turkmenistan, western Kopet Dag, 40 km east of Garrygala (= Kara Kala). 800 m. 4. 1 5. 19.V.1993, 
Sruoga leg., coll. van der Wolf. 

References Toll 1961: 280 (syn. of hieronella); Patzak 1974: 319: (( variicornis as bona sp.); 
Baldizzone 1986: 3, 9, figs. 15, 18, 24-26 (as C. hieronella): Vives-Moreno 1988: 82 (syn. of hieronella)', 
Razowski 1990: fig. 407 (as C. mayrella). 









30 Nuss & Stübner: Coleophora variicornis stat. rev. in Central Europe 




Figs. 2-5. Male genitalia. 2. C. variicornis (GU Stübner 860). 3. C. variicornis (GU Stübner 860), 
cornuti (interference contrast and extended focus option with 41 planes, interplanai distance 0.55 urn, 
object depth 22.2um) scale bar 40um. 4. C. hieronella, holotype (genitalia slide BM Microlep. 2363). 
5. C. hieronella, holotype (genitalia slide BM Microlep. 2363), cornuti (interference contrast and extended 
focus option with 62 planes, interplanal distance 0.74 urn, object depth 45,6 urn) (one cornutus is bro- 
ken off) scale bar 40um. 



cf genitalia (Figs. 2, 3). As is characteristic for the genus Coleophora, an 
uncus is not present and the distal part of the gnathos is an ovoid structure bearing 
many spines; tegumen narrow, without any special features; vinculum slender, V- 
shaped; costal part of valva weakly sclerotised, finger-shaped, without macroscopic 
setae dorsally; sacculus strongly sclerotised, dorsal edge more strongly sclerotised and 
terminating in a dorso-distal thorn, with one macroscopic seta ventro-anally; aedea- 
gus caudally forming a sclerotised ring with a dorso-caudal elongated projection, 
vesica with a group of 8-10 cornuti, which arise from a broad, straight sclerotised 
base, which can be plate-like and enlarged; each cornutus straight. 

9 genitalia (Figs. 6, 7). Bursa copulatrix ovoid with minute scobinate patches 
in its wall, signum crescent-shaped and with a sclerotised hook directed inwardly; 
ductus bursae membranous and straight on anterior third, slightly angled beyond and 
along the second third with numerous sclerotised spines in wall, angled at insertion of 
ductus seminalis, posterior third straight and membranous; colliculum forming an 
ovate sclerotised shield with strongly sclerotised spines; antrum strongly sclerotised, 
funnel-shaped, with a smooth wall; VHIth segment entirely sclerotised, surrounding 
ostium bursae ventrally; membrane VIII-IX elongated; apophyses posteriores twice as 
long as apophyses anteriores; papillae anales separated, each pointed distally. 



Nota lepid. 26 (1/2): 27-34 



31 




Figs. 6-9. Female genitalia. 6. C. variicornis (GU Stübner 1407). 7. C. variicornis (GU Stiibner 1407), 
detail of posterior ductus bursae and segment VIII. 8. C. hieronella (GU van der Wolf 6242). 9. C. 
hieronella (GU van der Wolf 6242), detail of posterior ductus bursae and segment VIII. (a. a.: apophyses 
anteriores; c: colliculum; d.b.: ductus bursae; d.s.: ductus seminalis; VIII: segment VIII) 



Diagnosis. Coleophora variicornis is distinguished from C. hieronella in the 
male by the absence of a macroscopic seta from the costa of the valva and in the 
female by the more pointed posterior tips of segment VIII, the longer apophyses ante- 
riores, and the thicker ductus bursae between the ductus seminalis and colliculum. 

Distribution. Known from Germany, Italy, Croatia, Macedonia, Albania, 
Bulgaria, Greece, Turkey, and Turkmenistan. 

Life history. The male adults have been attracted by lights, the female has 
been netted from Trifolium pratense flowers in day time. Surprisingly, C. variicornis 
is at least in some areas of eastern Germany the most common species of the ('. tri- 
folii species group. 



Coleophora hieronella Zeller, 1849: 203 (Figs. 4, 5, 8, 9) 

Material. Holotype (by monotypy) cf "Syracuse \ SI/.Il.) \ 2 n .iv.IS44 \ Zeller? (handwritten with 
black ink on white paper), "Hieronella Z. \ 29/4 44. Svraeiis. | Mavrella Is. 47. SSV' (handwritten with 
black ink on white paper, edged with black ink), "B.M. cf | Genitalia slide | No. 2363*' (printed in black 
and handwritten in red ink), "Coleophora hieronella. /.. I. in. i.nt. IV. 203. {1849) | C. * mavrella, 
Z. Is. 1H47M3-4 \ Type Q-unique-desrV (handwritten and printed with black ink on white, black edged 
paper), (drawer label: "Holo- | type"), BMNH. cf, 9 [paratypes of C. variicornis*] Spain, (hiclana, 
iv-v.1912, Korb leg., ISEZ; 4cf Huelva, HI Rompido, 1 3. vl 1981, coll. van der Wolf; AcS Siena Moicna. 
Sta. Elena, Jaen, lO.v.1983, J. B. Wolschrijn, coll. van der Wolf; cf Almena. I as Menas de Seron. 1500 m. 



32 Nuss & Stübner: Coleophora variicornis stat. rev. in Central Europe 



l-2.vi.2003, leg. et coll. van der Wolf; cf Huelva, Mazagon, 8-10.iv.1994, leg. et coll. van der Wolf; 
2c? Ventade, Azuel, Cortoba, 17.V.1981, coll. van der Wolf; cf Marabella, Malaga, 5. v. 1981, coll. van der 
Wolf; c? Salamancha, Belena, 8.V.1979, coll. van der Wolf; c? Sevilla, Ronquillo, 15.V.1981, coll. van der 
Wolf; cf Granada, 2.V.1978, coll. van der Wolf; cf Periana, Malaga, 24.iv.1978, coll. van der Wolf; 
cf Andalusia, province Malaga, Camino, de Ojen, 150 m, 17.iv.1980, E. Traugott-Olsen leg., ZSM; 
cf Granada, 5 km north of Otivar, 600 m, 17.iv.1987, Coenen & de Prins leg., coll. van der Wolf, 
cf France, Corse sept., Calvi, 12-20.V.1967, Klimesch leg., ZSM; cf, 9 Corse, Ste Lucie de Porto 
Vecchio, 7, ll.v.1996, K. J. Huisman leg., coll. van der Wolf, cf Italy, Sizily, Palermo, S. Martino d. 
Scale, 20-3 l.v. 1954, Klimesch leg., ZSM. cf Croatia, Istrien, Moscenice, 300 m, 5.vi.l970, 
A. Speckmeier leg., ZSM 

References. Toll 1961: 280; Patzak 1974 b: 319 (syn. of spissicornis); Baldizzone 1983: 225, 227; 
Kaltenbach & Roesler 1985: 49, 83, 84, 93, 104; Baldizzone 1986: fig. 14 (male genitalia of holotype of 
C hieronella); Vives-Moreno 1988: 82; Baldizzone 1990 a: 43; Baldizzone 1994: 83; Baldizzone 
1995: 110; Baldizzone 1997: 223. 

cf genitalia (Figs. 4, 5). As is characteristic for the genus Coleophora, an uncus 
is not present and the distal part of the gnathos is an ovoid structure bearing many 
spines; tegumen narrow, without any special features; vinculum slender, V-shaped; 
costal part of valva weakly sclerotised, finger-shaped, with one macroscopic seta dor- 
sally; sacculus strongly sclerotised, dorsal edge more strongly sclerotised and termi- 
nating in a dorso-distal thorn, and with one macroscopic seta ventro-anal; aedeagus 
caudally forming a sclerotised ring with a dorso-caudal elongated projection, vesica 
with a group of seven cornuti, which arise from a sclerotised, slender and elongated 
base which is bent on the side where the smaller cornuti arise (entire length of cornuti 
group: 180 urn); each cornurus slightly bent. 

9 genitalia (Figs. 8, 9). The features of the Ç genitalia are very similar to those 
of C. variicornis, with the following exceptions: the posterior tips of segment VIII are 
less pointed, more rounded, the apophyses anteriores are shorter, and the ductus bur- 
sae is narrower posterior to the ductus seminalis. 

Diagnosis. Coleophora hieronella differs from C variicornis in the male by 
the presence of a seta at the costa of the valva, in the female by the more rounded pos- 
terior tips of segment VIII, the shorter apophyses anteriores, and the narrower ductus 
bursae between the ductus seminalis and colliculum. 

Distribution. Known from France, Spain, Italy (Sicily), and Croatia. 

Remarks. After we identified a male of C hieronella collected on May 11,1 996 at 
"Ste Lucie de Porto Vecchio" on Corsica, we concluded that a female from the same 
locality collected on May 7, 1996 might be conspecific with it. Subsequently, we 
investigated the differences of C hieronella and C variicornis in female genitalia and 
found that they are very little. However, the result is supported by the fact that the two 
paratypes (cf , 9) of C. variicornis from Spain appeared to be true C hieronella, and 
all characters correspond with that species. According to these results, Baldizzone 
(1986) figured under 'C. hieronella" a female of C. hieronella on figures 24 and 25 
(from Andalusia), but C. variicornis on figure 26 (from Eolie Islands, Lipari). 






Nota lepid. 26 (1/2): 27-34 33 

Discussion 

Baldizzone (1983-1997) records 'C. hieronella' from a number of localities in the 
Mediterranean Region. Since this species has been confused with C. variicornis for- 
merly, we do not repeat those records for the distribution of C. hieronella here. It will 
be necessary to re-investigate those records and to verify whether the specimens 
belong to C. hieronella or to C. variicornis. 

Acknowledgements 

We acknowledge the loan of type specimens of metallic green Coleophora-species by Patrice Leraut & 
Joël Minet (MNHN Paris), Wolfram Mey (MNHU Berlin), Lukasz Przybylowicz (ISEZ Krakow), and 
Kevin Tuck (BMNH London). James E. Hogan from the Hope Entomological Collections of the Oxford 
University Museum of Natural History kindly checked for us the type specimen of Coleophora spissi- 
cornis (Haworth, 1828). For the loan of additional specimens we thank Andreas Segerer (ZSM Munich), 
Reinhard Gaedike (DEI Eberswalde), and Hugo van der Wolf (Nuenen). Helmut Kolbeck (Weng) and 
Antonio Vives Moreno (Madrid) kindly supplied our work with literature on Coleophora. We presented 
the discovery of an additional species of dark-metallic green Coleophora-species in Germany to the 
Microlepidoptera-workshop at the SEL-congress held in Korsor in June 2002 and thank the participants 
for their contributions to the discussion, especially Marko Mutanen (Oulu), Antonio Vives Moreno, and 
Hugo van der Wolf (Nuenen). Giorgio Baldizzone (Asti) and Hugo van der Wolf carefully reviewed this 
manuscript and kindly provided constructive comments. We gratefully acknowledge the linguistic 
improvements by Bernard Landry (Geneve) to the English manuscript. 



References 

Baldizzone, G. 1983. Records of the Lepidoptera of Greece based on the collections of G. Christensen 
and L. Gozmâny: III. Coleophoridae. - Annales Musei Goulandris 6: 207-248. 

Baldizzone, G. 1986. Contributions à la connaissance des Coleophoridae. XLII. Sur quelques Coleo- 
phoridae d'Espagne (Seconde partie: Espèces nouvelles pour la Faune espagnole, ou peu connues). 
- Nota lepidopterologica 9 (1-2): 2-34. 

Baldizzone G. 1990 a. Contributi alla conoscenza dei Coleophoridae, LVI. Coleophoridae nuovi o 
poco conosciuti délia fauna Greca (Lepidoptera). - Fragmenta Entomologica, Roma 22 (1): 39-59. 

Baldizzone, G. 1990 b. Contributions à la connaissance des Coleophoridae. LXII. Deux espèces nou- 
velles du genre Coleophora Hübner de la région méditerranéenne (Lepidoptera). - Nota lepi- 
dopterologica 13 (4): 198-206. 

Baldizzone, G. 1994. Contribuzioni alla conoscenza dei Coleophoridae. LXXV. Coleophoridae de-U'Area 
Irano-Anatolica e regioni limitrofe (Lepidoptera). - Associazione Naturalistica Piemontcse Memorie 
3: 5^23. -Apollo Books: Stenstrup. 

Baldizzone, G. 1995. Contribuzioni alla conoscenza dei Coleophoridae. LXXXIY 1 Coleophoridae 
raccolti in Marocco dalla spedizione dello Zoologisk Museum di Copenhagen (Lepidoptera: 
Coleophoridae). - Shilap Revista de Lepidoptcrologia 23 (90): 107 121. 

Baldizzone, G. 1997. Contribuzioni alla conoscenza dei Coleophoridae. LXXXVII. Coleophoridae QUOvi 
o poco conosciuti dell'Africa settcntrionale (Lepidoptera: Coleophoridae). Shilap Revista de 
Lepidoptcrologia 25 (100): 219-257. 

Emmet, A. M., J. R. Langmaid, K. P. Bland, M. F. V Corley & J. Ka/owski l c )%. Coleophoridae. 
126-338. - In: Emmet, A. M. (ed.), The Moths and Butterflies of Great Britain and Ireland 3: 
Yponomeutidae - Elachistidae. Ilarley Books: Colchester. 452 pp. 

Gaedike, R. & W. Hcinickc 1999. Verzeichnis der Schmetterlinge Deutsehlands. Entomofauna 
Germanica 3. - Entomologische Nachrichten und Berichte, Dresden. Beiheft 5: I 216. 

Kaltenbach, T. & R.-U. Rocsler 1985. Untersuchungen zur Zoogeographie der auf Sardinien vorkom- 
menden Coleophoridae (Microlepidopteia) unter Berücksichtigung Ökologischer Aspekte. Neue 
Entomologische Nachrichten, Keltern 16: 1 136. 



34 Nuss & Stübner: Coleophora variicornis stat. rev. in Central Europe 



Nel, J. 1993. Une nouvelle espèce de coléophore bronzé métallique, Coleophora paramayrella n. sp. 

(Lep. Coleophoridae). - Entomologica Gallica 4 (4): 213-217. 
Patzak, H. 1974. Ergebnisse der Albanien-Expedition des "Deutschen Entomologischen Institutes". 88. 

Beitrag: Lepidoptera: Coleophoridae. - Beiträge zur Entomologie, Berlin 24 (5-8): 317-322. 
Razowski, J. 1990. Motyle (Lepidoptera) Polski. XVI-Coleophoridae. - Monografie Fauny Polsky 18: 

1-270, pl. 1. 
Toll, S. 1952. Etude sur les genitalia de quelques Coleophoridae X. - Bulletin de la Société Entomo- 

logique de Muhlhouse 1952 (no. 3, 4, 5, 6, 7-8, 9): 17-24, 27-30, 35-39, 43-47, 53-56, 61-65. 
Toll, S. 1961. Ergebnisse der Mazedonienreise Friedrich Kasys, 1. Teil Lepidoptera: Coleophoridae. - 

Sitzungsberichte der österreichischen Akademie der Wissenschaften, mathematisch-naturwissen- 
schaftliche Klasse Abt. I, 170 (7): 279-304, pl. 1. 
Vives-Moreno, A. 1988. Catalogo mundial sistematico y de ditribucion de la familia Coleophoridae 

Hübner, [1825] (Insecta, Lepidoptera). - Boletin de Sanidad Vegetal 12: 1-196. 
Zeller, P. C. 1849. Beitrag zur Kenntnis der Coleophoren. - Linnaea Entomologica 4: 191^416. 



Notalepid. 26 (1/2): 35^16 35 

Synanthedon pamphyla sp. n. from southern Turkey with a 
comparative analysis of mitochondrial DNA of related species 
(Sesiidae) 

Axel Rallies 

The Walter and Eliza Hall Institute of Medical Research, IG Royal Parade, Melbourne/Parkville, 
Victoria 3050, Australia, e-mail: kallies@wehi.edu au 

Abstract. Synanthedon culiciformis (Linnaeus, 1758) shows a circumpolar distribution and is recorded 
from most parts of the northern Palaearctic region and from North America. Its known sister species, 
Synanthedon talischensis (Battel, 1906), however, is endemic to the Hyrcanian fauna and is found only 
in Talish south of the Caspian Sea. Here, another species, Synanthedon pamphyla sp. n., closely allied to 
S. culiciformis is described from southern Turkey. It is clearly separated from the known species by exter- 
nal characters, morphology of genitalia and bionomics. Further, sequences of two mitochondrial DNA 
regions of S. culiciformis and S. pamphyla sp. n. are analysed and compared to homologous sequences 
of the 'outgroup' species Synanthedon spheciformis ([Denis & Schiffermüller], 1775). This analysis sug- 
gests an isolation of S. culiciformis and S. pamphyla sp. n. for at least 300 000 years and implies that the 
latter species can be regarded as a Pleistocene relict. 

Zusammenfassung. Synanthedon culiciformis (Linnaeus, 1758) ist eine circumpolar verbreitete Art, die 
in der gesamten nördlichen Palaearktis und in Nordamerika vorkommt. Ihre einzige bisher bekannte 
Schwesterart, Synanthedon talischensis (Barrel, 1906), ist dagegen ein Endemit der hyrcanischen Fauna 
und ist nur aus Talish südlich des Kaspischen Meeres bekannt. In dieser Arbeit wird eine weitere eben- 
falls eng mit S. culiciformis verwandte Art, Synanthedon pamphyla sp. n., beschrieben, deren bisher 
bekannte Vorkommen auf die südliche Türkei beschränkt sind. Diese neue Art wird von den bekannten 
Taxa habituell, genitalmorphologisch und bionomisch abgegrenzt. Außerdem werden zwei mitochon- 
driale DNS-Regionen von S. culiciformis und S. pamphyla sp. n. analysiert und mit homologen 
Sequenzen der "Außengruppen-Art" Synanthedon spheciformis ([Denis & Schiffermüller], 1775) ver- 
glichen. Diese Analysen deuten auf eine Isolation von S. culiciformis und S. pamphyla sp. n. seit min- 
destens 300 000 Jahren hin und lassen vermuten, daß es sich bei letzterer um ein Glazialrelikt handelt. 

Key words. Lepidoptera, Sesiidae, new species, mitochondrial DNA, Turkey. 



Introduction 

In Asia Minor the family of clearwing moths (Sesiidae) is unusually rich in species. 
More than 100 species have been reported from Turkey alone (de Freina 1994; 
Spatenka et al. 1999; unpublished data). Like in the entire Mediterranean region or in 
Central Asia, the majority of species in Turkey belong to the rhizophagous genera 
Bembecia Hübner, [1819], Chamaesphecia Spuler, 1910, Dipchasphecia Capuse, 
1973, and Pyropteron Newmann, 1832. Xylophagous genera, of which Synanthedon 
Hübner, [1819] is by far the most species-rich in the Palaearctic region, are poorly 
represented. Considering this, the finding of a large, undescribed Synanthedon 
species in Turkey is remarkable. Here, Synanthedon pamphyla sp. n.. a species closely 
related to Synanthedon culiciformis (Linnaeus, 1758) and Synanthedon talischensis 
(Bartel, 1906), is described from the southern Toms Mts. From both related species 
S. pamphyla differs clearly in external characters and also m details of genitalia and 
bionomics. While S. culiciformis shows a wide circumpolar distribution with records 
from all over the northern Palaearctic and North America. S. talischensis is restricted 
to the Talish south of the Caspian Sea and is thought to be the sister species oi'.V. culi- 
ciformis (Spatenka et al. 1999). S. pamphyla can be regarded as a remarkable addition 
to the S. culiciformis species group. 

© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536 



36 



Rallies: Morphology and mitochondrial DNA of Synanthedonjyamphyla sp. n. from Turkey 




Figs. 1-8. Synanthedon species, all specimens in CAK. 1. S. pamphyla, male, holotype, Turkey. 
2. S. pamphyla, female, paratype, Turkey. 3. S. culiciformis, male, Germany. 4. S. culiciformis, female, 
Germany. 5. S. culiciformis, male, Bulgaria. 6. S. culiciformis, male, Bulgaria. 7. S. stomoxiformis amasina, 
male, Turkey. 8. S. stomoxiformis amasina, male, Greece. 



Notalepid. 26 (1/2): 35^6 



37 



Up to now, proposed phylogenetic relationships within the family Sesiidae are 
solely based on morphological analyses. DNA sequence data that have been widely 
applied in Lepidoptera systematics in the past decade (reviewed in Caterino et al. 
2000) have not been used for phylogenetic inference in Sesiidae. Nuclear genes, such 
as 18S rDNA, are one of the primary sources of molecular characters for relationships 
among more divergent groups (Hillis & Dixon 1991; Wiegmann et al. 2000). Mito- 
chondrial genes have proven most useful for relatively recent divergences, especially 
of mid Tertiary and younger age and thus have been mainly used to reconstruct the 
phylogenetic relations of species within closely related taxa groups (Lopez etal. 1997). 
Except for a study on the pheromone binding protein (Willett 2000) published 
sequence data of Sesiidae are not available. In this work, two different mitochondrial 
DNA fragments were analysed to estimate the genetic divergence of the two closely 
related species, S. pamphyla sp. n. and S. culiciformis . The results presented here may 
stimulate further molecular research on the phylogeny of Sesiidae. 



Material and Methods 

DNA isolation, primers, PCR conditions. DNA was extracted from 
the abdomen of dried specimens using a rapid and simple salt-based method as 
described previously (Aljanabi & Martinez 1997). The ND1 fragment was amplified 
using forward primer (5'ACATGATCTGAGTTCAAACCGG) and reverse primer 
(5'GCTGGTTGATCTTCTAATTCTA) (Weller et al. 1994). It contains 576 nucleo- 
tides and comprises a part of the 16S ribosomal RNA gene, the tRNA-Leu gene and 
a portion of the first exon of the NADH dehydrogenase subunit 1 gene. The CO fragment 
consists of 586 nucleotides and contains the 3' end of the cytochrome oxidase subunit 
I gene, the leucine tRNA gene, and the 5' end of the cytochrome oxidase subunit II 
gene. It was amplified using the primers S2792 (5'ATACCTCGACGTTATTCAGA) 
and A3389 (5' TCATAAGTTCAATATCATTG) (Brown et al. 1994). For each speci- 
men PCR fragments were obtained by two independent PCR reactions, cloned into 
pCR-XL-TOPO vector (Invitrogen) and sequenced by light cycler. PCR protocols 
were adopted from Weller et al. (1994) and Brown et al. (1999) respectively. 

Specimens used for DNA analysis. S. culiciformis: cf, Germany, Brandenburg. Neubrück 
near Gr. Köris, 2000, leg. Kallies & Garrevoet (Gen. prep. AK327, DNA-AK3) (CAK); Cf, Germania, 
Thüringen, Fischbachtal, 1991, leg. Eue (Gen. prep. AK328, DNA-AK4) (CAK); 9. Russia, middle 
Volga region, 40 km NEN Uljanovsk, Yumanovka, forest, 1997, leg. Tumanova (DNA-AK1 1 ) (CAK); S. 
pamphyla: cf, 9 (paratypes, Gen. Prep. AK322, DNA-AK8; Gen. Prep. AK320, DNA-AK1) (CAK); S. 
spheciformis'. cf, Germany, Mecklenburg, Hüttelmoor near Rostock, 1996, leg. Alliens (den. prep. 
AK338, DNA-AK5) (CAK). 

Material examined for morphological comparison. S. culiciformis: Norway: 9» Buskerud 
Fylke, Store Rodungen, Aal Kommune. 950 m. 1993, leg. Ockruck (CJG); France: 9- Alpes, lignes les 
Brév., 45°30'N 6°56 , E, leg. Schmidt (CUR); Germany: cf. Brandenburg, Oderberg, Pimpinellenberg, 
1996, leg. Kallies (Gen. prep. AK321) (CAK); cf, Brandenburg. Neubrück bei Gr. Kons. 2000. e.l., leg. 
Kallies & Garrevoet (Gen. prep. AK327) (CAK); cf, Thüringen. Pischbachtal, 1991, leg. Eue (Gen. piep. 
AK328) (CAK); 9, Mecklenburg, Grambower Moor near Schwerin. 1992. e.l. leg. Kallies (Gen. piep. 
AK323) (CAK); Austria: cf Lacken, 1942, leg. Reich! (den. prep. AK326) (CAK); Switzerland: Ç, 
Graubünden, Maloja pass, 1500m, 1991, leg. Riefenstahl (CUR): Russia: 9. middle Volga region. 40 km 
NEN Uljanovsk, Yumanovka, forest, 1997, leg. Tumanova (CAK); 9- Saratov distr., Polivanovka, 1929, 
lg. Richter (Gen. prep. AK355) (CAK); 9, Transbaikal, Noworotnaja. Schilka river, 2000 m (CAK); 



•^Q Kallies: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey 



Bulgaria: 5c? , 2ç>, Mitchurin, 1987 e.L, ex Alnus, leg. Lastuvka (CZL, CAK); USA: 9, Maryland, 
Chestertown, 1999, leg. Mistera (CHR). S. stomoxiformis: Germany cf, 9, Werbach near 
Tauberbischofsheim, ex Frangula, 1991, leg. Kallies (CAK). S. stomoxiformis amasina: Turkey: 

d\ Prov. Artvin, Kackar Dagi, Sarigöl-Yaylalar, 1500 m, 1995, leg. Kallies (CAK); Greece: cf, 
Pelepones, Kardamili, 1999, leg. Lastuvka (CAK). 

Abbreviations. ETA - external transparent area; PTA - posterior transparent area; ATA - anterior trans- 
parent area; CAK - collection A. Kallies; CHR - collection H. Riefenstahl, Hamburg, Germany; CJG - 
collection J. Gelbrecht, Königs Wusterhausen, Germany; CZL - collection Z. Lastuvka, Brno, Czech 
Republic. 



Taxonomic part 

Synanthedon pamphyla sp. n. 

Material. Holotype cf 'Turkey S, Toros Mts, ca. 25 km NW Alanya, Güzelbag, ca. 500 m, larva 
30.X.2001, ex Alnus orientalis, 9-25 .111.2002 e.L, leg. A. Kallies, A. Musolff & Th. Drechsel' (CAK, the 
holotype will be deposited in the Museum fur Naturkunde Berlin, Germany). Paratypes: lie?, 10Ç, same 
dates as holotype (CAK) (of two males and one female genitalia examined, gen. prep. AK320, AK322, 
AK325); 9, same locality data as holotype, 12.IV2001 on leaf of Alnus orientalis, leg. Th. Drechsel 
(CAK); c?, 49, Turkey S, Toros Mts, ca. 10 km E Alanya, Dimcay river valley, ca. 200 m, larva, early 
IX.2001, ex Alnus orientalis, 9-25.ffi.2002 e.L, leg. A. Kallies, A. Musolff & Th. Drechsel (CAK); 39, 
Turkey, between Ödemis and Salihli, northern slope of Boz Dagi, 1000 m, 38°22'N 28°07'E, 19.V1983, 
leg. E. Hüttinger (CZL); 9, Turkey, Prov. Izmir, 3 km N Bozdag (Birgi-Salihli), 900 m, 38°22'N 27°58'E, 
22.V1981, leg. H. & R. Rausch, F. Ressl (CZL). 

Male (holotype, Fig. 1). Alar expanse 26.0-28.0 mm, body length 14.0-16.0 mm, 
forewing length 11.5-12.5 mm, antenna 8.3-8.6 mm. 

Head, black almost throughout; frons laterally bright white; pericephalic scales 
laterally orange. Thorax: black; ventrally with a large orange-red spot; mesothorax 
with white hairlike scales dorso-laterally. Legs: entirely black. Abdomen: black; 
tergite 2 dorsally with a red orange band along posterior margin, laterally with orange- 
red spots; segment 4 with a broad orange-red, ventrally open band; anal tuft com- 
pletely black. Forewing: discal spot broad, with a narrow and short projection into the 
ATA; PTA well-developed, reaching under discal spot; ETA round, relatively small, 
maximally about 1.5x broader than discal spot; apical area broad and black, cell 
between R4 and R5 opaque; veins, costal and anal margins dorsally black, the latter 
with a few individual red scales near base; ventrally cubitus, costal and anal margins 
covered with orange scales; fringe black. Hindwing: with relatively broad discal spot 
which reaches M3; ventrally basal portion of the costal margin orange. 

Female (paratype, Fig. 2). Very similar to male but larger (alar expanse 
27.0-30.5 mm, one female with 24.0 mm), ETA somewhat smaller; ATA with some 
black scales in distal portion; outer margin of hindwing broader. 

Genitalia (Figs 10, 12). Very similar to that of S. culiciformis (diagnosis below). 

Diagnosis. This new species is closely related and similar to Synanthedon culi- 
ciformis and S. talischensis. From both species, however, it can be easily separated by 
external characters. S. pamphyla differs from S. culiciformis by the broader discal spot 
and the smaller ETA of the forewing (ETA maximally 1.5* broad than discal spot; 3x 
broader in S. culiciformis), by the broader apical area (along R3 about as broad as 
ETA; 1/3 to 1/2 x as broad in S. culiciformis), by the opaque cell between Cul and Cu2 
(transparent in S. culiciformis), by the shape of the PTA (just reaching the discal spot; 
reaching beyond in S. culiciformis), by the equally broad discal spot of the hindwing 



Notalepid. 26 (1/2): 35^6 



39 




0,5 mm 




0.2 mm 



££*»% 





0.2 mm 



Figs. 9-10. Male genitalia, a uncus-tegumen. b Saccus, c righl val va. d aedeagus (scale bar 
0.5 mm), e - basal part of the crista sacculi (scale bar 0.2 mm). 9. Synanthedon culiciformis, Germany 
(gen. prep. AK327, CAK). 10. Synanthedon pamphyla sp. n.. Turkey (gen. prep. AX325, CAK). 



40 Rallies: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey 

(narrower and pointed towards M2 in S. culiciformis), by the almost complete absence 
of red scales at the forewing base (present and very pronounced in S. culiciformis), by 
the black labial palps (ventrally red in S. culiciformis), by the completely black legs 
(tarsomers yellow in S. culiciformis), by the color of the abdomen (in S. culiciformis 
tergite 2 only occasionally red, red ring of segment 4 ventrally closed), and by the 
color of the ventral side of the forewing (orange-red scaling extending into the apical 
area in S. culiciformis). Further, S. pamphyla is conspicuously larger than S. culici- 
formis (alar expanses in males of S. culiciformis only 20-26 mm, in females 23-28 mm). 
From S. talischensis the new species differs by completely black antennae (distally 
white in S. talischensis), by the black labial palps (ventrally red in S. talischensis), and 
by the broad discal spot of the hindwing (small in S. talischensis). 

Consistent differences between S. pamphyla and S. culiciformis are also found in 
the morphology of the genitalia (Figs. 9-12). In male S. pamphyla, the valva is broad 
and arched, the distal end of the crista sacculi is relatively close to the ventral margin 
of the valva (valva narrow and straight, crista sacculi stronger bent with distal end 
more close to the setae field in S. culiciformis), the small 'secondary' crista connecting 
the proximal portion of the crista sacculi with the surface of the valva (Figs. 9e, 10e) 
is absent while it is present in S. culiciformis, the crista medialis of the gnathos is dis- 
tally somewhat longer and more pronounced than in S. culiciformis, and the ventral 
margin of the crista medialis is simple while it is cloven in S. culiciformis. In female 
genitalia (Figs. 11, 12), S. pamphyla displays short apophyses anteriores which do not 
reach the corpus busae (longer, reaching the corpus bursae in S. culiciformis) and the 
deepening in which the ostium and the proximal part of the ductus bursae is situated 
is covered with small well-sclerotized hooks (nearly absent in S. culiciformis). 
Furthermore, the ostium bursae is narrower, not conspicuously funnel-shaped as it is 
in S. culiciformis, and shows a small roundish distal plate ventrally which is absent in 
S. culiciformis. Since there was no material of S. talischensis available for detailed 
genitalia examination potential differences could not be investigated. 

Besides the two species compared above, S. pamphyla is also similar to S. stomoxi- 
formis (Hübner, 1790). Externally the latter can be separated by the black abdominal 
segment 2, the partially red tegulae, the laterally orange edged anal tuft, the com- 
pletely black frons, and the ventrally black thorax. Moreover, S. stomoxiformis dis- 
plays a completely different morphology of the genitalia (cf. Spatenka et al. 1999). 

Variability. Except for size, S. pamphyla is almost invariable in terms of external 
appearance. In some regions (Bulgaria, southern Russia) specimens of S. culiciformis 
with relatively small transparent areas and broad discal spots can be found. These 
specimens frequently display a red ring on abdominal segment 2. However, additional 
characters such as the red labial palps, yellowish tarsi and ventrally closed red 
abdominal ring are consistent and distinguish these populations from S. pamphyla. 
More importantly, characters of male and female genitalia used to differentiate 
between S. culiciformis and S. pamphyla did not show any variation. 

Distribution. To date S. pamphyla is known from the southern part of Turkey 
(Provinces of Antalya and Izmir), however, this species can probably be found asso- 
ciated with its hostplant along the Mediterranean coast of Turkey. 



Notalepid. 26 (1/2): 35-46 



41 





12 




Figs. 11-12. Female genitalia, ventral view (scale bar 0.5 mm), a - ostium and proximal part of ductus 
bursae (scale bar 0.2 mm). 11. Synanthedon culiciformis, Germany (gen. prep. AK323, CAK). 12. 
Synanthedon pamphyla sp. n., Turkey (gen. prep. AK320, CAK). 



Records of S. culiciformis from Turkey (Spatenka et al. 1999) may at least in part 
relate to specimens of S. pamphyla of which one was figured previously (Lastuvka & 
Lastuvka 1995: pi. 3 fig. 10, misidentified as S. culiciformis). The presence of S. culi- 
ciformis in Turkey needs verification. While this species may occur in the northern 
part of Turkey it is very unlikely to be found in the southern provinces. Specimens of 
S. culiciformis (Figs 6-7) from Micurin, Bulgaria, are the records which are geo- 
graphically closest to the known range of S. pamphyla. 

Bionomics. The hostplant of the new species is Alnus orientalis Decne 
(Betulaceae). This tree grows along rivers and streams on the southern slopes of the 
Toros Mts often accompanied by Nerium (Apocynaceae), Plaianus (Platanaceae) or 
Vitis (Vitaceae). Typically S. pamphyla inhabits the main shoot of young trees from 
1 to 6 cm diameter where it can be found from close to the root up to 4 m high in the 
tree. Infested trees usually can be recognised easily by a conspicuous swelling which 
is often accompanied by a patch of dead and dry bark. In autumn the full grown larva 
is found in a tunnel which leads from the swelling 8 to 15 cm upwards within the 



42 



Kallies: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey 



wood of the stem. Pupation takes place in early spring head-down in a cocon made 
from narrow wooden chips which is tightly attached to the tunnel's inner surface. The 
emerging hole is closed by fibrous wood chips which are pressed out of the hole by 
the larva. Occasionally, larvae can be found associated with injuries of the stem. 
Several larvae were found in the remnants of an older Alnus tree which was cut down 
a year before. 

The known localities of S. pamphyla are within the Eumediterranean to 
Mesomediterranean climate zone on the slopes of the Toros mountain range mostly 
between 200 and 500 m. The average temperature in January is 5-9 °C and in summer 
between 25 and 27 °C. Temperatures below zero are rare in this zone. Under labora- 
tory conditions branches which contained larvae, were stored from early December to 
early March in a humid environment at about 5 to 15 °C. After placing the branches 
at room temperature adults emerged within 3 to 19 days. From this it is assumed that 
under natural conditions adults can also be found in early spring probably from March 
to April. So far, however, only one adult specimen, a somewhat worn female, was 
observed at the type locality by Mr. Thomas Drechsel on the 12th of April. Some addi- 
tional specimens which are also part of the type series have been collected at an alti- 
tude of 900-1000 m on the slopes of the Boz Mts near Izmir. These specimens, all 
females, were collected at the end of May. 

Derivatio nominis. The species name derives from the ancient kingdom of 
Pamphylia which was situated east of Antalya about 3000 years ago. 

Genetic analysis 

Analysis of sequence divergence. To estimate the genetic distance 
between S. culiciformis and S. pamphyla and to initiate molecular characterisation of 
Sesiidae in systematics, the sequence of two mitochondrial DNA fragments, ND1 and 
CO, was analysed. As a prelude to interspecific analysis, the intraspecific variation 
within the ND1 and CO fragments was determined. While specimens of individual 
populations (as determined for the ND1 fragment in S. culiciformis from Brandenburg 
and S. pamphyla from the type locality) in general did not show sequence variation, a 
series of Thymidines (positions 31 to 39 of the fragment) within the 5' end of ND1 
fragment was found to be of variable length even among specimens of the same po- 
pulation. Since this region could not be reliable aligned it was omitted from analysis as 
was suggested by Brower (1994). Under these conditions, in the ND1 fragment seven 
positions (1 .23%) and in the CO fragment five positions (0.85%) were consistently dif- 
ferent between specimens of S. culiciformis from central Europe and specimens of S. 
pamphyla from the type locality in southern Anatolia. Of these changes only one, with- 
in the ND1 fragment, was modified by transversion, all other changes were transitions. 
The comparison of the sequences generated from a specimen of S. culiciformis from 
the Volga region of southern Russia and specimens of S. pamphyla indicated a higher 
degree of similarity. In this approach only 0.7% sequence divergence (four positions) 
for the ND1 fragment or 0.85% (five positions) for the CO fragment were found 
between the two taxa. However, while among specimens of S. culiciformis from 
Brandenburg and Thuringia only one position was found to be targeted by substitution, 
the mean divergence between these specimens and the specimen from southern 



Nota lepid. 26 (1/2): 35^6 



43 



Tab 1. Uncorrected pairwise distances (below diagonal) and transition / transversion ratio (above diago- 
nal). GB - Germany, Brandenburg; GT - Germany, Thuringia; RV - Russia, Volga region 




1 


2 


3 


4 


5 


1 S. spheciformis 


- 


3.4 


3.4 


3.3 


3.0 


2 S. culiciformis 'GB' 


0.0925 


- 


- 


12.0 


12.0 


3 S. culiciformis 'GT' 


0.0925 


0.0009 


- 


13.0 


12.0 


4 S. culiciformis 'RV 


0.0900 


0.0104 


0.0113 


- 


- 


5 S. pamphyla 


0.0900 


0.0104 


0.0104 


0.0078 


- 



Russia was as high as 0.97% indicating a genetic distance almost as high as the dis- 
tance between central European S. culiciformis and S. pamphyla. In fact, a phyloge- 
netic tree based on the mitochondrial sequence data generated in this study would 
group the specimen from the Volga region and S. pamphyla as sister taxa (not shown). 

As an 'outgroup' species Synanthedon spheciformis ([Denis & Schiffermüller], 
1775) was used in this study. The ND1 fragment of this species shows a divergence 
of about 9% to both S. pamphyla and S. culiciformis with several indels (gaps and 
insertions) in the 5 ' noncoding part of the fragment. Table 1 shows the uncorrected 
pairwise distances for all haplotypes as calculated from the ND1 and CO fragment 
(since for S. spheciformis a CO fragment could not be generated, distances and ratios 
for this species relate only to the ND1 fragment) and the ratio of transitions versus 
trans versions. All sequences are available at DDBJ/EMBL/GenBank, Accession Nos 
AY304 162-70. 

Applying a 'molecular clock'. Brower (1994) has proposed a molecular 
clock for arthropod mitochondrial DNA and assumed a constant pairwise mutation 
rate of about 2.3% per million years. Applying this molecular clock the corresponding 
age of the separation of S. culiciformis and S. pamphyla is estimated to be 300 000 to 
500 000 years. The divergences found in comparison of S. spheciformis to the species 
of the S. culiciformis group suggests a separation nearly 5 million years ago. 



Discussion 

The tribe Synanthedonini comprises an extensive group of clearwing moths which 
is found in all Zoogeographie regions. There are several genera recognized in the tribe 
of which the genus Synanthedon (sensu auctorum) which includes mainly 
xylophagous species, is by far the most species rich. However, in the Palearctic region 
rhizophagous genera, i.e. Dipchasphecia, Bembecia, Pyropteron, and Chamaesphecia, 
account for the bulk of Synanthedonini species. Most of the members of these genera 
can be placed into species groups partly containing large numbers of closely related 
species which are often found only in small ranges suggesting relatively recent radia- 
tions within the Palearctic region. While the rhizophagous genera are mainly well 
defined monophyletic groups, the genus Synanthedon in the present concept is likely 
to be paraphyletic (Lastuvka 1992a, b; unpublished data). 

In most cases, Palearctic Synanthedon species can be differentiated clearly by 
external and genitalic characters and often appear only distantly related, a view which 
is supported by the finding of this study (i.e. the large genetic distance of S. spheci- 
formis and the species of the S. culiciformis group). There are only few and usually 



44 Rallies: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey 



small species groups such as the S. formicaeformis (Esper, 1783), S. tipuliformis 
(Clerck, 1759), and S. vespiformis (Linnaeus, 1761) groups in the Palearctic region 
and the formation of local endemits, such as S. geranii Kallies, 1997 from Greece, is 
rather unusual, suggesting that recent species radiation in Palearctic Synanthedon is 
not as common as in rhizophagous Synanthedonini. 

The Holarctic Synanthedon culiciformis, the south Anatolian S. pamphyla and the 
Hyrcanian (south-west Caspian) S. talischensis are closely related but strictly 
allopatric species which share broad morphological, bionomical, and genetic simila- 
rities (as shown for two species). While Synanthedon culiciformis shows a circumpolar 
distribution with records from all over the northern Palearctic and North America, 
S. talischensis and S. pamphyla are restricted to the Talish south of the Caspian Sea 
and to the southern Toros Mts of Anatolia, respectively. To answer the question of how 
long populations of these three species have been separated and the gene flow 
between has been disrupted, it is appropriate to consider the history of climate 
changes in Asia Minor. Like in the entire northern hemisphere, the climate of Anatolia 
has been strongly influenced by the glacial ages. Periods of milder to warm climates 
alternated with periods of colder climates which triggered the spreading of arctic and 
boreal flora and fauna towards the south. During the past 1.7 million years at least 
17 glacial-interglacial oscillations occurred in the Mediterranean region (Bertolani- 
Marchetti 1985). Glacial periods, such as the Wurm glacial, caused the progression of 
the subarctic region deep into southern Europe and Asia Minor. During these times 
the average temperature in present Anatolia was about 8 to 10 °C lower than today and 
a maximal extension of the distribution of arctic and boreal species such as 
Synanthedon culiciformis can be supposed. At the same time, however, Eumediterra- 
nean vegetation was well-established in the lower parts of the southern Toros Mts 
(Wagener 1995). It can be assumed that in line with the glacial oscillations a geo- 
graphic separation and lasting isolation of at least two different populations of the 
Synanthedon culiciformis group took place. Genetic analysis indicates that speciation 
occurred 300 000 to 500 000 years ago suggesting an isolation during early glaciation 
events. Later, regression of the arcto-boreal vegetation led to a geographic isolation 
and an interruption of a potential gene flow between the isolated ancestor populations 
of Synanthedon pamphyla and Synanthedon talischensis on one side and Synanthedon 
culiciformis on the other side. 

Réfugia, such as the Hyrcanian and the Tauro-Mediterranean regions, were essen- 
tial for the survival of flora and fauna during the glacial periods of Pleistocene. These 
regions contain many endemic species (Wagener 1995) and Synanthedon pamphyla 
may represent another example of endemism in the southern Toros Mts. 

Although there is a general trend for reproductive isolation to increase with genet- 
ic divergence this relationship is hardly predictive for identifying new species. A broad 
variation in genetic distance between sibling species has been found in different 
studies ranging from undetectable to more than 13% (reviewed in Ferguson 2002). 
Several studies indicate that the mitochondrial DNA evolves at a similar rate in a wide 
range of organisms (Brower 1994; Avise et al 1998) but the duration of speciation 
varies widely from several thousand years, as shown for fishes, and several million 
years, in mammals and other vertebrates (reviewed in Avise et al 1998). 

Analysis of mitochondrial sequences carried out in this study revealed a degree 
of divergence between Synanthedon pamphyla and Synanthedon culiciformis of 



Notalepid. 26 (1/2): 35^6 



45 



0.78-1.04% consistent with rates of between 0.19% and 5% found for haplotypes 
within species groups or for sibling species in other studies on Lepidoptera (Caterino 
& Sperling 1998; Brown et al 1999; Blum et al 2003). This result and the high ratio 
of transitions to transversions support a very close relationship of both species, in 
agreement with the hypothesis of a speciation during the Pleistocene. Further, in this 
study surprisingly clear sequence differences between populations of S. culiciformis 
from the 'western' (central European) and the 'south-eastern' part (southern Russia) 
of the range were found. In fact, the distance between the Russian S. culiciformis com- 
pared to central European culiciformis was higher than the distance between Russian 
S. culiciformis and S. pamphyla (Tab. 1). This result as well as external characters of 
S. culiciformis from southern Russia and Bulgaria (such as the broad discal spot and 
the small transparent areas of the forewing) which distinguish these populations from 
central European S. culiciformis suggest that the south-eastern clade of S. culiciformis 
is well separated from the main part of the species range and may represent the sister 
taxon of S. pamphyla leaving S. culiciformis in the present concept paraphyletic. More 
material of S. culiciformis from various parts of its range especially from Bulgaria and 
southern Russia as well as material of S. talischensis and its detailed examination both 
on morphological and molecular level is necessary to decide whether a further taxo- 
nomic differentiation of the S. culiciformis group is appropriate. 

The higher degree of sequence similarity between the south Russian S. culiciformis 
and S. pamphyla suggests that S. pamphyla has evolved from an isolated population 
of the 'south-eastern clade' of S. culiciformis. Interestingly, the specimens from 
Bulgaria just like S. pamphyla and S. talischensis were bred from Alnus, which is 
utilized by S. culiciformis only occasionally as a host plant. It could be speculated that 
speciation in the S. culiciformis group was promoted not only by geographic isolation 
but also by host plant switch. 

As demonstrated by Ferguson (2002) genetic distance itself is not sufficient for 
species identification since several additional factors, e.g. degree of sympatry and 
geographical range, have a strong effect on the genetic distance measured. 
Accordingly, in this work, genetic distance was not used to separate S. pamphyla from 
S. culiciformis, rather mitochondrial sequence analysis was applied to reconstruct 
speciation in a temporal and geographical frame. 

As an 'outgroup' species S. spheciformis was used in this study. This species is 
well separated from the species of the S. culiciformis group. Mitochondrial DNA 
divergences found in comparison of S. spheciformis to the species of the S. culici- 
formis group suggest a much earlier separation, nearly 5 million years ago. This is 
in line with morphological data indicating a more distant relationship between 
S. spheciformis and the S. culiciformis species group. 



Acknowledgements. First of all I want to express my hearty thanks to my good friend Thomas Drechsel, 
(Neubrandenburg, Germany) with whom I shared many interesting and successful collecting trips. 
He was the one who collected the first specimen of S. pamphyla at the type locality and donated it to me. 
Further, I wish to thank Sven-Ingo Erlacher (Jena, Germany) for helpful comments on DNA analysis in 
insect phylogeny, Dr Zdenek Lastuvka (Brno, Czech Republic), Dr Jörg Gelbrecht (Königs Wuster- 
hausen, Germany) and Hans Riefenstahl (Hamburg, Germany) for the possibility to study material under 
their care, and to Dr Vadim Zolotuhin (Uljanovsk, Russia) for donating specimens for comparison. 
Finally, I want to express my heartiest thanks to my wife Anne for joining me on several expeditions and 
helping me collecting the larvae of the species described here, and to Dr Douglas Hilton (Melbourne, 
Australia) for correcting the English version of this article. 



46 



Kallies: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey 



References 

Aljanabi, S. M. & L. Martinez 1997. Universal and rapid salt extraction of high quality genomic DNA 
for PCR-based techniques. - Nucleic Acid Research 25: 4692^1693. 

Avise, J. C, D. Walker & G. C. Johns 1998. Speciation durations and Pleistocene effects on vertebrate 
phylogeography. - Proceedings of the Royal Society of London (B) 265: 1707-1712. 

Bertolani-Marchetti, D. 1985. Pollen paleoclimatology in the Mediterranean since Messinian time. 
Pp. 525-543.-7«: D. J. Stanley, D. J. & F.-C. Wezel (eds), Geological evolution of the Mediterranean 
Basin. Springer Verlag, New York-Berlin-Heidelberg-Tokyo. 

Blum, M. I, E. Bermingham & K. Dasmahapatra 2003. A molecular phylogeny of the neotropical but- 
terfly genus Anartia (Lepidoptera: Nymphalidae). - Molecular Phylogenetics and Evolution 26: 
46-55. 

Brown, J. M., O. Pellmyr, J. N. Thompson & R. G. Harrison 1994. Phylogeny of Greya (Lepidoptera: 
Prodoxidae), based on nucleotide sequence varaition in mitochondrial cytochrome oxidase I and II: 
Congruence with morphological data. - Molecular Biology and Evolution 11: 128-141. 

Brown, B., R. M. Emberson & A. M. Paterson 1999. Phylogeny of "Oxycanus" lineages of Hepialid 
moths from New Zealand inferred from sequence variation in the mtDNA COI and II gene regions. 
- Molecular Phylogenetics and Evolution 13: 463-473. 

Brower, A. V Z. 1994. Rapid morphological radiation and convergence among races of the butterfly 
Heliconius erato inferred from patterns of mitochondrial DNA evolution. - Proceedings of the 
National Academy of Sciences of the United States of America 91: 6491-6495. 

Caterino, M. S., S. Cho & F. A. H. Sperling 2000. The current state of insect molecular systematics: a 
thriving tower of Babel. -Annual Review of Entomology 45: 1-54. 

Caterino, M. S. & F. A. H. Sperling 2002. Papilio phylogeny based on mitochondrial cytochrome oxidase 
I and II genes. - Molecular Phylogenetics and Evolution 11: 122-137. 

de Freina, J. J. 1994. Contribution a la connaissance de la faune des Sesiidae de l'Asie Mineure 
(Lepidoptera: Sesiidae). - Linneana Belgica 14: 455^180, 25 figs, 56 maps. 

Ferguson, J. W. H. 2002. On the use of genetic divergence for identifying species. - Biological Journal 
of the Linnean Society 75: 509-516. 

Hillis, D. M. & M. T. Dixon 1991. Ribosomal DNA. Molecular evolution and phylogenetic inference. - 
Quarterly Review of Biology 66: 411-453. 

Lastuvka, Z. 1992a. Zur Systematik der paläarktischen Gattungen der Tribus Synanthedonini. 1. Mor- 
phologie und Klassifikation (Lepidoptera, Sesiidae). - Acta Universitatis Agricultrae, Brno (A) 38 
(1990): 221-233. 

Lastuvka, Z. 1992b. Zur Systematik der paläarktischen Gattungen der Tribus Synanthedonini. 2. Phylo- 
genese (Lepidoptera, Sesiidae). -Acta Universitatis Agricultrae, Brno (A) 38 (1990): 235-242. 

Lastuvka, Z. & A. Lastuvka 1995. An illustrated key to European Sesiidae (Lepidoptera). - Mendel 
University of Agriculture and Forestry, Brno. 174 pp. 

Lopez, J. V, M. Culver, J. C. Stephens, W. E. Johnson & S. J. O'Brien 1997. Rates of nuclear and cyto- 
plasmic mitochondrial DNA sequence divergence in mammals. - Molecular Biology and Evolution 
14:277-286. 

Spatenka, K., O. Gorbunov, Z. Lastuvka, I. Tosevski & Y. Arita 1999. Sesiidae - clearwing moths. -In: 
C. Naumann (ed.), Handbook of Palaearctic Macrolepidoptera. Vol. 1. - Gem Publ. Co., Wallingford, 
England. 569 pp. 

Wagener, S. 1995. Klima- und Vegetationsgeschichte des Vorderen Orients. -In: G. Hesselbarth, H. van 
Oorschot & S. Wagener, Die Tagfalter der Türkei. - Selbstverlag Sigbert Wagener, Bocholt. 1354 pp, 
141 pis, 342 + 4 maps. 

Weller, S. J., D. P. Pashley, J. A. Martin & J. L. Constable 1994. Phylogeny of noctuid moths and the util- 
ity of combining independent nuclear and mitochondrial genes. - Systematic Biology 43: 194-21 1. 

Wiegmann, B. M., C. Mitter, J. C. Regier, T. P. Friedlander, D. M. Wagner & E. S. Nielsen 2000. Nuclear 
genes resolve Mesozoic-aged divergences in the insect order Lepidoptera. - Molecular Phylogenetics 
and Evolution 15: 242-259. 

Willet, C. S. 2000. Do pheromone binding proteins converge in amino acid sequence when pheromones 
converge? - Journal of Molecular Evolution 50: 175-183. 



Notalepid. 26 (1/2): 47-57 



47 



Study on the genus Clepsis Guenée, 1845 from China 
(Tortricidae) 

Xinpu Wang, Houhun Li ! & Shuxia Wang 

Department of Biology, Nankai University, Tianjin 300071, P. R. China. 
1 Corresponding author, e-mail: lihouhun@nankai.edu.cn 

Abstract. The present paper reports fifteen species of the genus Clepsis Guenée, 1 845 from China. 
Among them, two species, C. laetornata sp. n. and C.flavifasciaria sp. n., are described as new to sci- 
ence with genital structures illustrated. Three species, C celsana (Rennel), C. neglectana (Herrich- 
Schäffer) and C. luctuosana (Rebel), are newly recorded from the country. The female of C. aba 
Razowski is described for the first time to science. Key to all the known Chinese species is given based 
on external characters and male genital characters respectively. 

Key words. Lepidoptera, Tortricidae, Clepsis, new species, China. 



Introduction 

Clepsis Guenée, 1 845 is a large genus of the subfamily Tortricinae, tribe Archipini. To 
date about 112 species have been reported worldwide, including sixty-four species 
from the Palaearctic Region, ten species from the Nearctic Region, ten from the Oriental 
Region, thirty-six from the Neotropical Region and one from the Afrotropical Region. 
In Asia, four species are recorded from Korea (Byun 1998), six from Japan (Kawabe 
1982), two from Nepal (Diakonoff 1976), one from northern Sumatra (Diakonoff 
1983), four from Taiwan (Kawabe, 1992b) and two from the northern part of China 
(Liu 1977). In China a total often species of the genus Clepsis have been recorded so 
far (Razowski 1979a, 1979b; Kawabe 1992b). In this paper two new species, Clepsis 
laetornata sp. n. and Clepsis flavif as ciaria sp. n., are added to the world fauna, three 
species are newly recorded from China and the female of Clepsis aba Razowski, 1979 
is described for the first time. Distributions of Chinese species of Clepsis are shown 
in Fig. 1. The type specimens are deposited in the Department of Biology, Nankai 
University, Tianjin, China. The research was supported by National Natural Science 
Foundation of China (No. 39960017). 

Clepsis Guenée, 1845 

Clepsis Guenée, 1845: 168. Type species: Tortrix rusticana Hübner, [1799]. 
Smicrotes Clemens, 1860: 355. Type species: Smicrotes peruana Clemens, I860. 
Siclobola Diakonoff, 1947: 25. Type species: Tortrix unifasciana Duponchel, 1843. 
Pseudamelia Obraztsov, 1954: 196. Type species: Tortrix unicolorana Obraztsov, 1954. 
Mochlopyga Diakonoff, 1955: 44. Type species: Tortrix humana Meyrick, 1912. 

This genus is well identified by the following characters: transtilla absent, labis with 
strong sclerotized disc and its upper edge armed with thorns, valva elongate with 
more or less distinctly differentiated terminal part, sacculus without free termination 
in male genitalia. 

© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536 



48 



Wang, Li & Wang: Study on the genus Clepsis Guenée from China 



The genus Clepsis was divided into seven species-groups by Razowski (1979a). 
According to his system, C laetomata sp. n. should belong to the group of C rurinana 
and C. flavifasciaria sp. n. to the group of C unicolorana. 




Fig. 1. Distributional map of Clepsis species in China. Legend: D C. laetornata sp. n.; ♦ C. flavifasciaria 
sp. n.; • C. aba Razowski; & C. celsana (Rennel); * C. neglectana (Herrich-Schäeffer); O C. luctuosana 
(Rebel); A C. rurinana (Linnaeus); A C. pallidana (Fabricius); C. melissa (Meyrick); ■ C. aerosana 
(Lederer); X C. zeuglodon Razowski; * C. razowskii Kawabe; © C. owadai Kawabe; # C. hohaunsha- 
nensis Kawabe; C. provocata (Meyrick) 



Key to the Chinese species of Clepsis based on external characters 

1 . Forewing with many yellowish brown streaks. C. razowskii 

- Forewing without yellowish brown streaks. 2 

2. Male forewing with costal fold. 3 

- Male forewing without costal fold. 12 

3. Hindwing yellow, termen black; costal edge of underside of forewing 



5. 



6. 



C. flavifasciaria sp. n. 
4 
C. pallidana 
5 
C. celsana 
6 
7 
8 
Front white; basal blotch, median fascia and subapical blotch very distinct, brown. 

C. laetornata sp. n. 
Front yellowish ochreous; median fascia strongly broadened medially, rust brown. C. aba 



with brightly yellowish fascia. 

Hindwing pale gray or whitish. 

Forewing with ground color yellow, two parallel fasciae present. 

Forewing with ground color brownish or pale gray. 

Forewing with costal fold very slender and short. 

Forewing with costal fold moderately broad. 

Basal blotch large or distinct. 

Basal blotch small or absent. 



Nota lepid. 26 (1/2); 47-57 



49 



8. Forewing with ground color brownish yellow 9 

- Forewing with ground color pale gray or creamy. 10 

9. Median fascia broken, not reaching posterior margin. C. owadai 

- Median fascia reaching posterior margin, with one line parallel to median fascia. 

C. rurinana 

10. Forewing distinctly expanded terminally, median fascia narrow. C. melissa 

- Forewing indistinctly expanded terminally. 1 1 

1 1 . Labial palpus whitish; head gray; subapical blotch large and distinct. C. provocata 

- Labial palpus ochreous with brown scales; head brownish; subapical blotch indistinct. 

C. zeuglodon 

12. Forewing with ground color pale. 13 

- Forewing with ground color dark. 14 

13. Forewing whitish, with spots among the pattern. C. luctuosana 

- Forewing slivery gray, without spots among the pattern. C. hohuanshanensis 

14. Forewing yellowish creamy, subapical blotch reaching apex. C. aerosana 

- Forewing brownish, subapical blotch small or not obvious, median 

fascia strongly broadened medially. C. neglectana 



Key to the Chinese species of Clepsis based on the male genital characters 

1 . Aedeagus smooth, without process or denticle. 2 

- Aedeagus with process or denticle. 6 

2. Uncus strong and thick. 3 

- Uncus slender, gradually tapering terminally; sacculus with ventral margin smooth. 

C. provocata 

3. Valva short, ovate; labis with two broad dentate lobes at both sides. C. owadai 

- Valva not ovate. 4 

4. Uncus straight apically, valva short, without lobated terminal part. C. luctuosana 

- Uncus rounded apically, valva elongate, with lobated terminal part. 5 

5. Uncus parallel laterally, rounded apically; aedeagus short and narrow. C. razowskii 

- Uncus distinctly broadened at middle, tapering terminally, aedeagus long and slender. 

C. laetornata sp. n. 

6. Aedeagus with dense ventral and dorso-lateral denticles, 
provided with long subterminal process on the left side; 

uncus broad and rounded apically. C. flavifasciaria sp. n. 

- Aedeagus without dense ventral denticles. 7 

7. Aedeagus with small dent. 8 
Aedeagus with large process. 1 1 

8. Valva elongate, with lobated terminal part. 9 
Valva somewhat ovate, without lobated terminal part. 1 

9. Uncus broad, tapering from before middle. C. rurinana 
Uncus broad at base, slender in distal half; sacculus with dentate ventral prominence. 

C. melissa 

10. Uncus long; aedeagus provided with one lateral and one ventral thorn. C. zeuglodon 
Uncus broad, aedeagus provided with some subterminal teeth laterally. C. hohuanshanensis 

1 1 . Aedeagus with long process on the right side. C. aba 
Aedeagus with process on the left side. 12 

12. Valva narrow, sacculus with distinct ventral prominence or denticle. 13 

- Valva broad, sacculus without ventral denticle. 14 

13. Uncus expanded from base to distal; ventral edge of sacculus with 

sharp prominence situated submedial ly. C. neglectana 

Uncus tapering postmedially, ventral edge of sacculus with 3-4 acute 

denticles; aedeagus thick, with two processes, left one larger than right one. C. celsana 

14. Uncus straight apically; aedeagus with long ventro-lateral process situated 

on the left side. C. aerosana 

Uncus rounded apically; aedeagus with subterminal denticle situated on the left side. 

C. pallidana 



50 



Wang, Li & Wang: Study on the genus Clepsis Guenée from China 




Figs. 2-3. Adults of Clepsis spp.: 2. Clepsis laetornata sp. n. 3. Clepsis flavifasciaria sp. n. 



Clepsis laetornata sp. n. (Figs. 2, 4) 

Material. Holotype: C? China: Weishan County (25.2 °N 100.3 °E), Yunnan Province, 2200 m, 20 Jul. 
2001, leg. Houhun Li and Xinpu Wang, genitalia slide no. WXP02182. Paratypes: 4Cf, same data as 
holotype. 

Description. M a 1 e (Fig. 2). Length of forewing 7.0-8.0 mm. Labial palpus 1.5 times 
shorter than diameter of compound eye; basal portion pale brownish, terminal portion 
of the second and the third segments whitish, third segment small, concealed in the ter- 
minal of second. Antenna slender, outer side whitish, inner side yellowish brown. 
Front white. Vertex with rough scales, yellowish brown. Thorax yellowish brown. 
Tegula developed. Forewing with ground color pale brown; basal blotch, median fas- 
cia and subapical blotch dark brown; basal portion of costal edge yellow-brown; 
costal fold broad, reaching median fascia; apex blunt; termen oblique; basal blotch 
finger-shaped; anterior portion of median fascia narrow, posterior portion broad; sub- 
apical blotch converse triangular; fringes with basal part pale white, distal part dark 
brown. Hindwing pale gray, termen somewhat yellow. Legs whitish, outer side of tarsi 
of foreleg, midleg and outer spur of midleg dark brown. Dorsal surface of abdomen 
pale brown, ventral surface pale yellow. 

Genitalia c? (Fig. 4). Tegumen broad. Uncus strong, distinctly broadened at 
middle, tapering terminally, rounded apically. Socius small. Lateral sclerite broad- 
ened. Arm of gnathos strong, rounded apically. Valva oblong, terminal portion with 
lobe. Sacculus narrow, slightly convex near base. Median part of labis broad and 
spined, terminal portion slender. Aedeagus thin, apically rounded, with three large 
cornuti in vesica. 

Female. Unknown. 
Diagnosis. The new species is similar to Clepsis melissa (Meyrick, 1908), but differs 
from the latter in the following characters: forewing with ground color light brown; 
uncus distinctly broadened at middle; sacculus without ventral prominence; aedeagus 
without ventro-lateral denticle.This species is also closely allied to Clepsis rurinana 
(Linnaeus), but can be distinguished from it by basal blotch on the surface of the 
forewing very large and distinct; uncus shorter and much stronger than that of the lat- 
ter species; aedeagus much slender, laterally without subterminal denticle. 



Notalepid. 26 (1/2): 47-57 



51 




Fig. 4. Male genitalia of Clepsis laetornata sp. n. (slide no. WXP02182) 

Derivatio nominis. The specific name comes from the Latin word, laetus (distinct) 
and ornatus (ornate), corresponding to the distinct basal blotch, median fascia and 
subapical blotch in the forewing. 



Clepsis flavifasciaria sp. n. (Figs. 3, 5, 6) 

Material. Holotype: Cf, China, Ningshan County (33.3 °N 108.3 °E), Shaanxi Province, 1650 m, 28 May 
1992, leg. Houhun Li, (slide no. WXP02186). Paratypes: lcf, 1Ç, same data as holotype. 

Description. Male (Fig. 3). Length of forewing 9.5 mm. Labial palpus 1.5 times as 
long as diameter of the compound eye; basal segment whitish; second segment long, 
pale brown; third segment small, whitish. Antenna thick, black, outer side with white 
scales, inner side ciliated. Front whitish. Vertex with rough scales, yellowish brown. 
Tegula developed. Forewing blackish brown, costal margin distinctly curved outwards 
to middle; brightly yellowish fascia below costal edge reaching subapical blotch; 
costal fold reaching 1/3 of costa, basally narrow, medially broad; apex pointed; ter- 
men distinctly oblique; basal blotch ill-defined; median fascia black, band-like, its 
anterior portion as wide as posterior portion; subapical blotch semicircular, black; 
fringes yellowish brown. Hindwing yellow, termen black; fringes pale brown. Tarsi of 
foreleg and midleg pale brown. Dorsal surface of abdomen pale brownish, ventral sur- 
face pale yellow. 



52 



Wang, Li & Wang: Study on the genus Clepsis Guenée from China 



Female. Length of forewing 10.5 mm, with yellow fascia below costal edge. 
Other characters same as male. 

Genitalia cf (Fig. 5). Tegumen broad; uncus strong, with basal half narrow, 
somewhat parallel laterally, distal half expanded, rounded apically. Socius vestigial. 
Arm of gnathos long and slender, terminal narrow. Valva narrow, weakly tapering ter- 
minally. Sacculus narrow, slightly convex before middle of ventral edge. Median part 
of labis broad, terminal part weakly tapering, dentate. Aedeagus large, densely with 
ventral and dorso-lateral denticles, provided with long subterminal process on the left 
side; no cornuti in vesica. 

Genitalia 9 (Fig- 6). Apophyses posterior almost as long as apophyses anteri- 
or, with a dent near base, highly sclerotized. Sterigma cup-shaped. Antrum long, scle- 
rotized. Ductus bursae thick, without cestum. Signum large, horn-shaped, inner side 
with small denticles. 




Fig. 5. Clepsis flavifasciaria sp. n., male genitalia (slide no. WXP02186). 



Diagnosis. This new species is closely allied to Clepsis unicolorana (Duponchel, 
1835) in male genitalia, but can be separated from the latter by the following character: 
in male genitalia, sacculus narrow; aedeagus densely with ventral and dorso-lateral 
denticles, provided with long subterminal process on the left side. In female geni- 
talia, signum horn-shaped. 



Notalepid. 26 (1/2): 47-57 



53 



Dériva tio nominis. The specific name is derived from the Latin word, flavus (yel- 
low) and fas ciarius (fascia), indicating the brightly yellowish fascia below costal edge 
in the forewing. 




Figs. 6-7. Female genitalia. 6. Clepsis ßavifasciaria sp. n. (slide no. WXP02187). 7. Clepsis aba (slide 
no. WXP02165). 



Clepsis aba Razowski, 1979a: 147, figs. 129, 130 (Fig. 7) 

Material. China: 5CT, 3 9, Ningshan County, Shaanxi Province, 1650 m, 15 20 June 1987, leg. Houhun 
Li, (slide no. WXP02 165). 



54 Wang, Li & Wang: Study on the genus Clepsis Guenée from China 

Description. Length of forewing 11.0-12.0 mm. 

Genitalia 9 (Fig. 7). Papilla analis broad; apophyses posterior about 1.5 times 
as long as apophyses anterior, heavily sclerotized. Sterigma broad. Antrum long, 
cylindrical, thick near ductus bursae. Ductus bursae thick. Cestum 1/3 as long as duc- 
tus bursae. Signum horn-shaped, small. 

Remarks. Razowski (1979) did not provide the description of the female in his paper. 
During our study, we found the female and described it here for the first time. 

Clepsis celsana (Kennel, 1919: 52, pi. 2 figs. 2, 3) (Cacoecid) 

Material. China: 3C?, Gongliu County, Xinjiang Aut. Reg., 1100 m, 6 June 1994, leg. Xincheng An. 

Remarks. The species is treated by Razowski (1979: 146, figs. 125-128, 213) and 
transferred to Clepsis. It is here recorded for the first time from China (Xinjiang). 

Clepsis neglectana (Herrich-Schäffer, 1851: 167) (Tortrix Lozotaenia) 

Tortrix flavana Duponchel, 1834: 87, pi. 239, fig. 6. 

Heterognomon betulifoliana Lederer, 1859: 248. 

Tortrix stiolana Ragonot, 1879: CXXXII. 

Tortrix xylotoma Meyrick, 1891: 13. . 

Tortrix severana Kennel, 1901: 227. 

Cacoecia delibatana Rothschild, 1912: 27, 49. 

Tortrix dorana Kennel, 1919: 60, pi. 2, fig. 12, pi. 4, fig. lb. 

Cacoecia acclivana Zerny, 1933: 108, pi. 1, fig. 11. 

Material. China: HCf, Gongliu County, Xinjiang Aut. Reg., 1100 m, 16 Jul. 1994, leg. Xincheng An; 
19, Beitun County, Xinjiang Aut. Reg., 530 m, 22 Jul. 1994, leg. Houhun Li; 2Cf , Ürümqi City, Xinjiang 
Aut. Reg., 920m, 8 Aug. 1994, leg. Houhun Li; 1Ç, Altay County, Xinjiang Aut. Reg., 900 m, 23 Jul. 
1994, leg. Houhun Li. 

Remarks. The species is treated by Razowski (1979a: 161, figs. 162-168, 225) and 
transferred to Clepsis. It is known to occur in Central Asia, Middle East, Europe and 
is here recorded for the first time from China (Xinjiang). 

Clepsis luctuosana (Rebel, 1914: 272, pi. 4 fig. 8) (Chephasia) 

Material. China: lCf , Altay County, Xinjiang Aut. Reg., 900 m, 23 Jul. 1994, leg. Houhun Li. 

Remarks. The species is treated by Razowski (1979a: 124, figs. 63, 64) and trans- 
ferred to Clepsis. It is known to occur in Central Asia (Tian shan) and here recorded 
for the first time from China (Xinjiang). 

Clepsis rurinana (Linnaeus, 1758: 823) (Phalaena Tortrix) 

Phalaena Tortrix modeeriana Linnaeus, 1761: 347. 
Phalaena Tortrix angulana Villers, 1789: 417, 612. 
Cacoecia idana Kennel, 1919: 51, pi. 2, fig. 1. 
Tortrix liotoma Meyrick, 1936: 60. 

Material. 3C?, Shexian County, Hebei Province, 700 m, 2-3 Jul. 2000, leg. Haili Yu; 4C?, 2Ç, Yixian 
County, Hebei Province, 150 m, 19 Jul. 2000, Haili Yu leg.; 1C?, Laiyuan County, Hebei Province, 1300 m, 
20 Jul. 2000, leg. Haili Yu; 4Cf, 1Ç, Jingxing County, Hebei Province, 1200 m, 23-26 Jul. 2000, leg. 
Haili Yu; 1C?, Neiqiu County, Hebei Province, 670 m, 28 Jul. 2000, leg. Haili Yu; lCf, Harbin City, 



Notalepid. 26 (1/2): 47-57 



55 



Heilongjiang Province, 150 m, 23 Jul. 1997, leg. Houhun Li; 6Cf , Heihe City, Heilongjiang Province, 
120 m, 25 Jul. 1997, leg. Houhun Li; 2Ç, Wudalianchi, Heilongjiang Province, 270 m, 30 Jul. 1997, leg. 
Houhun Li; IOC?, Tianmushan Mt., Zhejiang Province, 800 m, 19 Aug. 1999, leg. Houhun Li; 1C? , Yuexi 
County, Anhui Province, 8 Aug. 1995, leg. Xiangfu Hu; 6C?, Xinyang City, Henan Province, 1 1 Jul. 1997, 
leg. Houhun Li; 16Cf, 1Ç, Neixiang County, Henan Province, 650 m, 12 Jul. 1998; 2Cf, 2Ç, Shanxian 
County, Henan Province, 1 Jun. 2000, leg. Haili Yu; 23Cf, 8Ç, Jiyuan County, Henan Province, 650 m, 
3-7 Jun. 2000, leg. Haili Yu; 2C? , Dengfeng County, Henan Province, 800 m, 9 Jun. 2000, leg. Meicai 
Wei; lOCf, 4Ç, Lichuan City, Hubei Province, 1100 m, 2 Aug. 1999, leg. Houhun Li; lCf, Hefeng 
County, Hubei Province, 1260 m, 18 Jul. 1999, leg. Houhun Li; 5C?, Sangzhi County, Hunan Province, 
1250 m, 13 Aug. 2001, leg. Houhun Li and Xinpu Wang; 29C?, 10Ç, Fanjingshan Mt., Guizhou Province, 
1300 m, 1 Aug. 2001, leg. Houhun Li and Xinpu Wang; 30C?, Chengxian County, Shaanxi Province, 
1000 m, 9-12 Jun. 1993, leg. Houhun Li; lief, 4Ç, Louguantai, Shaanxi Province, 650 m, 11-15 May 
1995, leg. Aisihaer; lOCf, 2Ç, Yuzhong County, Gansu Province, 2120 m, 30-31 Jul. 1993, leg. Houhun 
Li; 4C?, 2Ç, Kangxian County, Gansu Province, 2-5 Jun. 1995, leg. Aisihaer; 2Cf, Wenxian County, 
Gansu Province, 1950 m, 4-5 Jul. 2001, leg. Houhun Li and Xinpu Wang; 5Cf, 4Ç, Xunhua County, 
Qinghai Province, 2240 m, 13-15 Jul. 1995, leg. Houhun Li; 3C?, 49, Jingyuan County, Ningxia Aut. 
Region, 13-17 Jul. 1983. 

Remarks. The species is treated by Razowski (1979a: 129, figs. 81, 82, 198) and 
transferred to Clepsis. It is known from China (Hebei, Heilongjiang, Anhui, Zhejiang, 
Henan, Hubei, Hunan, Guizhou, Shaanxi, Gansu, Qinghai and Ningxia), Mongolia, 
Korea, Japan, Indian, Nepal, Afghanistan, Siberia and Europe. 

Clepsis pallidana (Fabricius, 1776: 292) (Pyralis) 

[Tortrix] strigana Hübner, [1799]: pi. 22, fig. 141. 
Tortrix Lozotaenia stramineana Herrich-Schäffer, 1851: 163. 
Tortrix quinquemaculana Bremer, 1864: 90, pi. 7, fig. 23. 
Tortrix cesareana Joannis, 1891: LXXXIII. 
Tortrix districta Meyrick, 1920: 342. 

Material. 5Cf, 6Ç>, Tianjin, 31 May-2 Jul. 1965; 8C?, 1Ç, Jixian County, Tianjin, 550 m, 23-25 Jun. 
2001, leg. Houhun Li; 1C?, Zunhua City, Hebei Province, 120 m, 7 Jul. 2001, leg. Yanli Du; 1Ç, 
Dongwuzhu Banner, Inner Mongolia, 920 m, 8 Aug. 1997, leg. Houhun Li; lCf, Heihe City, Heilongjiang 
Province, 120 m, 25 Jul. 1997, leg. Houhun Li; 1 8CT, 8Ç, Yangling, Shaanxi Province, 450 m, Date from 
3 May 1985 to 31 Aug. 1995, leg. Houhun Li; 2Cf, Xunyi County, Shaanxi Province, 30 May 1985, leg. 
Houhun Li; 4Cf, Chengcheng County, Shaanxi Province, 10-11 Aug. 1993, leg. Houhun Li; 3(7, 
Danfeng County, Shaanxi Province, 28-29 May 1994, leg. Jin Zhou; 1(J, 1 9, Kangxian County, Gansu 
Province, 1200 m, 2-3 Jun. 1995, leg. Aisihaer; 7C?, 3 9, Zhongning County, Ningxia Aut. Reg., 26 Jul. 
1993, leg. Houhun Li; 2C?, Ürümqi, Xinjiang Aut. Reg., 920 m, 8 Aug. 1994, leg. Houhun Li; 1 9, Jinghc 
County, Xinjiang Aut. Reg., 23 Jul. 1994, leg. Duoliken. 

Remarks. The species is treated by Razowski (1979a: 149, figs. 133-135, 215) and 
transferred to Clepsis. It is known to occur in China (Tianjin, Hebei, Inner Mongolia, 
Heilongjiang, Shaanxi, Gansu, Ningxia, Xinjiang), Mongolia, Korea, Japan, Asia 
Minor, Russia and Europe. 

Clepsis melissa (Meyrick, 1908: 613) {Capua) 

Capua epiclintes Meyrick, 1928: 452. 

Material. China: 1CT, Kangtling County, Sichuan Province, 2400 m, <X Jul. 2001, leg. Houhun Li and 
Xinpu Wang. 

Remarks. The species is treated by Diakonoff (1976: 98) and Razowski (1979a: 131, 
figs. 83-87, 199, 200) and transferred to Clepsis. It is known to occur in China 
(Sichuan, Yunnan), Nepal and India. 



_ Wang, Li & Wang: Study on the genus Clepsis Guenée from China 

Clepsis aerosana (Lederer, 1853: 383, pi. 7, fig. 1) (Tortrix) 

Remarks. The species is treated by Razowski (1979a: 113, figs. 24-29, 183) and 
transferred to Clepsis. It is known to occur in China (Xingjiang), Mongolia, Russia 
(Razowski 1993). 

Clepsis zeuglodon Razowski, 1979a: 165, figs. 176-178 

Remarks. The species is known from China (Zhejiang) (Razowski 1979a). 

Clepsis razowskii Kawabe, 1992: 178, figs. 14, 20, 21, 30 
Remarks. The species is known from China (Taiwan) (Kawabe 1992). 

Clepsis owadai Kawabe, 1992: 180, figs. 15, 22, 31 

Remarks. The species is known from China (Taiwan) (Kawabe 1992). 

Clepsis hohaunshanensis Kawabe, 1985: 5. figs. 7, 8, 9, 15 

Remarks. The species is known from China (Taiwan) (Kawabe 1992). 

Clepsis provocata (Meyrick, 1912: 1) (Catamacta) 

Remarks. The species is treated by Razowski (1979b: 137. figs. 62, 93) and trans- 
ferred to Clepsis. It is known from China (Taiwan), India (Assam) (Razowski 1979b). 

References 

Bremer, O. 1864. Lepidopteren Ost-Sibiriens, insbesondere des Amur-Landes, gesammelt von den 
Herren G. Radde, R. Maack und R WulfFius. - Memoirs de l'Académie des Sciences de St.-Péters- 
bourg (ser. 7) 8 (1): 1-104, pis. 1-8. 

Byun, B. K., Y. S. Bae & K. T. Park 1998. Illustrated Catalogue of Tortricidae in Korea (Lepidoptera). - 
In: K. T. Park (ed.), Insects of Korea [2], 3 17 pp. Korea. 

Clarke, J. R G. 1958. Catalogue of the type specimens of Microlepidoptera in the British Museum 
(Natural History) described by Edward Meyrick, Vol. 3, 599 pp. London. 

Clemens, B. 1860. Contributions to American Lepidopterology. No. 6. - Proceedings of the Academy of 
Natural Sciences of Philadelphia 12: 345-362. 

Diakonoff, A. 1947. Microlepidoptera from Madagascar. - Memoirs de l'Institut Scientifique de Mada- 
gascar (A) 1(1): 22-30, figs. 8. 

Diakonoff, A. 1955. Lepidoptera of the Deutschen Nepal-Expedition. - Veröffentlichungen der Zoologi- 
schen Staatssammlung München 8: 43-50, fig. I, pis. 24-26. 

Diakonoff, A. 1976. Tortricoidea from Nepal, 2. - Zoologische Verhandelingen 144: 1-145. 

Diakonoff, A. 1983. Tortricidae from Atjeh, Northern Sumatara (Lepidoptera). - Zoologische Verhande- 
lingen 204: 1-132. 

Duponchel, P.A.J. 1834. Nocturnes. -In: J.B. Godart & P.A.J. Duponchel, Histoire Naturelle des Lépi- 
doptères ou Papillons de France 9: 1-627, pis CCXXXVII-CCLXVI. Paris, Mequignon-Marvis. 

Fabricius, J.C. 1776. Genera insectorum eorumque characteres naturales secundum numerum, figuram, 
situm et proportionem omnium partim oris adiecta mantissa specierum nuper detectrum.. 310 pp. 
Cologne 

Guenée, M. A. 1845. Essai sur une nouvelle classification des Microlépidoptères et catalogue des espèces 
européennes connues jusqu'à ce Jour. -Annales de la Société Entomologique de France (sér. 2) 3: 
105-192,297-344. 



Notalepid. 26 (1/2): 47-57 57 



Herrich-Schäffer, G.A.W. (1847-) 1849 (-1855). Systematische Bearbeitung der Schmetterlinge von 
Europa, zugleich als Text, Revision und Supplement zu Jakob Hübner's Sammlung europäischer 
Schmetterlinge. 4: Die Zünsler und die Wickler. - [l]-2-288, (Index) [l]-2-48, pl. 1-23 (Pyrali- 
dides) + 1-59 (Tortricides). 

Hübner, J. [1799]. Tortrices. - Sammlung europäischer Schmetterlinge 7: pis. 1-29. 

Joannis, J. 1891. [Untitled.] Bulletin de la Société entomologique de France 1891: LXXIX-LXXXIV 

Kawabe, A. 1982. Tortricidae. -In: H. Inoue et al. (eds.), Moths of Japan. 1: 966 pp, 2: 522 pp. Tokyo. 

Kawabe, A. 1985. Notes on the Tortricidae (Lepidoptera) from Taiwan, 1. - Tinea 12 (1): 1-10. 

Kawabe, A. 1992. Notes on the Tortricidae (Lepidoptera) from Taiwan, 4. - Tinea 13 (17): 178-181. 

Kawabe, A. et al. 1992b. Title. - In: J. B. Heppner & H. Inoue (eds.), Lepidoptera of Taiwan 1 (2): 
Checklist. 276 pp. Gainesville. 

Kennel, J. 1901. Neue Wickler des palaearctischen Gebietes. - Deutsche entomologische Zeitschrift Iris 
13(1900)2:205-305. 

Kennel, J. 1919. Mittelasiatische und andere neue Tortriciden. - Mitteilungen der Münchener Entomolo- 
gischen Gesellschaft 8 (1917-1918): 50-95, pis. 2-A. 

Lederer, J. 1853. Lepidopterologisches aus Sibirien. - Verhandlungen der Zoologisch-Botanischen 
Gesellschaft in Wien 3 (Abhandlungen): 351-386, pis. 1-7. 

Lederer, J. 1859. Classification der europäischen Tortriciden. - Wiener Entomologische Monatschrift 3: 
241-255. 

Linnaeus, C. 1758. Systema naturae per régna tria naturae, secundum classes, ordines, genera, species, 
cum characteribus, differentiis, synonymis, locis, 1 [10th edition]: 1-824. 

Linnaeus, C. 1761. Fauna Svecica. 1-560. Laurentii Salvii, Stockholmiae. 

Liu, Y. Q. J. W. Bai 1977. Economic Entomology of China, 11, Lepidoptera, Tortricidae. 93 pp. Beijing. 

Meyrick, E. 1891. A fortnight in Algeria, with descriptions of new Lepidoptera. -Entomologist's 
Monthly Magazine 27: 9-13. 

Meyrick, E. 1908. Descriptions of Indian Micro-Lepidoptera VII. - Journal of the Bombay Natural 
History Society 18: 613-638. 

Meyrick, E. 1912. Exotic Microlepidoptera. 1: 1 64. - [London], Taylor & Francis. 

Meyrick, E. 1920. Exotic Microlepidoptera. 2: 289-384. - [London], Taylor & Francis. 

Meyrick, E. 1928. Exotic Microlepidoptera. 3: 449-464. - [London], Taylor & Francis. 

Meyrick, E. 1936. Exotic Microlepidoptera. 5: 1-64. - [London], Taylor & Francis. 

Mutuura, A. 1980. A new species of Clepsis from the Northern Yukon Territory (Lepidoptera: Tortri- 
cidae). - Canadian Entomologist 112: 1071-1073. 

Obraztsov, N.S. 1954, Die Gattungen der palaearktischen Tortricidae. I Allgemeine Aufteilung der 
Familie und die Unterfamilien Tortricinae und Spargnothinae. I. Fortsetzung. - Tijdschrift voor Ento- 
mologie 97(3): 141-231, figs. 1-248. 

Ragonot, E.L. 1879. [Untitled.] Bulletin de la Société entomologique de France 1879: CXXXII-CXXXIII. 

Razowski, J. l979a. Revision of the Clepsis Guenée (Lepidoptera, Tortricidae). Part I. - Acta zoologica 
cracoviensia 23 (9): 101-198. 

Razowski, J. 1979b. Revision of the Clepsis Guenée (Lepidoptera, Tortricidae). Part II. - Acta zoologica 
cracoviensia 24 (2): 113-152. 

Razowski, J. 1987. The Genera of Tortricidae (Lepidoptera). Part II: Palaearctic Childanotinae and Tor- 
tricinae. -Acta zoologica cracoviensia 30 (1 1) : 141-355. 

Razowski, J. 1993. The catalogue of the species of Tortricidae (Lepidoptera). Part II: Palaearctics, 
Spargenothini, Euliini, Ramapesiini and Archipini. - Acta zoologica cracoviensia 35 (3): 665 703. 

Razowski, J. 2001. Die Tortriciden (Lepidoptera, Tortricidae) Mitteleuropas. 319 pp. Bratislava. 

Rebel, H. 1914. Ueber eine Mikrolcpidoptcrcnausbcutc aus dem westlichen Thian-Shan-Gebiet. 
Deutsche entomologische Zeitschrift Iris 28: 271 278, pl. 4. 

Rothschild, L.W. 1912. Adatok Magyarorszâg lepkcfaunâjâhoz. Rovartani Lapok 19: 21 29. 

Villers, C. J. 1789. Caroli Linnaei Entomologia, Faunae Succicac descriptionibus aueta; D.D. Scopoli, 
Geoffroy, de Geer, Fabricii, Schrank, ec. Spcciebus vel in Systcmate non enumerates, vel nuperrime 
detectis, vel speciebus Galliac Australis locupletata, generum specierumque rariorum iconibus orna 
menta; curante & augente Carolo de Villcrs. 2: xvi+656 s., 6 Taf Lugdum. 

Zerny, H. 1933. Lepidopteren aus dem nördlichen Libanon. Deutsche entomologische Zeitschrift Iris 
47:60-109, pl. 1. 



Notalepid. 26 (1/2): 59-63 



59 



Pyraloidea specimens labelled as Rebel types from Egypt at 
the National Museum of Natural History, Smithsonian 
Institution, Washington, D.C. 

M. Alma Sons 

Systematic Entomology Laboratory, PSI, Agriculture Research Service, USDA, Smithsonian 
Institution, P.O. Box 37012, National Museum Natural History, E-517, MRC 168, Washington, DC 
20013-7012; e-mail: asolis@sel.barc.usda.gov 

Abstract. The Anastase Alfieri collection from Egypt, acquired by the National Museum of Natural 
History (USNM), Smithsonian Institution, Washington, D.C., in 1965, included 5 pyraloid specimens 
labelled as types described by Rebel (1927): Piletocera opacalis, Pseudosyria gracilis, Heterographis 
acrobasella, Acrobasis pumilella, and Trachypteryx acanthotecta. The specimens are figured and the 
nomenclatural status of each species in the literature is described. There is a specimen of T. acanthotec- 
ta labelled as holotype in the USNM, but this was not been designated in the original description; and 
the subsequently designated lectotype is located at the Natural History Museum in Vienna. The follow- 
ing biological data is available: Pseudosyria gracilis eclosed from a stem of Lavandula pubescens 
(Lamiaceae) as indicated on the label data; and T. acanthotecta eclosed from a case on Acacia tortilis 
(Forssk.) Hayne (Fabaceae) as stated in the original description. Information about these specimens is 
provided to the lepidopterists' community for utilization in future systematic research. Types are not des- 
ignated. 

Key words. Pyraloidea, type depository, Anastase Alfieri, Egypt, host plant records, nomenclatural 
changes, type status. 



Introduction 

Rebel (1927) described many new Egyptian Microlepidoptera species from the 
collections of Adolf Andres and Anastase Alfieri. In 1965 the National Museum of 
Natural History (USNM), Smithsonian Institution, Washington, D.C. acquired the 
insect collection of Anastase Alfieri, who was with the Ministry of Egyptian 
Agriculture. The Alfieri collection included 5 pyraloid specimens labelled as types. 
None of the handwriting on the labels resemble the reproduction of a Rebel label pre- 
sented by Horn et al. (1990: pi. 26 fig. 20). 

Rebel (1927) stated that voucher specimens were deposited in the Alfieri collec- 
tion in Cairo and the Natural History Museum in Vienna (NHMW). According to 
Horn et al. (1990) the Coleoptera of the Alfieri collection is said to be at the Museum 
Frey in Tutzing near Munich (now Basel), and no mention is made of the Lepidoptera 
collection. Presumably the pyraloid specimens came to the United States long before 
the publication of Horn et al. (1990). The Alfieri collection has long since been incor- 
porated into the main USNM Lepidoptera collection. 

These five specimens labelled as types arc figured here and the text of the labels 
is given to inform the Lepidoptera community that they are deposited at the National 
Museum of Natural History for confirmation and utilization in future systematic 
research. The current nomenclatural status of each species group taxon is given 
according to published data, and further determination is left for researchers con- 



Nota lepidopterologica. 30.10.2003, ISSN 0342-7536 



60 



Solis: Pyraloidea labelled as Rebel types at the U. S. National Museum of Natural History 




Figs. 1-5. Habitus of Rebel types. 1. Piletocera opacalis. 2. Pseudosyria gracilis. 3. Heterographis 
acrobasella. 4. Acrobasis pumilella. 5. Trachypteryx acanthotecta. 



ducting revisionary work on these taxa. The nomenclatural status of the specimens 
considered is not determined nor designated herein. For unresolved type problems 
concerning Rebel species descriptions, future workers should examine the Pyraloidea 
material of both, the Natural History Museum in Vienna and the National Museum of 
Natural History in Washington. 



Nota lepid. 26 (1/2): 59-63 61 

Results 

Crambidae: Spilomelinae 

Piletocera opacalis Rebel, 1927:186-187 (Fig. 1). The original description states 
"Drei Stücke, davon eines mit Bezeichnung Bacos (Andres)" (three specimens of 
which one is labelled "Bacos"), and does not state the sex of the specimens upon 
which the name of the species is based; the specimen figured here is a female. Text of 
labels: "Sakka, at / camp, 10.11.22" (handwrtten with black ink on beige paper); 
"Coll. Alfieri | Egypte" (printed with black ink on beige paper); "Philitocera [sic] | 
opacalis n. sp | DET. REBEL, TYPE' (handwritten and "DET. REBEL" printed with 
black ink on beige paper); "Anastase Alfieri | Collection | 1965" (printed with black 
ink on white paper with a broad red stripe on the bottom half of the label). 

Pyralidae: Phycitinae 

Pseudosyria gracilis Rebel, 1927:180-182 (Fig. 2). The original description gives 
the following information: Two male specimens from "Wadi Hof 19.iii.[19]15"; the 
specimen figured here is a male. A lectotype was designated by Roesler (1973: 661) 
and deposited at the Natural History Museum V